Remise en question:notre vrai dieu n’a jamais été la religion.!!

En 325, au concile de Nicée, Constantin le Grand, créa l’église catholique après un génocide de 45 000 chrétiens, où il les tortura pour renoncer à la réincarnation. En même temps, des livres religieux de tous les villages de l’empire sont collectés et créent ainsi la BIBLE.
En 327, Constantin, connu sous le nom d’empereur de Rome, ordonne à Jérôme de traduire la version Vulgate en latin, changeant les noms hébreux et adultères qui s’appelèrent les Écritures.
En 431, le culte de la VIERGE a été inventé.
En 594, le PURGATOIRE a été inventé.
En 610, le titre de PAPE a été inventé.
En 788 le culte a été imposé aux journaux intimes païens.
En 995 la signification de kadosh (section) a été changée pour le tître de saint.
En 1079, le célibat des prêtres est imposé .
En 1090 le Rosaire est imposé.
En 1184, l’Inquisition a été perpétrée.
Dans les années 1190, les indulgences étaient vendues.
En 1215, la confession a été imposée aux prêtres.
Innocent III, le pape absolu
Innocent III
En 1216, le conte du pape Innocent sur la terreur du pain (un dieu de la mythologie grecque), qui devient chair humaine, a été inventé.
En 1311 le baptême est imposé.
En 1439, le PURGATOIRE inexistant a été dogmatisé.
En 1854, l’immaculée conception a été inventée.
En 1870, l’absurdité d’un pape infaillible s’impose, dans laquelle le concept de recrutement est inventé.
Il y a plus de 2500 choses inventées par cette religion pour asservir les êtres humains avec le christianisme..
Les religions et leurs dieux ont été créés comme un moyen de MANIPULATION et d’AFFAIRE. Dans le cadre de l’ÉVOLUTION de l’être humain est la LIBÉRATION de ces moyens de manipulation. Même si petit à petit l’humanité est à l’ère du RÉVEIL, les jeunes tous les jours sont moins religieux deux générations de plus et la religion catholique sera dans son crépuscule. (Je veux voir ce moment)
Tout fera partie de notre ÉVOLUTION.
C’est à vous de continuer à croire ce que vous croyez maintenant être la vérité absolue parce que vous ne vous êtes pas remis en question……
Donc  remets-toi en question et tu verras que toutes les religions sont une invention…. de l’homme.
Ce qu’il faut croire:c’est aux message d’amour,de paix et la philosophie de vie de Jésus Christ,de Mahomet et de Bouddha!
L’histoire humaine ne fait que commencer!

EN COMPLÉMENTAIRE

1215 INNOCENT III ET LE CONCILE DE LATRAN IV
Le pape Innocent III (1198-1216) réunit à Rome en 1215 un concile œcuménique (le quatrième siégeant au Latran) pour instituer une réforme de l’Église et de la société chrétiennes face aux hérétiques, aux musulmans et aux juifs. (Voir « L’antijudaïsme dans l’Europe chrétienne ».)Ce concile œcuménique fréquenté par 404 évêques venus de toute l’Église occidentale et de l’Église orientale de rite latin, un très grand nombre d’abbés, chanoines et représentants du pouvoir civil édicta les mesures sur l’ensemble de l’activité spirituelle et sociale des clercs et des laïcs, notamment sur le célibat et les mœurs des prêtres, l’élection des évêques, la perception des dîmes, le droit canon, le mariage. Le décret 21 rendit obligatoire la confession individuelle. Cette mesure, prise en charge surtout par les nouveaux ordres religieux, dominicains et franciscains, fut assez rapidement respectée par tous, avec ses compléments, l’attachement des fidèles à leurs paroisses et à leurs curés, le respect absolu par les prêtres du secret de la confession.La décision de Latran IV révolutionna les habitudes du clergé (des manuels initièrent les curés à cette nouvelle charge) et de l’ensemble des fidèles : examen de conscience, repentir, pénitence. L’examen de conscience inaugura une sensibilité et des pratiques qu’on peut considérer comme une formation à des attitudes propres à l’héritage occidental : l’introspection
et une technique d’exonération du poids des malaises existentiels .

UNE INVITATION À VISITER NOS BOUTIQUES EN LIGNE

D’énormes « chiens-ours » peuplaient les Pyrénées il y a 12 millions d’années

Une mandibule fossilisée mise au jour dans les Pyrénées-Atlantiques en France appartient à une espèce d’amphicyonidés inconnue à ce jour, affirment des paléontologues associés au Musée d’histoire naturelle de Bâle, en Suisse.

Mieux connus sous le nom de chiens-ours», les amphicyonidés forment une famille éteinte de grands mammifères carnivores. Ces animaux étroitement apparentés aux canidés peuplaient une bonne partie de l’hémisphère Nord.

Apparus à l’éocène (il y a 36 millions d’années) et disparus au miocène moyen (il y a 7,5 millions d’années), ils représentent l’un des groupes de prédateurs les plus caractéristiques de l’ancienne faune européenne.

Tartarocyon cazanavei
Leur masse corporelle variait de 9 à 320 kg et leur régime alimentaire était typiquement mésocarnivore, omnivore, broyeur d’os et hypercarnivore», note le paléontologue Bastien Mennecart dans un communiqué publié par le musée.
La mandibule a été mise au jour dans la petite commune de Sallespisse, dans le département des Pyrénées-Atlantiques, dans le sud-ouest de la France. Elle a été extirpée d’un dépôt marin vieux de 12 à 12,8 millions d’années.
La mandibule a été mise au jour dans un dépôt marin vieux de 12 à 12,8 millions d’années.

Les scientifiques ont été frappés par la dentition de la mâchoire inférieure.

L’équipe a nommé la bête Tartarocyon cazanavei, nom inspiré du personnage de Tartaro, un borgne géant de la mythologie basque.

La masse corporelle d’un Tartarocyon est estimée à 200 kg, ce qui en fait l’un des plus gros prédateurs qui vivaient sur le territoire européen au miocène.

Les découvertes de fossiles de vertébrés terrestres qui vivaient il y a 13 à 11 millions d’années dans le nord des Pyrénées sont très rares, note le communiqué. Cette découverte et la description de la mâchoire inférieure sont d’autant plus importantes. Elles offrent l’occasion de mieux comprendre l’évolution des chiens-ours européens dans le contexte environnemental de l’époque.»

Le détail de ces travaux est publié dans la revue PeerJ (en anglais).

Holotype de Tartarocyon cazanavei de Sallespisse, France, en vues occlusale, linguale et labiale. Barre d’échelle – 5 cm. Crédit image : Sole et al ., doi : 10.7717/peerj.13457.

N’OUBLIEZ PAS DE VISITER NOS BOUTIQUES EN LIGNE QUI SOUTIENNENT NOS SITES WEB EN DÉVELOPPEMENT
Sur ces liens:

La Criminelle Arnaque du COVID-19:Le département de la Défense des États-Unis a attribué un contrat pour la «recherche sur la COVID-19» en Ukraine 3 mois avant même que l’existence la Covid ne soit connue

Le monde a commencé à entendre parler d’un nouveau coronavirus au début de janvier 2020, avec des rapports faisant état d’une nouvelle pneumonie présumée comme une maladie se propageant à Wuhan, en Chine. Cependant, le monde n’a réellement connu la Covid-19 qu’en février 2020, car ce n’est que le 11 de ce mois que l’Organisation mondiale de la santé a officiellement nommé la nouvelle maladie à coronavirus, la Covid-19.

Donc, ceci étant la vérité officielle, pourquoi les données du gouvernement des États-Unis montrent-elles que le département américain de la Défense (DOD) a attribué un contrat le 12 novembre 2019 à Labyrinth Global Health INC. pour la «recherche COVID-19», au moins un mois avant l’émergence présumée du nouveau coronavirus, et trois mois avant qu’il ne soit officiellement surnommé [virus de la] Covid-19 (Coronavirus Desease 2019 ] ?

 

Cependant, les résultats choquants ne s’arrêtent pas là. Le contrat attribué en novembre 2019 pour la «recherche COVID-19» n’était pas seulement chargé de se dérouler en Ukraine, il faisait en fait partie d’un contrat beaucoup plus vaste pour un «programme de réduction des menaces biologiques en Ukraine».

Cela explique peut-être pourquoi Labyrinth Global Health collabore avec l’EcoHealth Alliance de Peter Daszak et Metabiota d’Ernest Wolfe depuis sa création en 2017.

Le gouvernement des États-Unis a un site Web appelé  » USA Spending » , une source officielle de données ouvertes sur les dépenses fédérales. Selon le site, au 12 avril 2021, le gouvernement américain a dépensé un montant époustouflant de 3630 milliards de dollars « en réponse à la COVID-19 ». Mais ce ne sont pas les seules informations sur Covid qui peuvent être trouvées sur le site.

Cachés dans la « recherche d’attribution », se trouvent des détails sur un contrat attribué par le ministère de la Défense à une société nommée  » Black & Veatch Special Projects Corp » , qui serait « une société mondiale d’ingénierie, d’approvisionnement, de conseil et de construction spécialisée dans le développement d’infrastructures ».

Le contrat a été attribué le 20 septembre 2012 et est décrit comme « Services professionnels, scientifiques et techniques ». Évidemment, c’est très vague et très probablement de peu d’intérêt pour quiconque tombe dessus. Mais il y a quelque chose de profond dans les détails qui devrait intéresser tout le monde.

L’« Historique des attributions » du contrat contient un onglet pour les « Sous-attributions » détaillant les bénéficiaires, la date d’action, le montant et une très brève description pour 115 transactions de sous-attribution. La plupart des sous-prix sont extrêmement banals pour des choses telles que « l’équipement de laboratoire pour Kiev » ou « le mobilier de bureau pour Kiev ».

Mais il y a un sous-prix qui se démarque parmi les autres, et il a été décerné à Labyrinth Global Health INC pour « SME Manuscript Documentation and COVID-19 Research ».

Un prix pour la recherche sur la Covid-19 n’est pas vraiment choquant alors que le monde est prétendument en proie à une pandémie de Covid-19, mais compte tenu du fait que le contrat de sous-traitance a été attribué le 12 novembre 2019, au moins un mois avant l’émergence présumée de le nouveau coronavirus, et trois mois avant qu’il ne soit officiellement surnommé Covid-19 [Coronavirus Desease 2019 ], le prix de la recherche sur la Covid-19 devrait être un choc pour tout le monde.

Mais le choc ne s’arrête pas là, car le lieu où le contact pour la recherche sur Covid-19 a été chargé d’avoir lieu était l’Ukraine, tout comme l’ensemble du contrat attribué par le DOD à Black & Veatch Special Projects Corp.

Les détails du contrat trouvés sur le site « USA Spending » révèlent en fait que le département spécifique du DOD qui a attribué le contact était la Defense Threat Reduction Agency (DTRA). Le contrat a été attribué le 20 septembre 2012 et conclu le 13 octobre 2020.

Bien que les détails soient vagues, le site du gouvernement américain révèle également que 21,7 millions de dollars sur les 116,6 millions de dollars de contact ont été dépensés pour un « programme de réduction des menaces biologiques en Ukraine ».

Pourquoi le ministère de la Défense a-t-il payé une entreprise qui est prétendument « une société mondiale d’ingénierie, d’approvisionnement, de conseil et de construction spécialisée dans le développement d’infrastructures », pour l’aider à mettre en œuvre un « programme de réduction des menaces biologiques en Ukraine » ?

Et pourquoi le DOD et ladite société ont-ils ensuite payé Labyrinth Global Health INC pour mener des recherches sur la COVID-19 en Ukraine au moins un mois avant l’émergence présumée du nouveau coronavirus, et trois mois avant qu’il ne soit officiellement surnommé Covid-19 ?

Fondée en 2017, Labyrinth Global Health serait une « petite entreprise détenue par des femmes avec une expertise approfondie et une expérience éprouvée dans le soutien d’initiatives pour le progrès scientifique et médical ».

Elle se décrit comme  » une organisation multiculturelle et internationale avec des bureaux dans quatre pays et une équipe d’experts aux parcours et compétences divers, notamment en microbiologie, virologie, santé mondiale, soins infirmiers en maladies infectieuses émergentes, anthropologie médicale, épidémiologie de terrain, recherche clinique, et les systèmes d’information sur la santé. »

Il se trouve que l’un de ces bureaux se trouve à Kiev, en Ukraine, que la société qualifie de «porte d’entrée vers l’Europe de l’Est».

L’équipe de direction de Labyrinth Global se compose de Karen Saylors, PHD, qui est la directrice générale ; Mary Guttieri, PHS, qui est la directrice scientifique ; et Murat Tartan qui est le directeur financier.

Karen Saylors, PhD, qui a cofondé Labyrinth Global Health, aurait travaillé dans le domaine de la santé publique internationale pendant plus d’une décennie et a passé de nombreuses années à vivre en Afrique pour établir des réseaux de surveillance mondiaux, « travailler avec des partenaires pour améliorer la politique de santé mondiale sur la détection, la réponse et le contrôle des maladies infectieuses ».

Au Labyrinthe, le Dr Saylors se spécialise dans les études qui visent à comprendre et à atténuer le risque biologique et comportemental de transmission de maladies. Le Dr Saylors a travaillé avec le réseau d’essais cliniques de l’Université d’Oxford au Vietnam sur la recherche sur la surveillance des maladies zoonotiques et continue de coordonner avec des partenaires régionaux les épidémies émergentes dans les populations animales et humaines.

Mais avec qui le Dr Karen Saylors et Labyrinth Global Health choisissent-ils de travailler ? Ce ne sont autres que « Eco Health Alliance » et « Metabiota ».

Le Dr Karen Saylors, Eco Health Alliance et Metabiota ont travaillé ensemble sur le programme « PREDICT » de l’Agence des États-Unis pour le développement international (USAID) à partir de 2009, tandis que Labyrinth Global Health a travaillé aux côtés de l’EHA et de Metabiota sur le programme PREDICT à partir de 2017.

Lancé en 2009 et financé par l’USAID, PREDICT était un système d’alerte précoce pour les maladies nouvelles et émergentes dans 21 pays. Il a été dirigé par le Davis One Health Institute de l’Université de Californie («UC») et les principaux partenaires comprenaient EcoHealth Alliance («EHA»), Metabiota, Wildlife Conservation Society et Smithsonian Institution, et comme nous venons de le révéler; Santé globale du labyrinthe. PREDICT a été un précurseur du projet plus ambitieux Global Virome.

L’USAID décrit PREDICT comme ayant apporté  » des contributions significatives au renforcement des capacités mondiales de surveillance et de diagnostic en laboratoire pour les virus connus et nouvellement découverts au sein de plusieurs groupes de virus importants, tels que les filovirus (y compris les virus Ebola), les virus de la grippe, les paramyxovirus et les coronavirus  » .

Voici l’une des nombreuses études publiées par Eco Health Alliance, Metabiota et Labyrinth Global Health prouvant le lien –

PREDICT s’est associé à l’Eco Health Alliance (EHA) à but non lucratif pour mener à bien ses efforts de 9 ans pour cataloguer des centaines de milliers d’échantillons biologiques,  » dont plus de 10 000 chauves-souris  » . Une étude financée par PREDICT en 2015 sur la « diversité des coronavirus chez les chauves-souris » comprenait également Peter Daszak, président de l’EHA, parmi ses participants.

Eco Health Alliance est répertorié comme partenaire de l’Institut de virologie de Wuhan (« WIV ») sur les pages archivées de son site Web et a été mentionné comme l’un des « partenaires stratégiques » de l’institut par le directeur général adjoint du WIV en 2018.

Notamment, la relation entre le WIV et l’établissement américain de biodéfense a été avancée par le conseiller politique de l’EHA, David R. Franz, ancien commandant du laboratoire américain d’armes biologiques à Fort Detrick.

Le Dr Shi Zhengli de WIV, alias « Batwoman », avait également travaillé avec Daszak de l’EHA sur des études liées aux chauves-souris. Dès 2005, Daszak et Zhengli menaient des recherches sur les coronavirus de type SRAS chez les chauves-souris. Plusieurs études financées par PREDICT sur les coronavirus de type SRAS et la grippe porcine comptent à la fois sur les contributions de Zhengli et de Daszak. La plus remarquable d’entre elles est peut-être une étude financée par PREDICT et NIH en 2015, qu’elle a co-écrite et intitulée : « Un groupe de coronavirus circulants de chauve-souris de type SRAS montre un potentiel d’émergence humaine ».

Pendant ce temps, Nathan Wolfe est le fondateur de Metabiota et de l’organisation à but non lucratif Global Viral. Il a passé plus de huit ans à mener des recherches biomédicales en Afrique subsaharienne et en Asie du Sud-Est. Sans surprise, le juif Wolfe est un  leader mondial du Forum économique mondial. Plus particulièrement, depuis 2008, il était membre du DSRC (Defense Science Research Council) de la DARPAjusqu’à sa dissolution.

Toutes ces personnes et organisations travaillent depuis au moins la dernière décennie à étudier les coronavirus et à aider à mettre en place des Biolabs en Ukraine. Tous utilisent des fonds du département américain de la Défense pour le faire. Vous pouvez en savoir plus à ce sujet iciici et ici.

Laissant de côté pour l’instant les biolabs en Ukraine, revenons au sujet de la Covid-19. Si le gouvernement américain finançait la recherche sur la Covid-19 avant que l’existence de la Covid-19 ne soit connue du public, cela suggère qu’ils savaient soit que la Covid-19 existait naturellement, soit qu’ils étaient impliqués dans la construction de ce virus dans un laboratoire.

Mais si les preuves contractuelles ne suffisent pas pour que vous parveniez à cette conclusion (ce devrait être le cas), alors associez-les peut-être à des preuves que l’Institut national américain des allergies et des maladies infectieuses (NIAID) et Moderna avaient un candidat coronavirus dans Décembre 2019 le sera.

Un accord confidentiel qui peut être consulté ici, stipule que les fournisseurs « Moderna » aux côtés de « l’Institut national des allergies et des maladies infectieuses » (NIAID) ont accepté de transférer les « candidats vaccins contre le coronavirus à ARNm » développés et détenus conjointement par le NIAID et Moderna aux destinataires. L’Université de Caroline du Nord à Chapel Hill’ le 12 décembre 2019.

L’accord a également été signé par deux représentants du NIAID, dont Amy F. Petrik PhD, spécialiste du transfert de technologie qui a signé l’accord le 12 décembre 2019 à 8h05. L’autre signataire était Barney Graham MD PhD, chercheur pour le NIAID, mais cette signature n’était pas datée.

Les derniers signataires de l’accord étaient Sunny Himansu, enquêteur de Moderna, et Shaun Ryan, conseiller général adjoint de Moderna. Les deux signatures ont été faites le 17 décembre 2019.

Toutes ces signatures ont été faites avant toute connaissance de l’émergence présumée du nouveau coronavirus. Ce n’est que le 31 décembre 2019 que l’Organisation mondiale de la santé (OMS) a pris connaissance d’un groupe présumé de cas de pneumonie virale à Wuhan, en Chine. Mais même à ce stade, ils n’avaient pas déterminé qu’un nouveau coronavirus présumé était à blâmer, déclarant plutôt que la pneumonie était de « cause inconnue ».

Tout cela nécessite des recherches beaucoup plus poussées pour assembler toutes les pièces du puzzle, mais voici ce que nous savons définitivement jusqu’à présent :

    Un nouveau coronavirus est apparu à Wuhan en décembre 2019.

    Le monde n’a entendu parler de ce nouveau coronavirus que début janvier 2020.

    Le monde ne savait pas que ce nouveau coronavirus s’appelait  Covid-19 jusqu’en février 2020, lorsque l’Organisation mondiale de la santé l’a officiellement nommé ainsi.

    Le département américain de la Défense a attribué un contrat de services professionnels, scientifiques et techniques à Black & Veatch Special Projects Corp‘, qui serait « une société mondiale d’ingénierie, d’approvisionnement, de conseil et de construction spécialisée dans le développement d’infrastructures ».

    Ce contrat concernait un programme de réduction des menaces biologiques en Ukraine.

    Dans le cadre de ce contrat plus important, un autre contrat a été attribué à Labyrinth Global Health pour la «recherche COVID-19» le 12 novembre 2019.

    Ce prix a été décerné au moins un mois avant l’émergence présumée du nouveau coronavirus et trois mois avant qu’il ne soit officiellement surnommé [virus de la maladie – MIRASTNEWS] Covid-19.

    Labyrinth Global Health travaille aux côtés de « Eco Health Alliance » et de « Metabiota », et a participé au programme USAID PREDICT. Toutes ces personnes et organisations travaillent depuis au moins la dernière décennie à étudier les coronavirus et à aider à mettre en place des Biolabs en Ukraine. Tous utilisent des fonds du département américain de la Défense pour le faire.

    Les informations trouvées ici indiquent qu’Eco Health Alliance a participé à la création du virus de la Covid-19.

    Les informations trouvées ici indiquent que Moderna a participé à la création du virus de la Covid-19.

    « Moderna », aux côtés du « National Institute of Allergy and Infectious Diseases » (NIAID), a accepté de transférer des « candidats de vaccins contre le coronavirus à ARNm » développés et détenus conjointement par le NIAID et Moderna, aux destinataires « l’Université de Caroline du Nord à Chapel Hill » le le 12 décembre 2019.

A quoi tout cela renvoie-t-il ? C’est à vous de réfléchir et de décider. Mais nous vous promettons qu’il y a beaucoup plus à venir sur ce qui précède…

Traduction : MIRASTNEWS


Je vous invite à visiter nos  boutiques en ligne conçues pour financer notre site web:

Sur ce lien: Vintage par Michel sur Etsy

Sur cet autre lien:Vintage par Michel sur E Bay

Le film du mois pour souligner la fête de Paques:Risen de 2016

 

L’HISTOIRE DU FILM

À Jérusalem lors des quarante jours qui succèdent à la résurrection du Christ, puis en Galilée. Clavius, un tribun militaire romain, et son aide de camp Lucius sont mandatés par Ponce Pilate pour superviser la crucifixion d’un juif nommé Jésus de Nazareth. Après la mort du condamné et sous la pression du Sanhédrin, Pilate ordonne de faire sceller et garder le tombeau mais le lendemain, les deux sentinelles ont disparu et le tombeau est vide. Pilate charge Clavius d’enquêter sur la disparition du corps du Nazaréen. Pourchassant les disciples du Christ soupçonnés d’avoir enlevé le corps, Clavius se convertit progressivement lorsqu’il les retrouve dans une petite maison de Jérusalem autour de Jésus ressuscité. Il finit par les rejoindre en Galilée. Pilate, se sentant trahi, envoie Lucius le tuer, mais Clavius s’en va se perdre au désert, incertain de ce qu’il a vu.

 

 

 

 

 

 

 

 

 

 

Mon évaluation

Il s’agit de mon film biblique favori car il fait un lien avec d’autres univers,entre la vision antique des dieux et la notre qui y voit une intervention extraterrestre.

 

 

 

La Criminelle Arnaque du COVID-19:Des preuves biochimiques et statistiques officielles confirment à 100 % que Moderna a créé le Covid-19

1) Lorsque  Kadhafi avait annoncé dans les années 60, en parlant des Américains, « ils fabriqueront des médicaments, et pour vous les fourguer, ils fabriqueront les maladies qui vont avec »; les « experts » l’avaient traité de « fou ». Les mêmes qui traitent aujourd’hui Poutine de fou.
2) Les Big Pharma (Pfizer, Moderna, J&J, etc.) ont sorti leur vaccin Covid en quelques mois, alors qu’habituellement il faut au moins 10 ans, prouve qu’ils étaient tous « au parfum »  de l’arnaque covid qui se préparait chez Moderna.
3) Dès le début de cette pseudo pandémie, nous avons été parmi les premiers à dénoncer cette arnaque et à affirmer que cette « maladie » est artificielle et qu’elle était conçue dans les labos de l’Oncle Sam.  H. Genséric

Des preuves sont apparues prouvant au-delà de tout doute raisonnable que le géant pharmaceutique Moderna, la société qui a gagné des milliards grâce à la vente d’une injection expérimentale appelée vaccin de Covid-19, a en fait créé le virus Covid-19.

Le 23 février, le Daily Mail a publié un article montrant que Moderna avait breveté la séquence de 19 lettres de base (nucléotides) qui code pour le site Furin Cleavage dans Covid-19. 

Il a cité un article rédigé par des scientifiques en Inde, en Suisse, en Italie et aux États-Unis ( avec prudence intitulé : MSH3 Homology and Potential Recombination Link to SARS-CoV-2 Furin Cleavage Site ) dans lequel ils ont calculé que les chances d’une séquence de 19 nucléotides, brevetée par Moderna, apparaissant au hasard dans Covid-19 , dans des circonstances où il n’apparaît nulle part ailleurs dans la nature sont de 1 sur 3 milliards [1].

Mais ils n’ont pas réussi à en tirer la déduction évidente. S’ils avaient fait cette déduction évidente, je crains que cela n’ait été la dernière déduction scientifique qu’ils aient jamais publiée !

Ils ont décidé d’enquêter sur la séquence d’ARN du site de clivage de la furine dans la protéine de pointe Covid-19 pour voir si cela se produisait ailleurs dans la nature. .

Heureusement, le NCBI/NIH a produit la merveilleuse base de données BLAST qui répertorie toutes les séquences de gènes dans la nature connues de l’homme et toutes les séquences de gènes synthétiques brevetées connues de l’office des brevets.

Les chercheurs ont choisi la séquence Furin Cleavage car il s’agit de la seule séquence continue de lettres de gène (séquence de nucléotides) dans Covid-19 avec plus de 3 nucléotides, qui diffère des lettres respectives dans son parent naturel le plus proche, le Bat Coronavirus RaTG13 (toutes les autres différences sont 3 lettres ou moins). C’était donc de loin le meilleur candidat pour déterminer si le Covid-19 était ou non créé par l’homme.

 

De plus, le site de clivage de la furine est la clé de la pathogénicité de Covid-19 . Donc, s’il devait y avoir un gain de fonction créé par l’homme inclus dans le virus, c’est là que l’on pourrait s’attendre à le trouver.

La séquence d’acides aminés du site de clivage de la furine est PRRA (Proline Argenine Argenine Alanine). Chaque acide aminé est codé par un codon composé de 3 nucléotides (lettres de séquence génétique). Ainsi, toutes les différences dans le code génétique entre Covid-19 et RaTG13 sont au plus long d’un codon, d’un acide aminé, autre que la séquence de clivage de la furine, qui est…

CCT CGG CGG GCA

La séquence complémentaire (le brin d’ADN opposé de la double hélice est (GGAGCCGCCCGT) car C se lie à G et A se lie à T

Le compliment inverse (la même chose écrite à l’envers) est donc TGCCCGCCGAGG

Les chercheurs ont effectué une recherche d’alignement BLAST (Basic Local Alignment Search Tool) (ce qui signifie qu’ils recherchent la séquence du gène, la séquence du gène inverse, la séquence du gène complémentaire et la séquence du gène complémentaire inverse) à travers chaque séquence de gènes dans la nature connue de l’homme depuis CTCCTCGGCGGGCACGTAG qui est la séquence de 19 nucléotides contenant la séquence de clivage de la furine, qui apparaît également dans Covid-19, et qui se trouve en fait sous la forme de complément inverse CTACGTGCCCCGCCGAGGAG brevetée par Moderna.

Leurs résultats de recherche peuvent être trouvés ici . 

Le tableau 1 montre qu’il existe bien dans les 5 brevets américains cités ci-dessous…

US9149506B2 : Polynucléotides modifiés codant pour la septine-4 – https://patents.google.com/patent/US9149506B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618953P
2013-12-16 Demande déposée par Moderna Therapeutics Inc
2014-05-22 Publication de US20140141067A1
2015-10-06 Publication de US9149506B2
2015-10-06 Demande accordée
2020-01-10 Premier litige familial mondial déposé

US9216205B2 : Polynucléotides modifiés codant pour la granulysine – https:// patents.google.com/patent/US9216205B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618873P
2013-12-16 Demande déposée par Moderna Therapeutics Inc
2014-04-24 Publication de US20140113960A1 2015-12-22
Publication de US9216205B2 2015-12-22
Demande accordée

SIAH encodant la polynucléotide E3subitine modifiée protéine ligase 1 – https://patents.google.com/patent/US9255129B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618868P
2013-12-16 Demande déposée par Moderna Therapeutics Inc
2014-05-22 Publication de US20140141068A1
2016-02-09 Demande accordée
2016-02-09 Publication de US9255129B2

US9301993B2 : Modified polynucleotides coding apoptosis inducing factor 1 – https://patents.google.com/patent/US9301993B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Mandataire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618957P
2013-12- 16 Demande déposée par Moderna Therapeutics Inc
2014-04-17 Publication de US20140107189A1
2016-04-05 Demande accordée
2016-04-05 Publication de US9301993B2
2020-01-10 Premier litige familial mondial déposé

US9587003B2 : Polynucléotides modifiés pour la production de protéines et de peptides liés à l’oncologie – https://patents.google.com/patent/US9587003B2/en 

Inventeur : Stephane Bancel, Tirtha Chakraborty, Antonin de Fougerolles, Sayda M. Elbashir, Matthias John, Atanu Roy, Susan Whoriskey, Kristy M. Wood, Paul Hatala, Jason P. Schrum, Kenechi Ejebe, Jeff Lynn Ellsworth, Justin Guild

Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618868P
2016-02-04 Demande déposée par ModernaTx Inc
2016-06-02 Publication de US20160152678A1
2017-03-07 Publication de US9587003B2
2017-03-07 Demande accordée

Ainsi, Moderna a déposé une première demande de brevet pour la séquence de 19 nucléotides en 2013 le 16 décembre. Peut-être que le 25 décembre aurait été plus approprié puisqu’il était destiné à devenir la couronne d’épines de Mathew27, Mark15 et John19.

Tableau 2 : montre que la séquence se produit dans Covid-19 du nucléotide 23601 à 23619.

Tableau 3 : montre que cette séquence de gène n’existe pas dans la nature (mais 14 parties nucléotidiques de celle-ci existent). 

J’ai décidé de vérifier leur travail. Oui. Je les ai effectivement vérifiés (j’enverrai une facture aux mondialistes). Cela s’est avéré être un voyage un peu épique. La page de brevet Google pour US9587003B2 ne contient pas la séquence du gène. Le pdf du brevet ne contient pas la séquence du gène et n’est pas consultable à partir des pages 101-304. Mais il a un lien vers une longue section « Liste des séquences » que l’on ne peut pas copier. Je l’ai donc transcrit manuellement de ma main juste –  http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US09587003B2 

À partir de cette page, vous pouvez entrer l’ID de séquence cité dans l’article sous la forme 11652 et accéder à https://seqdata.uspto.gov/?pageRequest=viewSequence&DocID=US09587003B2&seqID=11652 qui a ce qui suit aux nucléotides 2751-2733 en lisant à l’envers…

gccctgatca ccatcatggc ccagatcggc ag ctacgtgc ccgccgagga g gccaccatc 2760

CTACGTGCCCCGCCGAGGAG breveté par Moderna est le complément inverse de CTCCTCGGCGGGCACGTAG, la séquence de 19 nucléotides qui apparaît dans l’ADN de Covid-19 à partir du nucléotide 23601-23619 (qui serait donc couvert par leur brevet).

De même, vous pouvez rechercher la séquence dans US9149506B2 en allant sur https://seqdata.uspto.gov/?pageRequest=viewSequence&DocID=US09149506B2&seqID=11652 , après quoi vous retrouverez la même chose

gccctgatca ccatcatggc ccagatcggc ag ctacgtgc ccgccgagga g gccaccatc 2760

J’ai ensuite recherché la séquence génétique de Wuhan Hu1 (alpha) sur https://www.ncbi.nlm.nih.gov/nuccore/NC_045512 et j’ai trouvé 

23581 ttatcagact cagactaatt ct cctcggcg ggcacgtag t gtagctagtc aatccatcat de https://www.ncbi.nlm.nih.gov/nuccore/NC_045512 

Qui a la séquence de 19 nucléotides CTCCTCGGCGGGCACGTAG de 23601-23619 comme décrit dans le tableau 3. 

J’ai ensuite effectué ma propre recherche par explosion non alignée de toutes les séquences de gènes brevetées pour le compliment inverse directement (ou peut-être pour un compliment inversé) et j’ai obtenu les mêmes résultats que les chercheurs. 

Et pareil pour les 3 autres brevets américains.

Je peux donc confirmer, et le lecteur peut confirmer en utilisant les liens ci-dessus, que Moderna a demandé un brevet non seulement sur le complément inverse du site de clivage de la furine à 12 nucléotides dans Covid-19, mais en fait sur la séquence de 19 nucléotides le contenant comme décrit au dessus.

De plus, ils n’ont pas simplement déposé une demande de brevet le 4 février 2016 avec US9587003B2 : comme le rapporte le Daily Mail. Ils ont effectivement déposé le 16 décembre 2013 pour 4 brevets avec US9149506B2, US9216205B2, US9255129B2, US9301993B2 : également.

Ainsi, Moderna avait développé la séquence de gènes de 19 nucléotides contenant le site de clivage de la furine qui donne à Covid19 son infectivité pour l’homme grâce à une recherche brevetée sur le gain de fonction dès 2013, 6 ans avant l’épidémie de Wuhan. Pas 3 comme rapporté dans le Mail et viralement ailleurs.. 

Alors maintenant, nous examinons les chances que cela se produise naturellement. L’article calcule la probabilité que cette séquence particulière de 19 nucléotides se produise de manière aléatoire dans un virus de 30 000 nucléotides comme

(30 000-18) × (1/4) 19   = 1,09 × 10 -7

Ce qui est correct car il y a 30 000 à 18 places pour commencer la séquence étant donné qu’il faut encore 18 lettres supplémentaires pour la compléter. Mais il y a en fait 29 904 nucléotides dans Wuhan HU1 (alpha). Un calcul plus précis serait donc

(29 904-18) × (1/4) 19   = 1,087 × 10 -7

Ensuite, ils calculent les chances que la séquence de 19 nucléotides se produise dans la bibliothèque brevetée de 24 712 séquences d’une longueur moyenne de 3 300 nucléotides. Mais ce calcul n’est pas pertinent car la séquence n’est pas apparue au hasard dans 5 demandes de brevet Moderna. La séquence était connue pour coder pour un site de clivage de la furine, qui est connu pour fournir un gain de fonction aux coronavirus.

Il y a été mis délibérément et breveté en raison de son pouvoir infectieux chez l’homme, que nous verrons plus loin dans l’article, résulte du remplacement du codon viral normal de l’arginine (R) AGA (utilisé dans 45 % des codons viraux de l’arginine) par le le codon de l’arginine humaine CGG (utilisé dans 0 % des codons de l’arginine virale) dans le site de clivage de la furine.

Tout ce que nous essayons de déterminer ici, c’est quelles sont les chances qu’une séquence de 19 nucléotides brevetée par Moderna apparaisse dans Covid-19 par des causes naturelles, les mutations naturelles du Bat Coronavirus RaTG13 ou d’un autre virus.

Les nucléotides forment des codons qui sont des triplets. Il y a donc 64 triplets possibles des 4 nucléotides d’ADN ACGT (4x4x4 = 64). Mais tous les triplés se produisent. 61 codent pour 20 acides aminés de manière redondante et 3 sont des codons stop qui indiquent au ribosome d’arrêter de fabriquer la protéine.

Mais les choses ne sont pas aussi simples car le site de clivage Furin apparaît dans la protéine de pointe là où il doit être et la protéine de pointe n’a que 1273 × 3 = 3819 nucléotides. Les chances que la séquence de 19 nucléotides Furin Cleavage apparaisse dans la protéine de pointe sont 

(3 819-18) × (1/4) 19   = 1,389 × 10 -8

Soit 1 sur 72 millions. Ce seraient donc les chances qu’une variante particulière, disons la première variante de Covid-19, ait la séquence de 19 nucléotides au bon endroit (le pic). Et il l’a fait. Donc, certainement selon la prépondérance des probabilités, et certainement au-delà de tout doute raisonnable (1 sur 72 millions étant un doute déraisonnable), Moderna a créé Covid-19. 

Preuve 100% biochimique que Covid19 a été créé par l’homme

Le double codon CGG utilisé dans le site de clivage spécifique de la furine Moderna ne se produit dans aucun autre site de clivage de la furine dans aucun autre virus dans la nature. Les sites de clivage de la furine se produisent dans d’autres virus mais PAS du tout dans d’autres bétacoronavirus comme Covid-19 et PAS du tout avec le double codon CGG.

L’arginine (R), peut être codée par l’un des 6 triplets : AGG, AGA, CGA, CGC, CGG, CGT. Dans le Covid-19, le site de la furine (PRRA), compte 12 nucléotides (3 x 4). Dans le Covid-19, le doublet RR du site de la furine est codé par CGG-CGG.  

Antonio R. Romeu

Deux biochimistes, le professeur Antonio R. Romeu et le professeur assistant Enric Ollé, ont analysé le doublet RR à partir d’un large échantillon de sites de clivage de la furine de plusieurs types de virus . Ils ont découvert qu’il n’y avait aucun doublet RR codé par les codons CGG-CGG dans aucun virus dans la nature. Ils ont observé que le triplet AGA était le codon majoritaire impliqué dans ces doublets RR viraux.

Dans toute recombinaison génétique (où une partie d’un génome fusionne avec un autre génome), le code donneur est transmis à l’accepteur. Mais il n’y a tout simplement AUCUN VIRUS CONNU avec un site de clivage de la furine spécifique de Moderna (ayant la paire de codons CGG-CGG) qui existe pour donner un site de clivage de la furine spécifique de Moderna à Covid19. Donc, la seule façon dont cette séquence pourrait entrer dans Covid-19 est de Moderna. Moderna était le donateur. La nature ne l’était pas. CQFD. Affaire classée..  

Mais ça empire.

Les professeurs espagnols ont décidé d’analyser l’utilisation du codon de l’arginine dans chaque protéine de Covid-19. Le constat suivant…
AGG (13%)
AGA (45%)
CGA (5%)
CGC (10%)
CGG (3%)
CGT (24%). 

Ainsi, le triplet de codons AGA était majoritaire et, fait intéressant, CGG était le codon minoritaire de l’arginine dans le virus. 

Mais c’est encore pire.

Dans le cas particulier de la protéine S, sur les 42 Arginines (R) dont elle dispose, 20 sont codées par AGA, et seulement 2 par CGG. Ces 2 bien sûr, sont les deux dans le site de clivage Moderna Specific Furin.

Ainsi, la seule arginine dans la protéine de pointe qui est codée à la Moderna se trouve sur le site Furin Cleavage. Les 40 autres instances n’utilisent pas du tout CGG. 

Ils poursuivent ensuite en commentant que chaque espèce individuelle dans la nature a ses propres préférences de codons. De toute évidence, les virus aiment AGA, et n’aiment pas du tout CGG, dans la nature.

Mais devinez quelle espèce utilise CGG pour l’arginine plus que les 5 autres codons concurrents – oui, son vieil homo sapiens. Nos préférences de codage pour l’arginine sont

AGG (20 %)
AGA (20 %)
CGA (11 %)
CGC (19 %)
CGG (21 %)
CGT (9 %).

Ainsi, le codon CGG dans le site de clivage de la furine SERA issu de la recherche sur le gain de fonction chimère (combinaison homme-animal). 

Quelqu’un d’autre que Moderna aurait-il pu créer le Covid-19 en utilisant le site de clivage de la furine spécifique de Moderna ?

« De nouveaux documents montrent que 18 mois seulement avant l’apparition des premiers cas de Covid-19, les chercheurs avaient soumis des plans pour libérer des nanoparticules et des aérosols pénétrant dans la peau contenant de « nouvelles protéines de pointe  » de coronavirus de chauve-souris  des cavernes du Yunnan, en Chine. Ils prévoyaient également de créer des virus chimériques, génétiquement améliorés pour infecter plus facilement les humains, et ont demandé 14 millions de dollars à la Defense Advanced Research Projects Agency (Darpa) pour financer les travaux.

Des articles, confirmés comme authentiques par un ancien membre de l’administration Trump, montrent qu’ils espéraient introduire des «sites de clivage spécifiques à l’homme» pour les coronavirus de chauve-souris, ce qui faciliterait l’entrée du virus dans les cellules humaines.
Lorsque Covid-19 a été séquencé génétiquement pour la première fois, les scientifiques étaient perplexes quant à la façon dont le virus avait développé une telle adaptation spécifique à l’homme au site de clivage de la protéine de pointe, raison pour laquelle il est si infectieux. – le Telegraph

Je peux voir tous les grands journalistes du Daily Mail et du Telegraph (sans parler des scientifiques du monde entier) faire toutes ces recherches sur Covid19 et arriver à la conclusion logique inévitable qu’il y a eu une fuite accidentelle ou délibérée d’un laboratoire et doivent ensuite formuler leurs conclusions de manière à étiqueter cette forte probabilité comme une possibilité faible. 

Mais ci-dessus, nous l’avons prouvé comme un fait (puisque le codon CGG de la séquence de clivage spécifique de la furine de Moderna n’apparaît dans aucun site de clivage de la furine dans aucun virus naturel et, par conséquent, il ne peut pas avoir été le résultat d’une recombinaison génétique naturelle. Il doit donc être le résultat d’une insertion génétique faite par l’homme. 

En théorie, une autre partie impliquée avec le NAIAD ou le NIH aurait pu utiliser le site de clivage de la furine breveté par Moderna et fabriquer Covid19 eux-mêmes. Cela n’aurait brisé aucun brevet de Moderna. Le site de clivage Furin lui-même n’est pas brevetable étant connu depuis au moins 2004

US7223390B2 : Insertion de sites de clivage de la furine protéase dans les protéines membranaires 
et leurs
utilisations

Bien que Moderna ait en fait pu breveter le codage Moderna Specific (CGG pour AGA) du site de clivage de la furine qui n’était pas connu dans la nature même aujourd’hui (si nous acceptons que Covid-19 soit créé par l’homme).

Mais étant donné que la fuite de laboratoire (délibérée ou accidentelle) est venue de Wuhan, et compte tenu de la dissimulation chinoise et des démentis de Fauci exposés par le sénateur Rand Paul, et étant donné les dissimulations du NIH, du NIAID et des services de renseignement américains, quand leur Un rapport de 3 mois sur l’origine de Covid-19 commandé par l’imitateur présidentiel Biden n’a rien donné, et compte tenu des relations entre le NIAID, le NIH, le WIV, l’EcoHealth Alliance, l’Université de Caroline du Nord et Moderna, je ne vois aucune pièce pour quelqu’un d’autre.

De plus, toute la cabale impie des mauvais acteurs a commencé à développer le vaccin Moderna avant que la pandémie ne frappe – https://www.infowars.com/posts/must-watch-nih-claimed-joint-ownership-of-moderna-mrna-vaccine- a commencé-le-développement-des-semaines-avant-la-pandémie/ 

Mais les choses ne sont pas aussi simples que cela parce que la nature a certainement eu 100 000 ans pour fabriquer des virus humains et elle n’a jamais mis une seule fois un site de clivage de furine spécifique à Moderna (CGG pour AGA) dans quoi que ce soit, ni mis la séquence de 19 nucléotides dans quoi que ce soit auparavant.

Pourtant, dans les 6 ans suivant le brevetage de Moderna, nous le trouvons dans Covid-19 dans des circonstances où Moderna travaille avec ce virus. Donc juste là, la probabilité n’est pas de 100 000 contre 6 ou 16 666 contre 1 que Moderna soit responsable plutôt que la nature. Non c’est à 100% car la nature ne l’a pas fait. Il ne l’a jamais fait et rien ne prouve qu’il le fera un jour.

C’est l’homme qui mélange les codons humains et viraux de l’arginine, pas la nature. 

Le prof. Luc Montagnier a passé les dernières années de sa vie à prouver que le COVID-19 était créé par l’homme et qu’il contenait une grande partie du code génétique du VIH1

Le professeur Luc Montagnier, avant de mourir le 8 février 2022, a totalement détruit le concept selon lequel Covid-19 a évolué naturellement en montrant qu’il avait une équivalence massive avec VIH. Le diagramme ci-dessous montre une région de 275 nucléotides de Covid-19 qui contient 200 nucléotides du VIH/SIV (Simian ImmunoVirus). Et rappelez-vous qu’il y a 61 codons spécifiant 20 acides aminés. On peut donc dire la même chose en moyenne de 3 manières différentes avec des codons.

Vous pouvez télécharger un pdf de son étude ici et les documents supplémentaires ici . C’est très technique. Mais il a remporté le prix Nobel pour avoir découvert le virus VIH. Donc, si quelqu’un savait si Covid avait été boosté par le VIH, ce serait lui. Il a souligné que Covid-19 avait été créé par l’homme au début de la pandémie et qu’il avait lui-même été stipendié par la presse et les « vérificateurs des faits » pour avoir dit la vérité scientifique. Tous les « vérificateurs de faits » qui l’ont attaqué avaient tort.

Aucune de leurs vérifications des faits n’avait de fondement scientifique. Ces gens ne sont pas du tout des vérificateurs de faits bien sûr. Ce sont des agences de désinformation mondialistes, des fils de Goebbels, des fact chuckers et des négateurs de la science. Ils sont à peu près aussi dignes de confiance qu’une élection américaine. Je peux vérifier un fait par moi-même merci beaucoup. Je n’ai pas besoin qu’un taliban soumis au lavage de cerveau me dise son opinion sur un sujet qu’il n’a jamais étudié à l’université.

Puisque nous avons prouvé au-delà de tout doute raisonnable (au-delà d’un doute sur 1 sur 72 millions de manière statistique et avec 100% de certitude biochimique à partir du site de clivage de la furine spécifique de Moderna) que Moderna a fabriqué Covid-19. Et puisque Moderna et Fauci n’ont pas admis l’avoir fait et ont en fait dissimulé des preuves à cet effet, il se peut qu’ils cachent également autre chose.

Maintenant, les deux seules théories qui restent sont la théorie des fuites accidentelles de laboratoire et la théorie des fuites délibérées de laboratoire. Nous savons que la grande majorité des fuites politiques ne sont pas des accidents. Ce sont des stratégies délibérées pour procurer un avantage au bailleur ou au payeur. Il est bien connu dans l’industrie informatique que les virus apparaissent lorsque des ventes d’antivirus sont nécessaires. Pourquoi les choses seraient-elles différentes avec les virus humains, maintenant qu’ils peuvent aussi être créés par l’homme ? Surtout si l’on considère le rôle massif de Bill Gates et de sa fondation et de GAVI et GVAP dans le secteur mondial de la vaccination.

La seule raison pour laquelle Moderna créerait Covid-19 est de le lancer sur le marché. Sinon, tout l’exercice serait financièrement futile, commercialement inutile.

La raison invoquée par Fauci pour faire de la recherche sur le gain de fonction est que l’homme doit être en avance sur la nature ou les mauvais acteurs afin d’avoir un vaccin en temps utile si une maladie mute ou est génétiquement modifiée par « les Chinois ou les Russes » pour être mortelle !!

Mais pour croire cela, il faut croire que Moderna s’intéresse à sauver la vie des gens. Je m’excuse. Toutes leurs actions me montrent qu’ils sont intéressés à vacciner les gens sachant à quel point cela risque de leur coûter la vie.

Ils sont intéressés par le profit, le profit qui découle d’une pandémie. Ils ne sont pas des sauveurs de l’humanité comme ils le représentent. Ce sont nos exploiteurs et nos agresseurs.

Ils ont produit le virus pour le faire fuiter, pour se faire passer pour nos sauveurs de leur propre fuite. Ce ne sont pas les activités d’une figure de sauveur. Luc Montagnier essayait d’être notre sauveur d’eux et il a été assassiné (professionnellement) par leurs groupies. [La fiotte Macron a snobé le décès du Savant]
Moderna effectuait des recherches sur le gain de fonction afin de libérer le virus et de forcer un vaccin contre celui-ci d’une manière qui maximiserait ses profits. Ce n’est pas une théorie du complot. C’est ce qui s’est passé précisément. Le cours de leur action a été multiplié par 20. 

Ils l’ont sorti pour vendre leurs vaccins et détruire le système immunitaire de leurs clients car notre système immunitaire réduit leurs profits. C’est le business de Big Pharma. 

La raison pour laquelle l’écrivain est si confiant que Moderna ou leurs agents ont fabriqué et divulgué Covid-19 et la raison pour laquelle je l’ai appelé ainsi au début de la pandémie pour presque autant de ridicule que le professeur Montagnier a reçu (que Dieu le bénisse) est que le les Écritures disent dans Matthieu27, Marc15 et Jean19 : 

29 Et ils (les soldats du gouverneur du verset 27) placèrent une couronne d’épines et la mirent sur sa tête, et un roseau dans sa main droite ; et ils s’agenouillèrent devant lui, et se moquèrent de lui, disant : Salut, roi des Juifs !
30 Et ils crachèrent contre lui, prirent le roseau et le frappèrent sur la tête. (Matthieu 27 ASV)

Puis-je donc demander votre indulgence pendant que j’interprète ces mots : 

Le département américain de la défense a financé l’épissage génétique du coronavirus des protéines de pointe (Covid-19) par l’intermédiaire du NIH, du NIAID et de la DARPA, qui a d’abord infecté Jésus, par l’intermédiaire de son fiancé, les saints de la Nouvelle Alliance, juste après qu’il soit devenu le roi séculier, César à ces saints, les Juifs antitypiques, ceux qui se sont engagés à être des fils angéliques de Jacob, les nés de nouveau angéliquement.

Nous avons calculé que la malédiction qui a empêché Jésus de devenir César des saints s’est terminée en 2019Tishri15 (17/18 octobre). Glenn Beck a réalisé un documentaire montrant que 10 hôpitaux de Wuhan ont pris en charge des cas présentant des symptômes de Covid19 en octobre 2019. Oui les gens. Le Covid-19 est une preuve que Jésus est désormais le Roi séculier sur les saints, les Juifs antitypiques, les Juifs par l’alliance angélique du salut, au moins.

Mais ensuite, les soldats ont craché sur lui. Car c’est ainsi que Covid19 est transféré, à travers de petites gouttelettes d’aérosol expirées par la bouche. Les soldats lui ont délibérément craché dessus. Ce n’était pas une FUITE DE SALIVE ! Ils ont frappé Jésus sur la tête parce que les saints sont à la tête de l’église et ils ont attrapé Covid19 non pas par une infection fortuite au hasard mais par un coup délibéré avec une lecture, une arme biologique, une attaque armée délibérée. Pour en savoir plus, voir ici .

Alors ce que le Pr Montagnier a vu avec son expertise en virologie, je l’ai vu avec mon expertise théologique. Montrer que si les vérificateurs de faits et la science s’excluent mutuellement, la science et la théologie sont en fait d’accord, lorsqu’elles sont bien comprises (et c’est une grande mise en garde). Le Pr M nous a appris que les vaccins provoquent les variants. En effet, la virologie de base interdit la vaccination de masse pendant une pandémie pour cette raison même. Il a dit que la courbe des décès suit la courbe des vaccinations. Remarquez, paradoxalement, si les vaccins ont causé Omicron, alors ils nous ont sauvés d’eux-mêmes !

Le temps est venu de demander des comptes aux personnes et aux organisations

Les fabricants de Covid19, les fabricants de vaccins génétiques. leurs bailleurs de fonds et leurs promoteurs, qui comprennent presque tous les gouvernements, secteurs publics et services de santé dans le monde, sont donc coupables de génocide et de crimes contre l’humanité. Ils ont poussé le viol génétique, la maladie et la mort sur la moitié de la population mondiale afin d’enrichir les poches des sociétés pharmaceutiques. Les gouvernements et les secteurs publics du monde entier ont abandonné leur réglementation des services de santé aux milliardaires et aux entreprises sans cœur

Au Royaume-Uni, tout l’impôt sur le revenu que nous payons va au service de santé et tous ses protocoles sont déterminés par ses régulateurs et tous ses régulateurs sont contrôlés et financés par Big Pharma qui cherchent à nuire puis à gérer notre santé à leur profit.

Ainsi, chaque cent que nous dépensons en impôt sur le revenu nous rapproche un peu plus de la maladie, de la mort et de la toxicomanie.

Le professeur Luc Montagnier,en 2008.

Alors pourquoi le professeur Montagnier a-t-il choisi de passer les dernières années de sa vie à prouver que le Covid-19 était une création humaine et que les protéines de pointe, et donc les vaccins, étaient une menace existentielle pour l’espèce ? Que lui restait-il à prouver à lui-même ou à qui que ce soit d’autre à 87-89 ? Il ne l’a certainement pas fait pour accroître sa réputation dans la profession.

Non, il était animé par la même passion qui l’a poussé à découvrir le VIH. Une passion pour SAUVER l’humanité des virus et de ceux qui voudraient les concevoir pour nous nuire. Et pourquoi a-t-il rendu l’âme en février 2022 ? Parce qu’il savait qu’Omicron avait battu les vaccins. Son travail a été fait par un plus grand virologue que lui. Il a donc pu reposer en paix et aller voir des gens qui ont compris l’ampleur de sa contribution.

Covid-19 n’a pas été fabriqué en 2019. Il a été fabriqué à partir du site de clivage de la furine chimérique spécifique de Moderna (CGG pour AGA) à 19 nucléotides qui n’existe nulle part dans la nature.
Et chaque décès de Covid et chaque décès par vaccin Covid est carrément garé à la porte de ModeRNA en attente de justice.

Mais nous n’exécuterons pas cette justice assez vite. Et donc le fléau final sur l’humanité d’Apocalypse 6: 8, livré par le 4e cavalier de l’apocalypse, que Bill Gates lui-même a prophétisé, arrivera plus tard cette année (après la guerre et après la famine, les 2e et 3e cavaliers).

Source: BREAKING: Official Biochemical and Statistical Evidence 100% confirms Moderna created Covid-19

 


N’hésitez pas à visiter notre boutique en ligne:vous trouverez plein de cadeaux pour vos proches

Sur ce lien:Vintage par Michel

 

Rien ne va plus chez Facebook, « Meta » perd près de 200 milliards de dollars en Bourse

Les actions de Meta, la société mère de Facebook, ont chuté de plus de 25% jeudi,le 3 février 2022, anéantissant plus de 230 milliards de dollars de valeur marchande. Il y a quelques jours, la firme de Mark Zuckerberg jetait aussi l’éponge sur son projet de monnaie numérique, après des années de recherche et développement.

Meta perd près de 200 milliards de dollars en Bourse

A Wall Street, la réaction est forte, très forte. Dans les premières cotations, l’action de l’ex-Facebook plonge de plus de 25%. C’est plus de 230 milliards de dollars de capitalisation boursière qui s’envolent et la plus lourde sanction jamais accusée par le groupe de Mark Zuckerberg ou, plus largement par une société cotée à New York, souligne Bloomberg,

Le 03 février, à 15h15 GMT (16h15 en Suisse), le titre de Meta Platforms, maison mère de Facebook, dégringolait de 24% à 245 dollars, entraînant l’indice Nasdaq (-2,14%) dans sa chute.

La fortune du patron de Facebook, Mark Zuckerberg, estimée à 113 milliards de dollars à la clôture hier selon des documents de la SEC, subissait aussi une coupe sévère. Le co-fondateur du réseau social perdait virtuellement presque 28 milliards de dollars.

Les actions de Meta ont plongé à la suite d’un rapport sur les résultats trimestriels lamentable dans lequel la société a publié des prévisions de revenus plus faibles que prévu et a mis en garde contre plusieurs défis pour son activité cette année.

Les investisseurs ont abandonné les actions du géant de la technologie après avoir été alarmés à la fois par la baisse de la croissance des utilisateurs et la hausse des dépenses liées au projet de « métaverse » de la société. Facebook a dépensé plus de 10 milliards de dollars dans ce sens l’année dernière et s’attend à une “augmentation significative” des dépenses similaires pour 2022.

Le nombre d’utilisateurs, surtout, a déçu. Le revenu moyen par utilisateur (Arpu) est, certes, un peu plus élevé qu’attendu, à 11,57 dollars, contre 11,38 dollars visés par les analystes, mais ils sont moins nombreux : 1,93 milliard d’utilisateurs actifs quotidiens en décembre, contre 1,95 milliard anticipé, et 2,91 milliards d’actifs mensuels (2,95 milliards). C’est la première fois, dans l’histoire de l’entreprise, que le nombre d’utilisateurs actifs quotidiens s’inscrit en baisse par rapport au précédent.

 

Meta cède aussi sur la cryptomonnaie et abandonne le Diem

Février est décidément un mois compliqué pour Facebook, rebaptisé Meta. Après le projet avorté en 2019 du Libra, cette cryptomonnaie qui réunissait d’autres acteurs d’Internet et des paiements (PayPal, Visa, Mastercard) autour du réseau social, c’est au tour de son successeur, le Diem, d’être enterré.

Le diem n’aura pas réussi à faire oublier le « libra », nom du projet initial, qui avait, déjà, créé un véritable séisme dans la sphère bancaire mondiale il y a un peu plus de deux ans. Cette monnaie virtuelle décentralisée devait être lancée mi-2020, mais elle avait immédiatement déclenché une fronde internationale à son égard.

Le projet de monnaie numérique de Meta (Facebook), ne verra, donc, pas le jour. Elle a annoncé son démantèlement, ainsi que la vente des droits de propriété intellectuelle et d’autres actifs à la banque Silvergate Capital pour 182 millions de dollars.

Selon Bloomberg, le coup d’épée fatal a été porté par la Réserve fédérale des États-Unis qui aurait exercé sa pression sur le partenaire banquier du diem, Silvergate.

Le recul de Meta s’expliquerait par la dissuasion des autorités centrales qui n’entendent pas perdre aussi facilement le contrôle de la monnaie. Le pari était aussi prometteur puisqu’il surfait – comme les autres GAFA – sur l’explosion des cryptomonnaies, au nombre de 12.000 selon CoinGecko, et qui se sont bâties une véritable notoriété en pleine pandémie de Covid et face aux incertitudes liées à l’inflation sur les Bourses traditionnelles.

Amazon, Google, Apple, PayPal, mais aussi Tesla du côté des Américains… les géants de la Tech se penchent sur ces nouveaux moyens d’échanges, en dehors des circuits bancaires traditionnels, sur tous les continents. Mais dans les pays où un pouvoir central contrôle l’économie, comme en Chine ou en Inde, l’activité des cryptomonnaies est pratiquement bannie.

Le projet était d’autant plus stratégique qu’il promettait potentiellement d’échanger des biens et d’acheter des services dans le futur « métaverse » de la firme de Mark Zuckerberg

Avec ce projet de « monde virtuel » Zuckerberg révèle ainsi son objectif final, qui n’est pas seulement de dominer l’internet d’aujourd’hui, mais de contrôler et de définir l’internet que nous laisserons à nos enfants et aux enfants de nos enfants. Un internet de surveillance toujours plus invasif où la parole dissidente est bannie.

Source

Fb spie
Un document interne à Facebook révèle que le géant des médias sociaux surveille le comportement hors ligne de ses utilisateurs afin de déterminer si une personne doit être classée dans la catégorie «agent de la haine», comme l’a signalé le Washington Pundit .

 

 

 

 

 

 

 

 

 


N’OUBLIEZ PAS DE VISITEZ LA BOUTIQUE EN LIGNE DE VOTRE SITE WEB FAVORI ET DE PARTAGER SON LIEN:

Sur ce lien:Vintage par Michel

 

 

 

 

La Gigantesque Arnaque du COVID-19:Les laboratoires américains n’ont pas trouvé de Covid-19 dans 1.500 tests positifs analysés

Le CDC poursuivi pour fraude massive : des tests dans 7 universités de TOUTES les personnes examinées ont montré qu’elles n’avaient pas de Covid, mais seulement la grippe A ou B – Statistiques de l’UE : « Corona » a pratiquement disparu, même en cas de mortalité.

Un scientifique clinicien et immunologiste-virologue d’un laboratoire du sud de la Californie affirme que lui et ses collègues de 7 universités poursuivent le CDC pour fraude massive. La raison : pas un seul des 1.500 échantillons de personnes testées « positives » n’a pu trouver le Covid-19. Il a été découvert que TOUTES les personnes étaient simplement atteintes de la grippe A et, dans une moindre mesure, de la grippe B. Ceci est cohérent avec les découvertes précédentes d’autres scientifiques, dont nous avons fait état à plusieurs reprises. Dr Derek Knauss : « Lorsque mon équipe de laboratoire et moi avons soumis les 1.500 échantillons de Covid-19 supposés positifs aux postulats de Koch et les avons placés sous un SEM (microscope électronique), nous n’avons trouvé AUCUN Covid dans les 1.500 échantillons. Nous avons constaté que les 1.500 échantillons étaient principalement de la grippe A et de la grippe B, mais aucun cas de Covid. Nous n’avons pas utilisé le test PCR des taureaux***.

Dans 7 universités, pas une seule fois le COVID détecté

«Lorsque nous avons envoyé le reste des échantillons à Stanford, Cornell et quelques laboratoires de l’Université de Californie, ils sont arrivés au même résultat: PAS de COVID. Ils ont trouvé la grippe A et B. Ensuite, nous avons tous demandé au CDC des échantillons viables de Covid. Le CDC a dit qu’ils ne pouvaient pas les donner, car ils n’avaient pas ces échantillons. «Nous sommes donc arrivés à la dure conclusion de toutes nos recherches et travaux de laboratoire que Covid-19 était imaginaire et fictif. La grippe ne s’appelait que « Covid », et la plupart des 225.000 décès étaient dus à des comorbidités telles que les maladies cardiaques, le cancer, le diabète, l’emphysème pulmonaire, etc. Ils ont attrapé la grippe qui a encore affaibli leur système immunitaire, et ils sont morts. »

« Ce virus est fictif »

«Je dois encore trouver un échantillon viable avec Covid-19 avec lequel travailler. Nous qui avons effectué le test de laboratoire avec ces 1.500 échantillons dans les 7 universités poursuivons maintenant le CDC pour fraude au Covid-19. Le CDC ne nous a toujours pas envoyé d’échantillon viable, isolé et purifié de Covid-19. S’ils ne peuvent pas ou ne veulent pas, alors je dis qu’il n’y a pas de Covid-19. C’est fictif. «Les quatre articles de recherche décrivant les extraits du génome du virus Covid-19 n’ont jamais réussi à isoler et à purifier les échantillons. Les quatre articles ne décrivent que de petits morceaux d’ARN qui ne font que 37 à 40 paires de bases. Ce n’est PAS un VIRUS. Un génome viral compte normalement entre 30 000 et 40 000 paires de bases. «Maintenant que Covid-19 est censé être si mauvais partout, comment se fait-il qu’aucun laboratoire au monde n’ait complètement isolé et purifié ce virus? C’est parce qu’ils n’ont jamais vraiment trouvé le virus. Tout ce qu’ils ont découvert, ce sont de petits morceaux d’ARN qui n’ont de toute façon pas été identifiés comme étant le virus. Nous n’avons donc affaire qu’à une autre souche de grippe, comme chaque année. Le Covid-19 n’existe pas et est fictif .’ «Je crois que la Chine et les mondialistes ont mis en place ce canular Covid (la grippe déguisée en nouveau virus) pour établir une tyrannie mondiale et un État policier de contrôle totalitaire. Cette intrigue comprenait (également) une fraude électorale massive pour renverser Trump.

Le CDC lui-même admet n’avoir aucun virus identifiable

Profondément dissimulé dans un document officiel sur le Covid-19, le CDC admettait avec regret dès l’été 2020 qu’il n’avait pas de virus mesurable : ‘Comme aucun objet viral isolé quantifié (= mesuré) du 2019-nCoV n’est disponible à l’heure actuelle… ‘ (page 39 du ‘CDC 2019-Novel Coronavirus (2019-nCoV) Real-Time RT-PCR Diagnostic Panel’ (13 juillet) En d’autres termes, le CDC, en tant que l’une des principales autorités médicales au monde, ne pouvait pas , et ne peut toujours pas , démontrer un virus. À propos du test PCR à cette fin scientifiquement totalement démystifié, mais toujours abusé sans vergogne, le CDC a écrit sous la rubrique « limites » : « La détection de l’ARN viral ne peut pas démontrer la présence d’un virus infectieux, ni que le 2019-nCoV est l’agent causal. des symptômes cliniques. » Et en plus: « Ce test ne peut pas exclure d’autres maladies causées par d’autres pathogènes bactériens ou viraux. » En d’autres termes, nous ne pouvons pas prouver que les personnes qui tombent malades et sont hospitalisées, et meurent très occasionnellement, ont été rendues malades par un nouveau coronavirus appelé SARS-CoV-2, et nous ne pouvons pas non plus prouver qu’il les a amenées à développer une nouvelle maladie appelée « Covid19 ». Il pourrait tout aussi bien s’agir d’un virus différent et d’une maladie différente. (Et puisque tous les symptômes, y compris les pneumonies sévères, correspondent parfaitement à ce que la grippe peut provoquer historiquement chez les personnes vulnérables… « si ça ressemble à un canard et marche comme un canard, c’est un canard ».

Récompense de 1.800.000 $ pour avoir démontré le coronavirus

L’année dernière, l’équipe allemande de Samuel Eckert et le Isolate Truth Fund ont promis une récompense d’au moins 265.000 $ pour tout scientifique qui peut fournir une preuve irréfutable que le virus SARS-CoV-2 a été isolé et existe donc. Ils ont également souligné qu’aucun laboratoire au monde n’a encore été en mesure d’isoler ce virus corona. Ce montant est passé à 1.800.000 $ . Oui, les scientifiques des systèmes prétendent qu’ils l’ont fait, mais cet « isolement » ne consiste qu’en un échantillon du corps humain, qui est une « soupe » pleine de différents types de cellules, de restes de virus, de bactéries, etc. À l’aide de produits chimiques (toxiques), on recherche ensuite des particules (résiduelles) qui peuvent indiquer un virus qui a existé ou peut encore exister, après quoi cela est désigné comme «preuve».

L’équipe canadienne n’a également reçu aucune preuve malgré 40 demandes de loi sur l’accès public

Fin décembre 2020, il y avait une initiative similaire à celle en Allemagne. Une équipe autour de la journaliste d’investigation canadienne Christine Massey a soumis pas moins de 40 demandes de loi sur l’accès public aux autorités médicales du monde entier avec la simple demande de preuve que le virus SARS-CoV-2 a été isolé et que son existence peut donc être objectivement prouvée. Aucune des agences et autorités auxquelles nous avons écrit n’a été en mesure de fournir cette preuve.

« Impossible de démontrer que le SRAS-CoV-2 provoque une maladie appelée Covid-19 »

Le Dr Tom Cowan, le Dr Andrew Kaufman et Sally Fallon Morell ont récemment publié une déclaration sur « la controverse persistante sur la question de savoir si le virus SARS-CoV-2 est isolé ou purifié. Mais sur la base de la définition officielle d’ »isolement » d’Oxford (« le fait ou la condition d’être isolé ou isolé, une séparation d’avec d’autres choses ou personnes, debout seul »), le bon sens, les lois de la logique et les règles de la science dictent que toute personne impartiale doit arriver à la conclusion que le virus SARS-CoV-2 n’a jamais été isolé ou purifié. En conséquence, aucune confirmation de l’existence du virus ne peut être donnée. «Les implications logiques et scientifiques de ce fait sont que la structure et la composition de quelque chose dont l’existence ne peut être prouvée ne peuvent pas être connues, y compris la présence, la structure et la fonction d’un pic hypothétique ou d’autres protéines. La séquence génétique de quelque chose qui n’a jamais été trouvé ne peut pas être connue, ni les « variantes » (mutations) de quelque chose dont l’existence n’a pas été démontrée. Il est donc impossible de démontrer que le SRAS-CoV-2 provoque une maladie appelée Covid-19.’

Un test PCR combiné pour corona et grippe « parce qu’il n’y a pratiquement aucune différence »

Sans surprise, la plus grande société de biotechnologie au monde, la chinoise BGI, a récemment lancé un nouveau test PCR qui peut tester simultanément la grippe A, B et corona. Outre le fait avéré, reconnu par divers procès, qu’un test PCR ne peut pas prouver l’infection par quelque virus que ce soit, l’explication de BGI selon laquelle les deux maladies sont si difficiles à distinguer l’une de l’autre et qu’ils n’ont donc fait qu’un seul test, en dit plus que suffisant . Peut-être qu’il n’y a aucune différence, « Covid » n’est qu’un autre nom pour les virus de la grippe « vieux familiers », et c’est juste une autre astuce marketing intelligente ?

La plupart des gens ont été trompés par la propagande de la peur

Avec la propagande mondiale de la peur contrôlée par le gouvernement 24 heures sur 24, 7 jours sur 7, par les médias de masse, la plupart des gens en sont venus à croire qu’il existe en effet un virus potentiellement mortel qui rend les gens malades beaucoup plus rapidement et plus gravement que la grippe saisonnière. Cependant, même ce dernier n’est manifestement pas le cas. La grippe A est depuis des années la principale cause de décès par pneumonie dans le monde développé. Mais envoyez des personnes désignées comme des patients atteints de Covid sévères dans quelques unités de soins intensifs, mettez constamment des caméras dessus, dites à quelques médecins qu’ils ne doivent discuter que des pires cas, et vous avez votre « pandémie télévisée ». L’argument « nous le faisons parce que sinon les soins seront surchargés » a été sapé par les gouvernements eux-mêmes il y a quelque temps, en rejetant les offres de lits ou de personnel de soins intensifs supplémentaires, car « ce n’est pas nécessaire ». (Était-ce peut-être la première et la seule fois où la vérité était dite ?)

Chiffres officiels : rien d’inquiétant (mais ça ne revient jamais à la normale)

Maintenant que les chiffres officiels montrent également qu’après la saison normale de la grippe traditionnelle, tout va bien, et selon les statistiques de l’UE (EuroMOMO), il y a même une baisse significative de la mortalité, la société – s’il s’agissait vraiment d’un virus et de la santé publique – devrait revenir immédiatement à la normale pour commencer à réparer les énormes dégâts causés par les politiques gouvernementales. Cependant, comme vous le savez, cela ne se fera jamais, et c’est parce que ce canular pandémique soigneusement planifié poursuit un programme idéologique, le « Grand Reset », qui vise à démolir en grande partie la société et l’économie de l’Occident, puis à soumettre à une dictature technocratique communiste mondiale des vaccins climatiques, dans laquelle toutes nos libertés, droits civils et droits à l’autodétermination seront supprimés une fois pour toutes. C’était du moins leur plan.


EN COMPLÉMENTAIRE

 

Mais où est ce satané virus ? Personne ne l’a vu ou isolé !

L’appel à l’autorité est une erreur logique. Pourtant, au cours de cette longue simulation Covid-19 de l’autoritarisme mondial, on nous dit encore et encore de faire confiance au CDC, qui s’est trompé tout au long du chemin. La clé d’une république saine est de remettre continuellement en question l’autorité. Et la question la plus importante à poser à cette autorité autocratique est la suivante : le virus Sars-CoV-2 a-t-il déjà été vraiment isolé ? Et si oui, montrez-nous la preuve.

Les Centers for Disease Control (CDC) des États-Unis à Atlanta ont confirmé par écrit qu’ils n’avaient aucun échantillon réel, isolé et purifié du virus SARS-CoV-2 et ne pouvaient fournir aucun enregistrement sur ce virus, qui aurait causé COVID-19.
Au cours des derniers mois, des demandes de Freedom of Information Act (FOIA) ont été adressées aux Centers for Disease Control (CDC) pour demander des preuves que le CDC a isolé ou purifié le virus SARS-CoV-2.
Le 7 juin 2021, le CDC a confirmé (à nouveau) par écrit qu’il n’avait aucun dossier montrant qu’il avait déjà isolé ou purifié le virus qui serait à l’origine de la maladie appelée COVID-19.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Ces demandes écrites ont été faites par Mme Christine Massey au directeur général du CDC/ATSDR FOIA, M. Robert Andoh, pour localiser et fournir TOUS les enregistrements, recherches et/ou résultats pour TOUT isolement et purification « virale » (par quiconque, n’importe où, n’importe quand dans le Monde) à partir d’un échantillon de patient, par macération, filtration et/ou l’utilisation d’une ultracentrifugeuse . . . ce qu’on appelle le « Gold Standard » pour isoler et identifier un micro-organisme pathologique ou nana organisme.
Le « Gold Standard » pour l’isolement et l’identification des microbes sont appelés postulats de Koch et Rivers, qui ont été établis il y a de nombreuses années pour isoler les postulats de bactéries (Koch) ou de virus (Rivers).
Voici une comparaison côte à côte des postulats de Koch et des postulats de Rivers :

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Statement On Virus Isolation (SOVI)

Isolation: The action of isolating; the fact or condition of being isolated or standing alone; separation from other things or persons; solitariness.

– Oxford English Dictionary

La controverse sur la question de savoir si le virus du SRAS-CoV-2 a déjà été isolé ou purifié se poursuit. Cependant, en utilisant la définition ci-dessus, le bon sens, les lois de la logique et les préceptes de la science, toute personne impartiale doit arriver à la conclusion que le virus SARS-CoV-2 n’a jamais été isolé ou purifié. En conséquence, aucune confirmation de l’existence du virus ne peut être trouvée. Les conséquences logiques, de bon sens et scientifiques de ce fait sont :

  • la structure et la composition de quelque chose dont l’existence n’a pas été démontrée ne peuvent pas être connues, y compris la présence, la structure et la fonction de tout spike hypothétique ou d’autres protéines ;
  • la séquence génétique de quelque chose qui n’a jamais été trouvée ne peut pas être connue ;
  • les « variantes » de quelque chose dont l’existence n’a pas été démontrée ne peuvent pas être connues ;
  • il est impossible de démontrer que le SARS-CoV-2 provoque une maladie appelée Covid-19.

En termes aussi concis que possible, voici la bonne façon d’isoler, de caractériser et de démontrer un nouveau virus. Tout d’abord, on prélève des échantillons (sang, crachats, sécrétions) de nombreuses personnes (par exemple 500) présentant des symptômes suffisamment uniques et spécifiques pour caractériser une maladie. Sans mélanger ces échantillons avec AUCUN tissu ou produit contenant également du matériel génétique, le virologue macère, filtre et ultra-centrifuge, c’est-à-dire purifie l’échantillon. Cette technique de virologie courante, utilisée depuis des décennies pour isoler les bactériophages1 et les virus dits géants dans chaque laboratoire de virologie, permet ensuite au virologue de démontrer en microscopie électronique des milliers de particules de taille et de forme identiques. Ces particules sont le virus isolé et purifié.

L’uniformité de ces particules identiques est ensuite vérifiée par des techniques physiques et/ou microscopiques. Une fois la pureté déterminée, les particules peuvent être davantage caractérisées. Cela comprendrait l’examen de la structure, de la morphologie et de la composition chimique des particules. Ensuite, leur constitution génétique se caractérise par l’extraction du matériel génétique directement des particules purifiées et l’utilisation de techniques de séquençage génétique, telles que le séquençage de Sanger, qui existent également depuis des décennies. Ensuite, on fait une analyse pour confirmer que ces particules uniformes sont d’origine exogène (extérieure) conformément au concept de virus, et non les produits de dégradation normaux des tissus morts et mourants.2 (En mai 2020, nous savons que les virologues ont aucun moyen de déterminer si les particules qu’ils voient sont des virus ou simplement des produits de décomposition normaux de tissus morts et mourants.)3

Si nous sommes arrivés jusqu’ici, nous avons complètement isolé, caractérisé et séquencé génétiquement une particule virale exogène. Cependant, nous devons encore montrer qu’il est causalement lié à une maladie. Ceci est réalisé en exposant un groupe de sujets sains (des animaux sont généralement utilisés) à ce virus isolé et purifié de la manière dont la maladie est supposée se transmettre. Si les animaux tombent malades avec la même maladie, comme le confirment les résultats cliniques et d’autopsie, on a maintenant montré que le virus provoque en fait une maladie. Cela démontre l’infectiosité et la transmission d’un agent infectieux.

Aucune de ces étapes n’a même été tentée avec le virus SARS-CoV-2, et toutes ces étapes n’ont pas été non plus réalisées avec succès pour un virus dit pathogène. Notre recherche indique qu’aucune étude montrant ces étapes n’existe dans la littérature médicale.

Au lieu de cela, depuis 1954, les virologues ont prélevé des échantillons non purifiés sur un nombre relativement restreint de personnes, souvent moins de dix, atteintes d’une maladie similaire. Ils traitent ensuite cet échantillon de manière minimale et inoculent cet échantillon non purifié sur une culture tissulaire contenant généralement quatre à six autres types de matériel – qui contiennent tous un matériel génétique identique à ce qu’on appelle un « virus ». La culture tissulaire est affamée et empoisonnée et se désintègre naturellement en de nombreux types de particules, dont certaines contiennent du matériel génétique. Contre tout bon sens, logique, utilisation de la langue anglaise et intégrité scientifique, ce processus est appelé « isolement du virus ». Ce breuvage contenant des fragments de matériel génétique provenant de nombreuses sources est ensuite soumis à une analyse génétique, qui crée ensuite dans un processus de simulation informatique la séquence présumée du virus présumé, un soi-disant génome in silico. A aucun moment un virus réel n’est confirmé par microscopie électronique. A aucun moment un génome n’est extrait et séquencé d’un virus réel. C’est de la fraude scientifique.

L’observation que l’échantillon non purifié – inoculé sur une culture tissulaire avec des antibiotiques toxiques, du tissu fœtal bovin, du liquide amniotique et d’autres tissus – détruit le tissu rénal sur lequel il est inoculé est donnée comme preuve de l’existence et de la pathogénicité du virus. C’est de la fraude scientifique.

À partir de maintenant, lorsque quelqu’un vous remet un article suggérant que le virus SARS-CoV-2 a été isolé, veuillez consulter les sections méthodes. Si les chercheurs ont utilisé des cellules Vero ou toute autre méthode de culture, vous savez que leur processus n’était pas l’isolement. Vous entendrez les excuses suivantes pour lesquelles l’isolement réel n’est pas fait :

  1. Il n’y avait pas assez de particules virales trouvées dans les échantillons de patients pour être analysées.
  2. Les virus sont des parasites intracellulaires ; ils ne peuvent pas être trouvés en dehors de la cellule de cette manière.

Si le numéro 1 est vrai et que nous ne pouvons pas trouver le virus dans les crachats des personnes malades, alors sur quelles preuves pensons-nous que le virus est dangereux ou même mortel ? Si le numéro 2 est correct, alors comment le virus se transmet-il d’une personne à l’autre ? On nous dit qu’il sort de la cellule pour infecter les autres. Alors pourquoi n’est-il pas possible de le trouver?

Enfin, remettre en question ces techniques et conclusions de virologie n’est pas un problème de distraction ou de division. Faire la lumière sur cette vérité est essentiel pour arrêter cette terrible fraude à laquelle l’humanité est confrontée. Car, comme nous le savons maintenant, si le virus n’a jamais été isolé, séquencé ou montré comme provoquant une maladie, si le virus est imaginaire, alors pourquoi portons-nous des masques, prenons-nous des distances sociales et mettons-nous le monde entier en prison ?

Enfin, si les virus pathogènes n’existent pas, alors qu’est-ce qui se passe dans ces dispositifs injectables appelés à tort « vaccins », et à quoi servent-ils ? Cette question scientifique est la plus urgente et la plus pertinente de notre époque.

1 Isolement, caractérisation et analyse des bactériophages du lac halo-alcalin Elmenteita, KenyaJuliah Khayeli Akhwale et al, PLOS One, publié le 25 avril 2019. https://journals.plos.org/plosone/article?id=10.1371/journal. pone.0215734 — consulté le 15/02/21

2 « Vésicules extracellulaires dérivées de cellules apoptotiques : un lien essentiel entre la mort et la régénération », Maojiao Li1 et al, Frontiers in Cell and Developmental Biology, 2 octobre 2020. https://www.frontiersin.org/articles/10.3389/fcell. 2020.573511/complet — consulté le 15/02/21

3 « Le rôle des vésicules extracellulaires en tant qu’alliés des virus du VIH, du VHC et du SRAS », Flavia Giannessi, et al, Virus, 2020 mai

Source : Has the Sars-CoV-2 Virus Ever Really Been Isolated?


VENEZ VISITER NOTRE BOUTIQUE ENB LIGNE QUI ASSUME NOTRE EXISTENCE FINANCIÈRE ACTUELLE:

Sur ce lien:VintageparMichel

 

 

 

 

La Gigantesque Arnaque du COVID-19:Les animaux malades de la peste / politique du bouc émissaire au Québec [et ailleurs]

Un mal qui répand la terreur,
Mal que le Ciel en sa fureur
Inventa pour punir les crimes de la terre,
La Peste (puisqu’il faut l’appeler par son nom),
Capable d’enrichir en un jour l’Achéron, [1]
Faisait aux animaux la guerre.
Ils ne mouraient pas tous, mais tous étaient frappés

– Jean de La Fontaine

 

Le covid 19 c’est, bel et bien, ce mal inventé par les marchés financiers afin de punir un prolétariat par trop populeux et qui ne sert plus à rien dans un contexte où l’économie réelle est moribonde en Occident. Tous frappés par ce fléau difficile à circonscrire, pas vraiment mortel en définitive, les anciens consommateurs sont pris d’un accès de panique et ne savent plus à quel saint se vouer. Joggant sur la voie publique tels des volatiles sans têtes, nos concitoyens réclament une voie de sortie qui, l’espèrent-ils, leur permettra de renouer avec leurs bonnes vieilles habitudes.

Mais, la peste de DAVOS est coriace et ses innombrables variants – véritables surgeons d’un mal qui sévit malgré les médecines de cheval qui nous sont administrées – font leur apparition le temps d’une saison, comme autant de modes éphémères qui dictent les tenues de circonstance. La muselière est de mise en toutes circonstances, que ce soit à l’intérieur ou à l’extérieur, par beau temps ou tempête de verglas, complément obligé d’une tenue élégante ou négligée. Et, le téléphone intelligent, accessoire indispensable, représente la laisse qui permet aux appariteurs sadiques de cette habile mise en scène de faire danser les consommateurs sur les musiques de l’heure.

 

Les maîtres chanteurs

Les marchés financiers qui façonnent de nouveaux produits spéculatifs représentent les maîtres chanteurs d’un système économique qui ne peut plus fonctionner qu’à partir de la coercition et de la terreur instillées par nos gouvernements qui n’en sont que les relais obligés. Les immenses fonds de pension à la BLACKROCK [2] – après avoir détourné le fruit du labeur de la génération du boom de l’après-guerre – ont décidé d’investir du côté de BIG PHARMA, dans un contexte où cette fausse pandémie représente une chance inespérée de faire d’une pierre, plusieurs coups … en effet, les gouvernements, tout en étant saignés à blanc par l’ARN MESSAGER, se disent qu’il faut bien que cette panacée serve à quelque chose. Alors, on vaticine et vaccine à tout va. Après que la Fondation Rockefeller a étudié divers scénarios de pandémies, après que le Seigneur de DAVOS a annoncé la venue d’une grande réinitialisation censée nous délivrer de nous-même, et que l’Organisation Mondiale de la Santé s’est perdue en conjectures à propos d’une flopée de variants préalablement baptisés par des gnostiques déjantés, le champ de bataille était libre pour une mise en quarantaine définitive de nos sociétés décadentes.

Sésame, ouvre-toi !

Le PASS SANITAIRE ou VACCINAL, véritable prélude à un contrôle biométrique complet du bétail humain, permet de faire en sorte que les brebis galeuses ne puissent pas être tentées de contaminer l’eau de la mangeoire commune. À l’instar de cette fable des Animaux malades de la peste, les consommateurs sevrés par cette crise sanitaire orchestrée sentent qu’il faudra bien sacrifier quelques-uns parmi les marginaux qui refusent de se conformer aux diktats de l’heure. C’est ici que la théorie du bouc émissaire, complément indispensable des stratégies de triangulation de l’ingénierie sociale, fait son entrée en scène de manière magistrale. Puisque dans une triangulation réussie il faut bien qu’une victime expiatoire tienne lieu de médiation entre les captifs et leurs bourreaux. Pétries d’un christianisme couvant sous les braises, bien que décharné, nos sociétés ont cherché à se délester de leurs responsabilités en sacrifiant des boucs émissaires.

Crier haro sur le baudet

Ainsi, incapables de justifier l’inoculation d’un poison qui ne protège pas vraiment des séquelles de cette flopées de variants créés en laboratoire, ne trouvant pas les mots afin d’expliquer pourquoi il faut imposer un nouveau couvre-feu à partir du temps des fêtes et en quoi la destruction de nos liens filiaux nous protègerait-elle contre ce prétendu fléau, nos bourreaux s’en remettent aux non-injectés et à tous ceux qui refusent de se plier aux injonctions de cette tyrannie techno-médicale.

Le Lion tint conseil, et dit : « Mes chers amis,
Je crois que le Ciel a permis
Pour nos péchés cette infortune ;
Que le plus coupable de nous
Se sacrifie aux traits du céleste courroux ;
Peut-être il obtiendra la guérison commune. »

 – Jean de La Fontaine

Ne plus couper les cheveux en quatre

Et, dans un contexte où les « non-vaccinés » pourraient bien représenter un groupe témoin gênant, il devient urgent de les isoler afin de les contraindre à se plier aux exigences du sacrifice collectif qui nous est proposé. Quitte à faire crever les plus irréductibles dans les meilleurs délais, puisqu’il y a péril en la demeure à l’heure où nos sadiques tortionnaires ambitionnent d’implémenter un système de contrôle biométrique sanitaire et sociétal de manière permanente. Il faut donc aller au plus pressant et cesser, séance tenante, de tergiverser sur une question qui a déjà été tranchée des lustres avant le signal de départ de ce véritable coup d’état néofasciste.

Les entités maléfiques qui ont pris le contrôle du Parlement du Québec (en France et ailleurs) ne coupent plus les cheveux en quatre puisque leurs commanditaires de l’industrie pharmaceutique et du Forum économique mondial de Davos réclament des mesures plus musclées et expéditives avant la venue du printemps. Le bon peuple étant manifestement excédé par tous ces excès de zèle, réalisant que l’économie est sur le point de rendre l’âme et que les effets secondaires de la potion magique épuisent une masse grandissante parmi les animaux conformes, [3] il faut faire vite avant que la coupe ne déborde.

Chez nous, au Québec, les responsables de ce carnage socioéconomique sont littéralement pris d’une rage indescriptible. Il faut faire vite et bien. Et, surtout pas dans la dentelle. Alors, les brebis galeuses, non-conformes, n’ayant plus accès à aucune forme de divertissement, ne pouvant plus entrer dans les musées et autres édifices publics, ne pouvant plus se restaurer ou festoyer avec les autres animaux, et, après s’être fait mettre à l’écart par les membres de leurs familles respectives, devront payer un pactole pour être admis à l’hôpital et la JUNTE aux manettes a même tenté, à l’instar de la province du Nouveau Brunswick, de les priver de nourriture en forçant les distributeurs alimentaires à imposer le sésame sanitaire. Heureusement, jusqu’à nouvel ordre, les petits commerçants et les grandes chaînes ont refusé d’obtempérer [4]. Et, alors que près d’un million de Québécois vivent comme des chiens, en ne sachant pas ce que DEMAIN leur réservera, une flopée de chroniqueurs stipendiés par le grand capital réclame que des sanctions à la hauteur du crime tombent. Il faut anéantir ceux et celles qui osent toujours défier les injonctions de nos maîtres véritables. Dans ces conditions, on comprend facilement l’empressement des psychopathes de service au Parlement de Québec. On ne sait jamais ce qui pourrait advenir si, d’office, une plainte pour CRIMES CONTRE L’HUMANITÉ, finissait par être traitée en bonne et due forme à la Cour internationale de Justice.

L’Âne vint à son tour, et dit : « J’ai souvenance
Qu’en un pré de moines passant,
La faim, l’occasion, l’herbe tendre, et je pense
Quelque diable aussi me poussant,
Je tondis de ce pré la largeur de ma langue.
Je n’en avais nul droit, puisqu’il faut parler net. »
À ces mots, on cria haro sur le baudet.

 – Jean de La Fontaine

Patrice-Hans Perrier
Source Le Saker Francophone


NOTES

1-Les charognards se gaventPfizer, BioNtech et Moderna réalisent un bénéfice de 1.000 dollars par seconde.

L’arnaque Covid a décidément fait beaucoup d’heureux aux côtés des centaines de milliers de morts et des millions d’éclopés, et cela ne pourra que s’accentuer, avec les booster 3, puis 4, puis ad vitam aeternam.

Selon People’s Vaccine Alliance, chaque seconde, Pfizer, BioNtech et Moderna réalisent un bénéfice de 1.000 dollars. Cette manne représente, pour l’année en cours, un bénéfice avant impôts estimé à 34 milliards de dollars, soit 65.000 par minute ou 93,5 millions de dollars par jour,. 

Comparons ce montant, gagné chaque seconde par les trois larrons pharmaceutiques,  au salaire moyen annuel en France, dans le monde, dans l’UE et en Afrique, on obtient :

  France Monde UE Afrique
Salaire annuel moyen en k$ 46,5 9,5 28,8 1,3
1,4 6,8 2,3 50,0

Cela veut dire que les trois mousquetaires de Big Pharma gagnent en une minute, 1,4 fois le salaire annuel d’un Français, 2,3 fois celui d’un Européen (UE) et 50 fois celui d’un Africain

Ces trois fabricants ont  aussi perçu plus de 8 milliards de dollars d’aides publiques américaines pour développer leurs vaccins tueurs et invalidants.

Par ailleurs, selon une étude commandée par le groupe de La Gauche au Parlement européen, la taxation des multinationales qui ont enregistré des bénéfices exceptionnels pendant la pandémie, pourrait rapporter 25 milliards d’euros à l’Union européenne, dont 5,6 milliards à la France. De quoi répondre aux besoins en hôpitaux ou en personnels de santé.

On n’est jamais mieux servi que par … les siens

Premier exemple
Ce mercredi 1er décembre, la présidente de la Commission européenne, Ursula von der Leyen, a déclaré en conférence de presse que le temps était venu de réfléchir à l’option d’une vaccination obligatoire.  Elle a donc déclaré qu’il était temps de créer des plans COVID destinés à obliger TOUS les états européens à vacciner (3 doses et plus) les 445 millions d’Européens.

Ursula von der Leyen est la femme du directeur d’un fabricant de vaccins Covid ARNm.  Son mari, Heiko von der Leyen est le directeur médical de Orgenesis, une société américaine de biotechnologie spécialisée dans les « vaccins à base de cellules » et de thérapies de géniques, qui se proclame fièrement « l’Uber de l’espace de thérapie cellulaire et génique« .

Il a occupé ce poste depuis le 20 septembre et a servi sur son comité consultatif scientifique depuis 2019.

Deuxième exemple. En Russie…aussi

Tatyana Golikova, commissaire de Covid de Russie a travaillé sans relâche pour imposer les passeports vaccinaux. Bien sûr, cela n’a rien à voir avec le fait que son beau-fils Vladimir Khristenko fabrique le vaccin Kovivak (approuvé pour une utilisation depuis le 2021).

La population de la Fédération de Russie est de 145,9 millions de personnes, il y a donc des milliards à glaner.

Le vaccin KoviVac est produit la société Nanolek. L’un des fondateurs, ainsi que le président de Nanolek, est le beau-fils Tatyana Golikova, cheffe du siège de la lutte contre le coronavirus.

La conclusion de tout cela est simple : la vaccination, rendue quasi obligatoire en Russie, rapporte des revenus colossaux à un groupe de personnes bien spécifique.

Il est difficile de croire qu’en promettant 189 milliards de roubles pour la vaccination des Russes, le gouvernement n’a pas calculé à qui iront ces fonds.

2-Seules DEUX sociétés, Vanguard et BlackRock, contrôlent la planète, alors que les 1 % les plus riches du monde possèdent 82 % de la richesse mondiale

 

Les actions des plus grandes entreprises du monde sont détenues par les mêmes investisseurs institutionnels. Ils sont tous propriétaires les uns des autres.
Cela signifie que des marques « concurrentes », comme Coke et Pepsi, ne le sont pas vraiment, puisque leurs actions sont détenues par exactement les mêmes sociétés d’investissement, fonds de placement, compagnies d’assurance, banques et, dans certains cas, gouvernements. C’est le cas dans toutes les industries.
Les petits investisseurs sont détenus par de plus gros investisseurs. Ceux-ci sont détenus par des investisseurs encore plus grands. Le sommet visible de cette pyramide ne comporte que deux sociétés dont nous avons souvent vu le nom…

Ce sont Vanguard et BlackRock.

3-Pandémie Vaccinale. Les personnes ayant reçu un vaccin Covid-19 représentent 70% des décès toutes causes confondues au cours des 6 premiers mois de 2021, 20% survenant dans les 21 jours suivant la vaccination
4-La situation est pire en Tunisie, dans laquelle un gouvernement fantoche [i.e. soumis aux oukases de ceux qui décident OMS, Big Pharma, Empire anglo-sioniste, …] , seuls le petits commerces sont accessibles aux pestiférés (i.e. sans pass nasitaire). Les grandes surfaces ont été les premières à exiger le pass de la honte.

N’OUBLIEZ PAS DE VISITER LA BOUTIQUE EN LIGNE DE VOTRE SITE WEB FAVORI

Sur ce lien:Vintage par Michel

La Criminelle Arnaque du COVID-19:93% des autopsies révèlent que des personnes vaccinées contre le Covid-19 sont mortes du vaccin

La piqûre de vax Covid-19 a été impliquée dans 93% des décès de personnes autopsiées. Le point le plus intéressant à noter est que le coroner ou le procureur général a affirmé qu’ils n’étaient pas dus aux piqûres du génocide. Au départ, quinze corps ont été examinés, âgés de 28 à 95 ans. Ils étaient décédés de 7 jours à 6 mois après la « vaccination ». Cependant, un examen plus approfondi a révélé que la piqûre ayant provoqué un caillot était la cause du décès de 14 des 15 patients. L’organe le plus attaqué était le cœur, mais d’autres organes étaient touchés comme les poumons et le foie. La signification de ces découvertes est déconcertante, car cela signifie qu’il existe un potentiel de millions de décès.

Dr Sucharit Bakdi
Dr Sucharit Bakdi

 

 

Le Dr Sucharit Bhakdi et le Dr Arne Burkhardt ont fait un travail merveilleux pour sensibiliser le public à ces dangereux piqûres de vax Covid-19. Les membres des familles ont demandé que les corps de ces victimes soient minutieusement examinés. Le Dr Bhakdi a consacré toute sa vie à la pratique, à l’enseignement et à la recherche en microbiologie et en maladies infectieuses. Le Dr Burkhardt est un pathologiste et virologue de renommée mondiale qui a publié plus de 300 articles dans les domaines de l’immunologie, de la bactériologie et de la virologie. Les deux hommes travaillent actuellement en Allemagne. Ironiquement, le Dr Bhakdi envisage de quitter le pays parce que les autorités sanitaires veulent que son enfant de 4 ans soit piqué par vax Covid.

Le Dr Bhakdi et le Dr Burkhardt ont tous deux remarqué que chez 14 des 15 patients témoins, il y avait de nombreuses preuves de l’attaque du corps contre lui-même, ce qu’ils n’avaient jamais vu auparavant. Ces patients étaient des personnes décédées à la maison, lors d’événements sportifs, dans la voiture ou au travail. Le Dr Burkhardt a pu ajouter 55 patients supplémentaires à ses examens, portant le nombre total à 70. Chez plus de 90 % des personnes décédées, le Dr Burkhardt a découvert une auto-attaque auto-immune dans les tissus de ces organes par des lymphocytes T tueurs, dans la plage d’âges de 28 à 90 ans. Dans tous les décès, ils ont trouvé les mêmes résultats pathologiques. Le seul dénominateur commun à toutes ces personnes était le vax génocidaire Covid, une thérapie génique, qui a causé des dommages aux protéines de pointe aux tissus. Quatre des victimes du vax Covid-19, n’ont reçu qu’une seule dose. À chaque piqûre de Covid, le système immunitaire s’aggrave progressivement. Le Dr Bhakdi décrit les injections comme «fuyantes», produisant des protéines de pointe qui préparent les organes à l’attaque des lymphocytes tueurs. Il a également noté que ces lymphocytes du système lymphatique sont en train de mourir. Ces cellules sont responsables de la destruction des virus et des bactéries déjà présents dans notre corps, tels que la mononucléose infectieuse, le cytomégalovirus, le virus de l’herpès, le virus d’Epstein-Barr, la tuberculose, la toxoplasmose et tout autre virus dormant. Le Dr Bhakdi a également noté qu’il y a « une explosion de tumeurs et de cancers parmi les vaccinés que personne ne peut expliquer« . Les lymphocytes sont les cellules responsables du contrôle des cancers dans notre corps.

 

 

Le Dr Hoffe avait découvert plus tôt cette année dans ses propres recherches que 60% des patients qui avaient reçu la piqûre de génocide Covid avaient des niveaux élevés de D-dimères, ce qui est un indicateur de coagulation sur les parois des petits vaisseaux sanguins. Le Dr Ryan Cole, un autre pathologiste, constate une multiplication par vingt du cancer de l’utérus, ainsi que d’autres tumeurs. Le Dr Cole a noté que les « vaccins » n’incitent pas les patients à produire suffisamment d’IgA sécrétoires. L’immunoglobuline A est la première ligne de défense contre les microbes nocifs, tout en maintenant une réponse immunologique équilibrée. Enfin, le Dr Cole reconnaît que les infiltrats de lymphocytes T dans la population piquée sont destructeurs de tissus. Il veut faire une étude pour voir comment la protéine de pointe se dépose dans les organes au site des infiltrats.

CONCLUSION

Le fameux docteur Bhakdi a été nominé pour un prix Nobel en 2021.Il est actuellement le scientifique le plus censuré de la planète!

Le travail de l’équipe Bhakdi/Burkhardt est une bombe. C’est la première fois qu’une étude explique comment les piqûres du vax du génocide tuent les lymphocytes dans le système lymphatique, ce qui équivaut à une station d’épuration du corps. Cela conduira par conséquent à l’émergence d’agents pathogènes dormants infectant l’hôte. Je connais personnellement une infirmière praticienne en Pennsylvanie qui a contracté le zona et une infection au Covid-19, après sa troisième injection de rappel. L’une des questions que je me pose et sur laquelle je pense que nous avons besoin de plus de recherches est la suivante : la mort des lymphocytes est-elle une conséquence permanente de l’injection de Covid ? Nous savons par des études antérieures que chaque injection semble détruire l’immunité. Les piquants se préparent-ils à une facilitation de l’infection par des anticorps (Antibodydependant enhancement ou ADE en anglais), ce qui conduirait à des infections percées ? [Une infection percée est un cas de maladie dans lequel un individu vacciné devient infecté par la maladie, en raison du fait que le vaccin n’a pas réussi à fournir une immunité complète contre l’agent pathogène]

Le travail de l’équipe Bhakdi/Burkhardt, ainsi que du Dr Hoffe et du Dr Cole, peut être décrit comme suit.
– Premièrement, les événements inflammatoires dans les petits vaisseaux sanguins sont caractérisés par une abondance de lymphocytes T et de cellules endothéliales mortes, qui à leur tour peuvent conduire à des caillots sanguins.
– Deuxièmement, il y a une accumulation importante de lymphocytes T dans les tissus entourant les vaisseaux sanguins.
– Troisièmement, il y a une infiltration massive des organes et des tissus avec ces cellules tueuses.
D’après les travaux de tous ces scientifiques, nous voyons que le cœur est le principal organe impliqué, mais la coagulation peut se produire n’importe où avec ces piqûres Covid, du cerveau aux vaisseaux sanguins. Ces « injections de caillots » doivent être stoppées immédiatement !

Source
Réseau d’actualités Nemos – 11 janvier 2022


N’OUBLIEZ PAS DE VISITER NOTRE BOUTIQUE EN LIGNE 

Sur ce lien:Vintage parMichel

 

 

 

 

Poésie:Des nouvelles de la cigale et la fourmi

Nous avons des nouvelles de la cigale et la fourmi
La Cigale, s’étant faite vaccinée ,
Se trouva fort dépourvue
Quand le Variant fut venu.
Les vaccins ne protégeaient
Point plus qu’un stock de PQ,
Point plus qu’un bout de tissu.

Elle va pleurer grise mine
Chez la Fourmi sa voisine,
l’accusant de l’avoir infectée
n’étant, elle, pas vaccinée !
Mais la Fourmi reste digne,
face à cette verve assassine.

Elle connait la plandémie honteuse,
Et répondit à cette emmerdeuse :
– Que faisiez-vous sur les réseaux ?
N’étiez-vous pas hier du côté des collabos?
Aviez-vous cherché d’autres pistes ?
Non bien sûr ! vous n’êtes pas complotiste !

– Nuit et jour à tout venant,
J’ai écouté le gouvernement,
Suivi la bien-pensance sans faille,
Les vaccinés n’sont pas cobayes !
BigPharma le jure, foi d’animal,
Nos vies sont leur intérêt principal !

– J’en suis fort aise…
Eh bien, toussez maintenant et PASSez votre chemin !

Jean de La Quarantaine

 


AUTRE VERSION

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 


N’OUBLIEZ PAS DE VISITEZ NOTRE BOUTIQUE EN LIGNE

Sur ce lien:Vintage par Michel