La Criminelle Arnaque du COVID-19:Des preuves biochimiques et statistiques officielles confirment à 100 % que Moderna a créé le Covid-19

1) Lorsque  Kadhafi avait annoncé dans les années 60, en parlant des Américains, « ils fabriqueront des médicaments, et pour vous les fourguer, ils fabriqueront les maladies qui vont avec »; les « experts » l’avaient traité de « fou ». Les mêmes qui traitent aujourd’hui Poutine de fou.
2) Les Big Pharma (Pfizer, Moderna, J&J, etc.) ont sorti leur vaccin Covid en quelques mois, alors qu’habituellement il faut au moins 10 ans, prouve qu’ils étaient tous « au parfum »  de l’arnaque covid qui se préparait chez Moderna.
3) Dès le début de cette pseudo pandémie, nous avons été parmi les premiers à dénoncer cette arnaque et à affirmer que cette « maladie » est artificielle et qu’elle était conçue dans les labos de l’Oncle Sam.  H. Genséric

Des preuves sont apparues prouvant au-delà de tout doute raisonnable que le géant pharmaceutique Moderna, la société qui a gagné des milliards grâce à la vente d’une injection expérimentale appelée vaccin de Covid-19, a en fait créé le virus Covid-19.

Le 23 février, le Daily Mail a publié un article montrant que Moderna avait breveté la séquence de 19 lettres de base (nucléotides) qui code pour le site Furin Cleavage dans Covid-19. 

Il a cité un article rédigé par des scientifiques en Inde, en Suisse, en Italie et aux États-Unis ( avec prudence intitulé : MSH3 Homology and Potential Recombination Link to SARS-CoV-2 Furin Cleavage Site ) dans lequel ils ont calculé que les chances d’une séquence de 19 nucléotides, brevetée par Moderna, apparaissant au hasard dans Covid-19 , dans des circonstances où il n’apparaît nulle part ailleurs dans la nature sont de 1 sur 3 milliards [1].

Mais ils n’ont pas réussi à en tirer la déduction évidente. S’ils avaient fait cette déduction évidente, je crains que cela n’ait été la dernière déduction scientifique qu’ils aient jamais publiée !

Ils ont décidé d’enquêter sur la séquence d’ARN du site de clivage de la furine dans la protéine de pointe Covid-19 pour voir si cela se produisait ailleurs dans la nature. .

Heureusement, le NCBI/NIH a produit la merveilleuse base de données BLAST qui répertorie toutes les séquences de gènes dans la nature connues de l’homme et toutes les séquences de gènes synthétiques brevetées connues de l’office des brevets.

Les chercheurs ont choisi la séquence Furin Cleavage car il s’agit de la seule séquence continue de lettres de gène (séquence de nucléotides) dans Covid-19 avec plus de 3 nucléotides, qui diffère des lettres respectives dans son parent naturel le plus proche, le Bat Coronavirus RaTG13 (toutes les autres différences sont 3 lettres ou moins). C’était donc de loin le meilleur candidat pour déterminer si le Covid-19 était ou non créé par l’homme.

 

De plus, le site de clivage de la furine est la clé de la pathogénicité de Covid-19 . Donc, s’il devait y avoir un gain de fonction créé par l’homme inclus dans le virus, c’est là que l’on pourrait s’attendre à le trouver.

La séquence d’acides aminés du site de clivage de la furine est PRRA (Proline Argenine Argenine Alanine). Chaque acide aminé est codé par un codon composé de 3 nucléotides (lettres de séquence génétique). Ainsi, toutes les différences dans le code génétique entre Covid-19 et RaTG13 sont au plus long d’un codon, d’un acide aminé, autre que la séquence de clivage de la furine, qui est…

CCT CGG CGG GCA

La séquence complémentaire (le brin d’ADN opposé de la double hélice est (GGAGCCGCCCGT) car C se lie à G et A se lie à T

Le compliment inverse (la même chose écrite à l’envers) est donc TGCCCGCCGAGG

Les chercheurs ont effectué une recherche d’alignement BLAST (Basic Local Alignment Search Tool) (ce qui signifie qu’ils recherchent la séquence du gène, la séquence du gène inverse, la séquence du gène complémentaire et la séquence du gène complémentaire inverse) à travers chaque séquence de gènes dans la nature connue de l’homme depuis CTCCTCGGCGGGCACGTAG qui est la séquence de 19 nucléotides contenant la séquence de clivage de la furine, qui apparaît également dans Covid-19, et qui se trouve en fait sous la forme de complément inverse CTACGTGCCCCGCCGAGGAG brevetée par Moderna.

Leurs résultats de recherche peuvent être trouvés ici . 

Le tableau 1 montre qu’il existe bien dans les 5 brevets américains cités ci-dessous…

US9149506B2 : Polynucléotides modifiés codant pour la septine-4 – https://patents.google.com/patent/US9149506B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618953P
2013-12-16 Demande déposée par Moderna Therapeutics Inc
2014-05-22 Publication de US20140141067A1
2015-10-06 Publication de US9149506B2
2015-10-06 Demande accordée
2020-01-10 Premier litige familial mondial déposé

US9216205B2 : Polynucléotides modifiés codant pour la granulysine – https:// patents.google.com/patent/US9216205B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618873P
2013-12-16 Demande déposée par Moderna Therapeutics Inc
2014-04-24 Publication de US20140113960A1 2015-12-22
Publication de US9216205B2 2015-12-22
Demande accordée

SIAH encodant la polynucléotide E3subitine modifiée protéine ligase 1 – https://patents.google.com/patent/US9255129B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618868P
2013-12-16 Demande déposée par Moderna Therapeutics Inc
2014-05-22 Publication de US20140141068A1
2016-02-09 Demande accordée
2016-02-09 Publication de US9255129B2

US9301993B2 : Modified polynucleotides coding apoptosis inducing factor 1 – https://patents.google.com/patent/US9301993B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Mandataire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618957P
2013-12- 16 Demande déposée par Moderna Therapeutics Inc
2014-04-17 Publication de US20140107189A1
2016-04-05 Demande accordée
2016-04-05 Publication de US9301993B2
2020-01-10 Premier litige familial mondial déposé

US9587003B2 : Polynucléotides modifiés pour la production de protéines et de peptides liés à l’oncologie – https://patents.google.com/patent/US9587003B2/en 

Inventeur : Stephane Bancel, Tirtha Chakraborty, Antonin de Fougerolles, Sayda M. Elbashir, Matthias John, Atanu Roy, Susan Whoriskey, Kristy M. Wood, Paul Hatala, Jason P. Schrum, Kenechi Ejebe, Jeff Lynn Ellsworth, Justin Guild

Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618868P
2016-02-04 Demande déposée par ModernaTx Inc
2016-06-02 Publication de US20160152678A1
2017-03-07 Publication de US9587003B2
2017-03-07 Demande accordée

Ainsi, Moderna a déposé une première demande de brevet pour la séquence de 19 nucléotides en 2013 le 16 décembre. Peut-être que le 25 décembre aurait été plus approprié puisqu’il était destiné à devenir la couronne d’épines de Mathew27, Mark15 et John19.

Tableau 2 : montre que la séquence se produit dans Covid-19 du nucléotide 23601 à 23619.

Tableau 3 : montre que cette séquence de gène n’existe pas dans la nature (mais 14 parties nucléotidiques de celle-ci existent). 

J’ai décidé de vérifier leur travail. Oui. Je les ai effectivement vérifiés (j’enverrai une facture aux mondialistes). Cela s’est avéré être un voyage un peu épique. La page de brevet Google pour US9587003B2 ne contient pas la séquence du gène. Le pdf du brevet ne contient pas la séquence du gène et n’est pas consultable à partir des pages 101-304. Mais il a un lien vers une longue section « Liste des séquences » que l’on ne peut pas copier. Je l’ai donc transcrit manuellement de ma main juste –  http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US09587003B2 

À partir de cette page, vous pouvez entrer l’ID de séquence cité dans l’article sous la forme 11652 et accéder à https://seqdata.uspto.gov/?pageRequest=viewSequence&DocID=US09587003B2&seqID=11652 qui a ce qui suit aux nucléotides 2751-2733 en lisant à l’envers…

gccctgatca ccatcatggc ccagatcggc ag ctacgtgc ccgccgagga g gccaccatc 2760

CTACGTGCCCCGCCGAGGAG breveté par Moderna est le complément inverse de CTCCTCGGCGGGCACGTAG, la séquence de 19 nucléotides qui apparaît dans l’ADN de Covid-19 à partir du nucléotide 23601-23619 (qui serait donc couvert par leur brevet).

De même, vous pouvez rechercher la séquence dans US9149506B2 en allant sur https://seqdata.uspto.gov/?pageRequest=viewSequence&DocID=US09149506B2&seqID=11652 , après quoi vous retrouverez la même chose

gccctgatca ccatcatggc ccagatcggc ag ctacgtgc ccgccgagga g gccaccatc 2760

J’ai ensuite recherché la séquence génétique de Wuhan Hu1 (alpha) sur https://www.ncbi.nlm.nih.gov/nuccore/NC_045512 et j’ai trouvé 

23581 ttatcagact cagactaatt ct cctcggcg ggcacgtag t gtagctagtc aatccatcat de https://www.ncbi.nlm.nih.gov/nuccore/NC_045512 

Qui a la séquence de 19 nucléotides CTCCTCGGCGGGCACGTAG de 23601-23619 comme décrit dans le tableau 3. 

J’ai ensuite effectué ma propre recherche par explosion non alignée de toutes les séquences de gènes brevetées pour le compliment inverse directement (ou peut-être pour un compliment inversé) et j’ai obtenu les mêmes résultats que les chercheurs. 

Et pareil pour les 3 autres brevets américains.

Je peux donc confirmer, et le lecteur peut confirmer en utilisant les liens ci-dessus, que Moderna a demandé un brevet non seulement sur le complément inverse du site de clivage de la furine à 12 nucléotides dans Covid-19, mais en fait sur la séquence de 19 nucléotides le contenant comme décrit au dessus.

De plus, ils n’ont pas simplement déposé une demande de brevet le 4 février 2016 avec US9587003B2 : comme le rapporte le Daily Mail. Ils ont effectivement déposé le 16 décembre 2013 pour 4 brevets avec US9149506B2, US9216205B2, US9255129B2, US9301993B2 : également.

Ainsi, Moderna avait développé la séquence de gènes de 19 nucléotides contenant le site de clivage de la furine qui donne à Covid19 son infectivité pour l’homme grâce à une recherche brevetée sur le gain de fonction dès 2013, 6 ans avant l’épidémie de Wuhan. Pas 3 comme rapporté dans le Mail et viralement ailleurs.. 

Alors maintenant, nous examinons les chances que cela se produise naturellement. L’article calcule la probabilité que cette séquence particulière de 19 nucléotides se produise de manière aléatoire dans un virus de 30 000 nucléotides comme

(30 000-18) × (1/4) 19   = 1,09 × 10 -7

Ce qui est correct car il y a 30 000 à 18 places pour commencer la séquence étant donné qu’il faut encore 18 lettres supplémentaires pour la compléter. Mais il y a en fait 29 904 nucléotides dans Wuhan HU1 (alpha). Un calcul plus précis serait donc

(29 904-18) × (1/4) 19   = 1,087 × 10 -7

Ensuite, ils calculent les chances que la séquence de 19 nucléotides se produise dans la bibliothèque brevetée de 24 712 séquences d’une longueur moyenne de 3 300 nucléotides. Mais ce calcul n’est pas pertinent car la séquence n’est pas apparue au hasard dans 5 demandes de brevet Moderna. La séquence était connue pour coder pour un site de clivage de la furine, qui est connu pour fournir un gain de fonction aux coronavirus.

Il y a été mis délibérément et breveté en raison de son pouvoir infectieux chez l’homme, que nous verrons plus loin dans l’article, résulte du remplacement du codon viral normal de l’arginine (R) AGA (utilisé dans 45 % des codons viraux de l’arginine) par le le codon de l’arginine humaine CGG (utilisé dans 0 % des codons de l’arginine virale) dans le site de clivage de la furine.

Tout ce que nous essayons de déterminer ici, c’est quelles sont les chances qu’une séquence de 19 nucléotides brevetée par Moderna apparaisse dans Covid-19 par des causes naturelles, les mutations naturelles du Bat Coronavirus RaTG13 ou d’un autre virus.

Les nucléotides forment des codons qui sont des triplets. Il y a donc 64 triplets possibles des 4 nucléotides d’ADN ACGT (4x4x4 = 64). Mais tous les triplés se produisent. 61 codent pour 20 acides aminés de manière redondante et 3 sont des codons stop qui indiquent au ribosome d’arrêter de fabriquer la protéine.

Mais les choses ne sont pas aussi simples car le site de clivage Furin apparaît dans la protéine de pointe là où il doit être et la protéine de pointe n’a que 1273 × 3 = 3819 nucléotides. Les chances que la séquence de 19 nucléotides Furin Cleavage apparaisse dans la protéine de pointe sont 

(3 819-18) × (1/4) 19   = 1,389 × 10 -8

Soit 1 sur 72 millions. Ce seraient donc les chances qu’une variante particulière, disons la première variante de Covid-19, ait la séquence de 19 nucléotides au bon endroit (le pic). Et il l’a fait. Donc, certainement selon la prépondérance des probabilités, et certainement au-delà de tout doute raisonnable (1 sur 72 millions étant un doute déraisonnable), Moderna a créé Covid-19. 

Preuve 100% biochimique que Covid19 a été créé par l’homme

Le double codon CGG utilisé dans le site de clivage spécifique de la furine Moderna ne se produit dans aucun autre site de clivage de la furine dans aucun autre virus dans la nature. Les sites de clivage de la furine se produisent dans d’autres virus mais PAS du tout dans d’autres bétacoronavirus comme Covid-19 et PAS du tout avec le double codon CGG.

L’arginine (R), peut être codée par l’un des 6 triplets : AGG, AGA, CGA, CGC, CGG, CGT. Dans le Covid-19, le site de la furine (PRRA), compte 12 nucléotides (3 x 4). Dans le Covid-19, le doublet RR du site de la furine est codé par CGG-CGG.  

Antonio R. Romeu

Deux biochimistes, le professeur Antonio R. Romeu et le professeur assistant Enric Ollé, ont analysé le doublet RR à partir d’un large échantillon de sites de clivage de la furine de plusieurs types de virus . Ils ont découvert qu’il n’y avait aucun doublet RR codé par les codons CGG-CGG dans aucun virus dans la nature. Ils ont observé que le triplet AGA était le codon majoritaire impliqué dans ces doublets RR viraux.

Dans toute recombinaison génétique (où une partie d’un génome fusionne avec un autre génome), le code donneur est transmis à l’accepteur. Mais il n’y a tout simplement AUCUN VIRUS CONNU avec un site de clivage de la furine spécifique de Moderna (ayant la paire de codons CGG-CGG) qui existe pour donner un site de clivage de la furine spécifique de Moderna à Covid19. Donc, la seule façon dont cette séquence pourrait entrer dans Covid-19 est de Moderna. Moderna était le donateur. La nature ne l’était pas. CQFD. Affaire classée..  

Mais ça empire.

Les professeurs espagnols ont décidé d’analyser l’utilisation du codon de l’arginine dans chaque protéine de Covid-19. Le constat suivant…
AGG (13%)
AGA (45%)
CGA (5%)
CGC (10%)
CGG (3%)
CGT (24%). 

Ainsi, le triplet de codons AGA était majoritaire et, fait intéressant, CGG était le codon minoritaire de l’arginine dans le virus. 

Mais c’est encore pire.

Dans le cas particulier de la protéine S, sur les 42 Arginines (R) dont elle dispose, 20 sont codées par AGA, et seulement 2 par CGG. Ces 2 bien sûr, sont les deux dans le site de clivage Moderna Specific Furin.

Ainsi, la seule arginine dans la protéine de pointe qui est codée à la Moderna se trouve sur le site Furin Cleavage. Les 40 autres instances n’utilisent pas du tout CGG. 

Ils poursuivent ensuite en commentant que chaque espèce individuelle dans la nature a ses propres préférences de codons. De toute évidence, les virus aiment AGA, et n’aiment pas du tout CGG, dans la nature.

Mais devinez quelle espèce utilise CGG pour l’arginine plus que les 5 autres codons concurrents – oui, son vieil homo sapiens. Nos préférences de codage pour l’arginine sont

AGG (20 %)
AGA (20 %)
CGA (11 %)
CGC (19 %)
CGG (21 %)
CGT (9 %).

Ainsi, le codon CGG dans le site de clivage de la furine SERA issu de la recherche sur le gain de fonction chimère (combinaison homme-animal). 

Quelqu’un d’autre que Moderna aurait-il pu créer le Covid-19 en utilisant le site de clivage de la furine spécifique de Moderna ?

« De nouveaux documents montrent que 18 mois seulement avant l’apparition des premiers cas de Covid-19, les chercheurs avaient soumis des plans pour libérer des nanoparticules et des aérosols pénétrant dans la peau contenant de « nouvelles protéines de pointe  » de coronavirus de chauve-souris  des cavernes du Yunnan, en Chine. Ils prévoyaient également de créer des virus chimériques, génétiquement améliorés pour infecter plus facilement les humains, et ont demandé 14 millions de dollars à la Defense Advanced Research Projects Agency (Darpa) pour financer les travaux.

Des articles, confirmés comme authentiques par un ancien membre de l’administration Trump, montrent qu’ils espéraient introduire des «sites de clivage spécifiques à l’homme» pour les coronavirus de chauve-souris, ce qui faciliterait l’entrée du virus dans les cellules humaines.
Lorsque Covid-19 a été séquencé génétiquement pour la première fois, les scientifiques étaient perplexes quant à la façon dont le virus avait développé une telle adaptation spécifique à l’homme au site de clivage de la protéine de pointe, raison pour laquelle il est si infectieux. – le Telegraph

Je peux voir tous les grands journalistes du Daily Mail et du Telegraph (sans parler des scientifiques du monde entier) faire toutes ces recherches sur Covid19 et arriver à la conclusion logique inévitable qu’il y a eu une fuite accidentelle ou délibérée d’un laboratoire et doivent ensuite formuler leurs conclusions de manière à étiqueter cette forte probabilité comme une possibilité faible. 

Mais ci-dessus, nous l’avons prouvé comme un fait (puisque le codon CGG de la séquence de clivage spécifique de la furine de Moderna n’apparaît dans aucun site de clivage de la furine dans aucun virus naturel et, par conséquent, il ne peut pas avoir été le résultat d’une recombinaison génétique naturelle. Il doit donc être le résultat d’une insertion génétique faite par l’homme. 

En théorie, une autre partie impliquée avec le NAIAD ou le NIH aurait pu utiliser le site de clivage de la furine breveté par Moderna et fabriquer Covid19 eux-mêmes. Cela n’aurait brisé aucun brevet de Moderna. Le site de clivage Furin lui-même n’est pas brevetable étant connu depuis au moins 2004

US7223390B2 : Insertion de sites de clivage de la furine protéase dans les protéines membranaires 
et leurs
utilisations

Bien que Moderna ait en fait pu breveter le codage Moderna Specific (CGG pour AGA) du site de clivage de la furine qui n’était pas connu dans la nature même aujourd’hui (si nous acceptons que Covid-19 soit créé par l’homme).

Mais étant donné que la fuite de laboratoire (délibérée ou accidentelle) est venue de Wuhan, et compte tenu de la dissimulation chinoise et des démentis de Fauci exposés par le sénateur Rand Paul, et étant donné les dissimulations du NIH, du NIAID et des services de renseignement américains, quand leur Un rapport de 3 mois sur l’origine de Covid-19 commandé par l’imitateur présidentiel Biden n’a rien donné, et compte tenu des relations entre le NIAID, le NIH, le WIV, l’EcoHealth Alliance, l’Université de Caroline du Nord et Moderna, je ne vois aucune pièce pour quelqu’un d’autre.

De plus, toute la cabale impie des mauvais acteurs a commencé à développer le vaccin Moderna avant que la pandémie ne frappe – https://www.infowars.com/posts/must-watch-nih-claimed-joint-ownership-of-moderna-mrna-vaccine- a commencé-le-développement-des-semaines-avant-la-pandémie/ 

Mais les choses ne sont pas aussi simples que cela parce que la nature a certainement eu 100 000 ans pour fabriquer des virus humains et elle n’a jamais mis une seule fois un site de clivage de furine spécifique à Moderna (CGG pour AGA) dans quoi que ce soit, ni mis la séquence de 19 nucléotides dans quoi que ce soit auparavant.

Pourtant, dans les 6 ans suivant le brevetage de Moderna, nous le trouvons dans Covid-19 dans des circonstances où Moderna travaille avec ce virus. Donc juste là, la probabilité n’est pas de 100 000 contre 6 ou 16 666 contre 1 que Moderna soit responsable plutôt que la nature. Non c’est à 100% car la nature ne l’a pas fait. Il ne l’a jamais fait et rien ne prouve qu’il le fera un jour.

C’est l’homme qui mélange les codons humains et viraux de l’arginine, pas la nature. 

Le prof. Luc Montagnier a passé les dernières années de sa vie à prouver que le COVID-19 était créé par l’homme et qu’il contenait une grande partie du code génétique du VIH1

Le professeur Luc Montagnier, avant de mourir le 8 février 2022, a totalement détruit le concept selon lequel Covid-19 a évolué naturellement en montrant qu’il avait une équivalence massive avec VIH. Le diagramme ci-dessous montre une région de 275 nucléotides de Covid-19 qui contient 200 nucléotides du VIH/SIV (Simian ImmunoVirus). Et rappelez-vous qu’il y a 61 codons spécifiant 20 acides aminés. On peut donc dire la même chose en moyenne de 3 manières différentes avec des codons.

Vous pouvez télécharger un pdf de son étude ici et les documents supplémentaires ici . C’est très technique. Mais il a remporté le prix Nobel pour avoir découvert le virus VIH. Donc, si quelqu’un savait si Covid avait été boosté par le VIH, ce serait lui. Il a souligné que Covid-19 avait été créé par l’homme au début de la pandémie et qu’il avait lui-même été stipendié par la presse et les « vérificateurs des faits » pour avoir dit la vérité scientifique. Tous les « vérificateurs de faits » qui l’ont attaqué avaient tort.

Aucune de leurs vérifications des faits n’avait de fondement scientifique. Ces gens ne sont pas du tout des vérificateurs de faits bien sûr. Ce sont des agences de désinformation mondialistes, des fils de Goebbels, des fact chuckers et des négateurs de la science. Ils sont à peu près aussi dignes de confiance qu’une élection américaine. Je peux vérifier un fait par moi-même merci beaucoup. Je n’ai pas besoin qu’un taliban soumis au lavage de cerveau me dise son opinion sur un sujet qu’il n’a jamais étudié à l’université.

Puisque nous avons prouvé au-delà de tout doute raisonnable (au-delà d’un doute sur 1 sur 72 millions de manière statistique et avec 100% de certitude biochimique à partir du site de clivage de la furine spécifique de Moderna) que Moderna a fabriqué Covid-19. Et puisque Moderna et Fauci n’ont pas admis l’avoir fait et ont en fait dissimulé des preuves à cet effet, il se peut qu’ils cachent également autre chose.

Maintenant, les deux seules théories qui restent sont la théorie des fuites accidentelles de laboratoire et la théorie des fuites délibérées de laboratoire. Nous savons que la grande majorité des fuites politiques ne sont pas des accidents. Ce sont des stratégies délibérées pour procurer un avantage au bailleur ou au payeur. Il est bien connu dans l’industrie informatique que les virus apparaissent lorsque des ventes d’antivirus sont nécessaires. Pourquoi les choses seraient-elles différentes avec les virus humains, maintenant qu’ils peuvent aussi être créés par l’homme ? Surtout si l’on considère le rôle massif de Bill Gates et de sa fondation et de GAVI et GVAP dans le secteur mondial de la vaccination.

La seule raison pour laquelle Moderna créerait Covid-19 est de le lancer sur le marché. Sinon, tout l’exercice serait financièrement futile, commercialement inutile.

La raison invoquée par Fauci pour faire de la recherche sur le gain de fonction est que l’homme doit être en avance sur la nature ou les mauvais acteurs afin d’avoir un vaccin en temps utile si une maladie mute ou est génétiquement modifiée par « les Chinois ou les Russes » pour être mortelle !!

Mais pour croire cela, il faut croire que Moderna s’intéresse à sauver la vie des gens. Je m’excuse. Toutes leurs actions me montrent qu’ils sont intéressés à vacciner les gens sachant à quel point cela risque de leur coûter la vie.

Ils sont intéressés par le profit, le profit qui découle d’une pandémie. Ils ne sont pas des sauveurs de l’humanité comme ils le représentent. Ce sont nos exploiteurs et nos agresseurs.

Ils ont produit le virus pour le faire fuiter, pour se faire passer pour nos sauveurs de leur propre fuite. Ce ne sont pas les activités d’une figure de sauveur. Luc Montagnier essayait d’être notre sauveur d’eux et il a été assassiné (professionnellement) par leurs groupies. [La fiotte Macron a snobé le décès du Savant]
Moderna effectuait des recherches sur le gain de fonction afin de libérer le virus et de forcer un vaccin contre celui-ci d’une manière qui maximiserait ses profits. Ce n’est pas une théorie du complot. C’est ce qui s’est passé précisément. Le cours de leur action a été multiplié par 20. 

Ils l’ont sorti pour vendre leurs vaccins et détruire le système immunitaire de leurs clients car notre système immunitaire réduit leurs profits. C’est le business de Big Pharma. 

La raison pour laquelle l’écrivain est si confiant que Moderna ou leurs agents ont fabriqué et divulgué Covid-19 et la raison pour laquelle je l’ai appelé ainsi au début de la pandémie pour presque autant de ridicule que le professeur Montagnier a reçu (que Dieu le bénisse) est que le les Écritures disent dans Matthieu27, Marc15 et Jean19 : 

29 Et ils (les soldats du gouverneur du verset 27) placèrent une couronne d’épines et la mirent sur sa tête, et un roseau dans sa main droite ; et ils s’agenouillèrent devant lui, et se moquèrent de lui, disant : Salut, roi des Juifs !
30 Et ils crachèrent contre lui, prirent le roseau et le frappèrent sur la tête. (Matthieu 27 ASV)

Puis-je donc demander votre indulgence pendant que j’interprète ces mots : 

Le département américain de la défense a financé l’épissage génétique du coronavirus des protéines de pointe (Covid-19) par l’intermédiaire du NIH, du NIAID et de la DARPA, qui a d’abord infecté Jésus, par l’intermédiaire de son fiancé, les saints de la Nouvelle Alliance, juste après qu’il soit devenu le roi séculier, César à ces saints, les Juifs antitypiques, ceux qui se sont engagés à être des fils angéliques de Jacob, les nés de nouveau angéliquement.

Nous avons calculé que la malédiction qui a empêché Jésus de devenir César des saints s’est terminée en 2019Tishri15 (17/18 octobre). Glenn Beck a réalisé un documentaire montrant que 10 hôpitaux de Wuhan ont pris en charge des cas présentant des symptômes de Covid19 en octobre 2019. Oui les gens. Le Covid-19 est une preuve que Jésus est désormais le Roi séculier sur les saints, les Juifs antitypiques, les Juifs par l’alliance angélique du salut, au moins.

Mais ensuite, les soldats ont craché sur lui. Car c’est ainsi que Covid19 est transféré, à travers de petites gouttelettes d’aérosol expirées par la bouche. Les soldats lui ont délibérément craché dessus. Ce n’était pas une FUITE DE SALIVE ! Ils ont frappé Jésus sur la tête parce que les saints sont à la tête de l’église et ils ont attrapé Covid19 non pas par une infection fortuite au hasard mais par un coup délibéré avec une lecture, une arme biologique, une attaque armée délibérée. Pour en savoir plus, voir ici .

Alors ce que le Pr Montagnier a vu avec son expertise en virologie, je l’ai vu avec mon expertise théologique. Montrer que si les vérificateurs de faits et la science s’excluent mutuellement, la science et la théologie sont en fait d’accord, lorsqu’elles sont bien comprises (et c’est une grande mise en garde). Le Pr M nous a appris que les vaccins provoquent les variants. En effet, la virologie de base interdit la vaccination de masse pendant une pandémie pour cette raison même. Il a dit que la courbe des décès suit la courbe des vaccinations. Remarquez, paradoxalement, si les vaccins ont causé Omicron, alors ils nous ont sauvés d’eux-mêmes !

Le temps est venu de demander des comptes aux personnes et aux organisations

Les fabricants de Covid19, les fabricants de vaccins génétiques. leurs bailleurs de fonds et leurs promoteurs, qui comprennent presque tous les gouvernements, secteurs publics et services de santé dans le monde, sont donc coupables de génocide et de crimes contre l’humanité. Ils ont poussé le viol génétique, la maladie et la mort sur la moitié de la population mondiale afin d’enrichir les poches des sociétés pharmaceutiques. Les gouvernements et les secteurs publics du monde entier ont abandonné leur réglementation des services de santé aux milliardaires et aux entreprises sans cœur

Au Royaume-Uni, tout l’impôt sur le revenu que nous payons va au service de santé et tous ses protocoles sont déterminés par ses régulateurs et tous ses régulateurs sont contrôlés et financés par Big Pharma qui cherchent à nuire puis à gérer notre santé à leur profit.

Ainsi, chaque cent que nous dépensons en impôt sur le revenu nous rapproche un peu plus de la maladie, de la mort et de la toxicomanie.

Le professeur Luc Montagnier,en 2008.

Alors pourquoi le professeur Montagnier a-t-il choisi de passer les dernières années de sa vie à prouver que le Covid-19 était une création humaine et que les protéines de pointe, et donc les vaccins, étaient une menace existentielle pour l’espèce ? Que lui restait-il à prouver à lui-même ou à qui que ce soit d’autre à 87-89 ? Il ne l’a certainement pas fait pour accroître sa réputation dans la profession.

Non, il était animé par la même passion qui l’a poussé à découvrir le VIH. Une passion pour SAUVER l’humanité des virus et de ceux qui voudraient les concevoir pour nous nuire. Et pourquoi a-t-il rendu l’âme en février 2022 ? Parce qu’il savait qu’Omicron avait battu les vaccins. Son travail a été fait par un plus grand virologue que lui. Il a donc pu reposer en paix et aller voir des gens qui ont compris l’ampleur de sa contribution.

Covid-19 n’a pas été fabriqué en 2019. Il a été fabriqué à partir du site de clivage de la furine chimérique spécifique de Moderna (CGG pour AGA) à 19 nucléotides qui n’existe nulle part dans la nature.
Et chaque décès de Covid et chaque décès par vaccin Covid est carrément garé à la porte de ModeRNA en attente de justice.

Mais nous n’exécuterons pas cette justice assez vite. Et donc le fléau final sur l’humanité d’Apocalypse 6: 8, livré par le 4e cavalier de l’apocalypse, que Bill Gates lui-même a prophétisé, arrivera plus tard cette année (après la guerre et après la famine, les 2e et 3e cavaliers).

Source: BREAKING: Official Biochemical and Statistical Evidence 100% confirms Moderna created Covid-19

 


N’hésitez pas à visiter notre boutique en ligne:vous trouverez plein de cadeaux pour vos proches

Sur ce lien:Vintage par Michel

 

Rien ne va plus chez Facebook, « Meta » perd près de 200 milliards de dollars en Bourse

Les actions de Meta, la société mère de Facebook, ont chuté de plus de 25% jeudi,le 3 février 2022, anéantissant plus de 230 milliards de dollars de valeur marchande. Il y a quelques jours, la firme de Mark Zuckerberg jetait aussi l’éponge sur son projet de monnaie numérique, après des années de recherche et développement.

Meta perd près de 200 milliards de dollars en Bourse

A Wall Street, la réaction est forte, très forte. Dans les premières cotations, l’action de l’ex-Facebook plonge de plus de 25%. C’est plus de 230 milliards de dollars de capitalisation boursière qui s’envolent et la plus lourde sanction jamais accusée par le groupe de Mark Zuckerberg ou, plus largement par une société cotée à New York, souligne Bloomberg,

Le 03 février, à 15h15 GMT (16h15 en Suisse), le titre de Meta Platforms, maison mère de Facebook, dégringolait de 24% à 245 dollars, entraînant l’indice Nasdaq (-2,14%) dans sa chute.

La fortune du patron de Facebook, Mark Zuckerberg, estimée à 113 milliards de dollars à la clôture hier selon des documents de la SEC, subissait aussi une coupe sévère. Le co-fondateur du réseau social perdait virtuellement presque 28 milliards de dollars.

Les actions de Meta ont plongé à la suite d’un rapport sur les résultats trimestriels lamentable dans lequel la société a publié des prévisions de revenus plus faibles que prévu et a mis en garde contre plusieurs défis pour son activité cette année.

Les investisseurs ont abandonné les actions du géant de la technologie après avoir été alarmés à la fois par la baisse de la croissance des utilisateurs et la hausse des dépenses liées au projet de « métaverse » de la société. Facebook a dépensé plus de 10 milliards de dollars dans ce sens l’année dernière et s’attend à une “augmentation significative” des dépenses similaires pour 2022.

Le nombre d’utilisateurs, surtout, a déçu. Le revenu moyen par utilisateur (Arpu) est, certes, un peu plus élevé qu’attendu, à 11,57 dollars, contre 11,38 dollars visés par les analystes, mais ils sont moins nombreux : 1,93 milliard d’utilisateurs actifs quotidiens en décembre, contre 1,95 milliard anticipé, et 2,91 milliards d’actifs mensuels (2,95 milliards). C’est la première fois, dans l’histoire de l’entreprise, que le nombre d’utilisateurs actifs quotidiens s’inscrit en baisse par rapport au précédent.

 

Meta cède aussi sur la cryptomonnaie et abandonne le Diem

Février est décidément un mois compliqué pour Facebook, rebaptisé Meta. Après le projet avorté en 2019 du Libra, cette cryptomonnaie qui réunissait d’autres acteurs d’Internet et des paiements (PayPal, Visa, Mastercard) autour du réseau social, c’est au tour de son successeur, le Diem, d’être enterré.

Le diem n’aura pas réussi à faire oublier le « libra », nom du projet initial, qui avait, déjà, créé un véritable séisme dans la sphère bancaire mondiale il y a un peu plus de deux ans. Cette monnaie virtuelle décentralisée devait être lancée mi-2020, mais elle avait immédiatement déclenché une fronde internationale à son égard.

Le projet de monnaie numérique de Meta (Facebook), ne verra, donc, pas le jour. Elle a annoncé son démantèlement, ainsi que la vente des droits de propriété intellectuelle et d’autres actifs à la banque Silvergate Capital pour 182 millions de dollars.

Selon Bloomberg, le coup d’épée fatal a été porté par la Réserve fédérale des États-Unis qui aurait exercé sa pression sur le partenaire banquier du diem, Silvergate.

Le recul de Meta s’expliquerait par la dissuasion des autorités centrales qui n’entendent pas perdre aussi facilement le contrôle de la monnaie. Le pari était aussi prometteur puisqu’il surfait – comme les autres GAFA – sur l’explosion des cryptomonnaies, au nombre de 12.000 selon CoinGecko, et qui se sont bâties une véritable notoriété en pleine pandémie de Covid et face aux incertitudes liées à l’inflation sur les Bourses traditionnelles.

Amazon, Google, Apple, PayPal, mais aussi Tesla du côté des Américains… les géants de la Tech se penchent sur ces nouveaux moyens d’échanges, en dehors des circuits bancaires traditionnels, sur tous les continents. Mais dans les pays où un pouvoir central contrôle l’économie, comme en Chine ou en Inde, l’activité des cryptomonnaies est pratiquement bannie.

Le projet était d’autant plus stratégique qu’il promettait potentiellement d’échanger des biens et d’acheter des services dans le futur « métaverse » de la firme de Mark Zuckerberg

Avec ce projet de « monde virtuel » Zuckerberg révèle ainsi son objectif final, qui n’est pas seulement de dominer l’internet d’aujourd’hui, mais de contrôler et de définir l’internet que nous laisserons à nos enfants et aux enfants de nos enfants. Un internet de surveillance toujours plus invasif où la parole dissidente est bannie.

Source

Fb spie
Un document interne à Facebook révèle que le géant des médias sociaux surveille le comportement hors ligne de ses utilisateurs afin de déterminer si une personne doit être classée dans la catégorie «agent de la haine», comme l’a signalé le Washington Pundit .

 

 

 

 

 

 

 

 

 


N’OUBLIEZ PAS DE VISITEZ LA BOUTIQUE EN LIGNE DE VOTRE SITE WEB FAVORI ET DE PARTAGER SON LIEN:

Sur ce lien:Vintage par Michel

 

 

 

 

La Gigantesque Arnaque du COVID-19:Les laboratoires américains n’ont pas trouvé de Covid-19 dans 1.500 tests positifs analysés

Le CDC poursuivi pour fraude massive : des tests dans 7 universités de TOUTES les personnes examinées ont montré qu’elles n’avaient pas de Covid, mais seulement la grippe A ou B – Statistiques de l’UE : « Corona » a pratiquement disparu, même en cas de mortalité.

Un scientifique clinicien et immunologiste-virologue d’un laboratoire du sud de la Californie affirme que lui et ses collègues de 7 universités poursuivent le CDC pour fraude massive. La raison : pas un seul des 1.500 échantillons de personnes testées « positives » n’a pu trouver le Covid-19. Il a été découvert que TOUTES les personnes étaient simplement atteintes de la grippe A et, dans une moindre mesure, de la grippe B. Ceci est cohérent avec les découvertes précédentes d’autres scientifiques, dont nous avons fait état à plusieurs reprises. Dr Derek Knauss : « Lorsque mon équipe de laboratoire et moi avons soumis les 1.500 échantillons de Covid-19 supposés positifs aux postulats de Koch et les avons placés sous un SEM (microscope électronique), nous n’avons trouvé AUCUN Covid dans les 1.500 échantillons. Nous avons constaté que les 1.500 échantillons étaient principalement de la grippe A et de la grippe B, mais aucun cas de Covid. Nous n’avons pas utilisé le test PCR des taureaux***.

Dans 7 universités, pas une seule fois le COVID détecté

«Lorsque nous avons envoyé le reste des échantillons à Stanford, Cornell et quelques laboratoires de l’Université de Californie, ils sont arrivés au même résultat: PAS de COVID. Ils ont trouvé la grippe A et B. Ensuite, nous avons tous demandé au CDC des échantillons viables de Covid. Le CDC a dit qu’ils ne pouvaient pas les donner, car ils n’avaient pas ces échantillons. «Nous sommes donc arrivés à la dure conclusion de toutes nos recherches et travaux de laboratoire que Covid-19 était imaginaire et fictif. La grippe ne s’appelait que « Covid », et la plupart des 225.000 décès étaient dus à des comorbidités telles que les maladies cardiaques, le cancer, le diabète, l’emphysème pulmonaire, etc. Ils ont attrapé la grippe qui a encore affaibli leur système immunitaire, et ils sont morts. »

« Ce virus est fictif »

«Je dois encore trouver un échantillon viable avec Covid-19 avec lequel travailler. Nous qui avons effectué le test de laboratoire avec ces 1.500 échantillons dans les 7 universités poursuivons maintenant le CDC pour fraude au Covid-19. Le CDC ne nous a toujours pas envoyé d’échantillon viable, isolé et purifié de Covid-19. S’ils ne peuvent pas ou ne veulent pas, alors je dis qu’il n’y a pas de Covid-19. C’est fictif. «Les quatre articles de recherche décrivant les extraits du génome du virus Covid-19 n’ont jamais réussi à isoler et à purifier les échantillons. Les quatre articles ne décrivent que de petits morceaux d’ARN qui ne font que 37 à 40 paires de bases. Ce n’est PAS un VIRUS. Un génome viral compte normalement entre 30 000 et 40 000 paires de bases. «Maintenant que Covid-19 est censé être si mauvais partout, comment se fait-il qu’aucun laboratoire au monde n’ait complètement isolé et purifié ce virus? C’est parce qu’ils n’ont jamais vraiment trouvé le virus. Tout ce qu’ils ont découvert, ce sont de petits morceaux d’ARN qui n’ont de toute façon pas été identifiés comme étant le virus. Nous n’avons donc affaire qu’à une autre souche de grippe, comme chaque année. Le Covid-19 n’existe pas et est fictif .’ «Je crois que la Chine et les mondialistes ont mis en place ce canular Covid (la grippe déguisée en nouveau virus) pour établir une tyrannie mondiale et un État policier de contrôle totalitaire. Cette intrigue comprenait (également) une fraude électorale massive pour renverser Trump.

Le CDC lui-même admet n’avoir aucun virus identifiable

Profondément dissimulé dans un document officiel sur le Covid-19, le CDC admettait avec regret dès l’été 2020 qu’il n’avait pas de virus mesurable : ‘Comme aucun objet viral isolé quantifié (= mesuré) du 2019-nCoV n’est disponible à l’heure actuelle… ‘ (page 39 du ‘CDC 2019-Novel Coronavirus (2019-nCoV) Real-Time RT-PCR Diagnostic Panel’ (13 juillet) En d’autres termes, le CDC, en tant que l’une des principales autorités médicales au monde, ne pouvait pas , et ne peut toujours pas , démontrer un virus. À propos du test PCR à cette fin scientifiquement totalement démystifié, mais toujours abusé sans vergogne, le CDC a écrit sous la rubrique « limites » : « La détection de l’ARN viral ne peut pas démontrer la présence d’un virus infectieux, ni que le 2019-nCoV est l’agent causal. des symptômes cliniques. » Et en plus: « Ce test ne peut pas exclure d’autres maladies causées par d’autres pathogènes bactériens ou viraux. » En d’autres termes, nous ne pouvons pas prouver que les personnes qui tombent malades et sont hospitalisées, et meurent très occasionnellement, ont été rendues malades par un nouveau coronavirus appelé SARS-CoV-2, et nous ne pouvons pas non plus prouver qu’il les a amenées à développer une nouvelle maladie appelée « Covid19 ». Il pourrait tout aussi bien s’agir d’un virus différent et d’une maladie différente. (Et puisque tous les symptômes, y compris les pneumonies sévères, correspondent parfaitement à ce que la grippe peut provoquer historiquement chez les personnes vulnérables… « si ça ressemble à un canard et marche comme un canard, c’est un canard ».

Récompense de 1.800.000 $ pour avoir démontré le coronavirus

L’année dernière, l’équipe allemande de Samuel Eckert et le Isolate Truth Fund ont promis une récompense d’au moins 265.000 $ pour tout scientifique qui peut fournir une preuve irréfutable que le virus SARS-CoV-2 a été isolé et existe donc. Ils ont également souligné qu’aucun laboratoire au monde n’a encore été en mesure d’isoler ce virus corona. Ce montant est passé à 1.800.000 $ . Oui, les scientifiques des systèmes prétendent qu’ils l’ont fait, mais cet « isolement » ne consiste qu’en un échantillon du corps humain, qui est une « soupe » pleine de différents types de cellules, de restes de virus, de bactéries, etc. À l’aide de produits chimiques (toxiques), on recherche ensuite des particules (résiduelles) qui peuvent indiquer un virus qui a existé ou peut encore exister, après quoi cela est désigné comme «preuve».

L’équipe canadienne n’a également reçu aucune preuve malgré 40 demandes de loi sur l’accès public

Fin décembre 2020, il y avait une initiative similaire à celle en Allemagne. Une équipe autour de la journaliste d’investigation canadienne Christine Massey a soumis pas moins de 40 demandes de loi sur l’accès public aux autorités médicales du monde entier avec la simple demande de preuve que le virus SARS-CoV-2 a été isolé et que son existence peut donc être objectivement prouvée. Aucune des agences et autorités auxquelles nous avons écrit n’a été en mesure de fournir cette preuve.

« Impossible de démontrer que le SRAS-CoV-2 provoque une maladie appelée Covid-19 »

Le Dr Tom Cowan, le Dr Andrew Kaufman et Sally Fallon Morell ont récemment publié une déclaration sur « la controverse persistante sur la question de savoir si le virus SARS-CoV-2 est isolé ou purifié. Mais sur la base de la définition officielle d’ »isolement » d’Oxford (« le fait ou la condition d’être isolé ou isolé, une séparation d’avec d’autres choses ou personnes, debout seul »), le bon sens, les lois de la logique et les règles de la science dictent que toute personne impartiale doit arriver à la conclusion que le virus SARS-CoV-2 n’a jamais été isolé ou purifié. En conséquence, aucune confirmation de l’existence du virus ne peut être donnée. «Les implications logiques et scientifiques de ce fait sont que la structure et la composition de quelque chose dont l’existence ne peut être prouvée ne peuvent pas être connues, y compris la présence, la structure et la fonction d’un pic hypothétique ou d’autres protéines. La séquence génétique de quelque chose qui n’a jamais été trouvé ne peut pas être connue, ni les « variantes » (mutations) de quelque chose dont l’existence n’a pas été démontrée. Il est donc impossible de démontrer que le SRAS-CoV-2 provoque une maladie appelée Covid-19.’

Un test PCR combiné pour corona et grippe « parce qu’il n’y a pratiquement aucune différence »

Sans surprise, la plus grande société de biotechnologie au monde, la chinoise BGI, a récemment lancé un nouveau test PCR qui peut tester simultanément la grippe A, B et corona. Outre le fait avéré, reconnu par divers procès, qu’un test PCR ne peut pas prouver l’infection par quelque virus que ce soit, l’explication de BGI selon laquelle les deux maladies sont si difficiles à distinguer l’une de l’autre et qu’ils n’ont donc fait qu’un seul test, en dit plus que suffisant . Peut-être qu’il n’y a aucune différence, « Covid » n’est qu’un autre nom pour les virus de la grippe « vieux familiers », et c’est juste une autre astuce marketing intelligente ?

La plupart des gens ont été trompés par la propagande de la peur

Avec la propagande mondiale de la peur contrôlée par le gouvernement 24 heures sur 24, 7 jours sur 7, par les médias de masse, la plupart des gens en sont venus à croire qu’il existe en effet un virus potentiellement mortel qui rend les gens malades beaucoup plus rapidement et plus gravement que la grippe saisonnière. Cependant, même ce dernier n’est manifestement pas le cas. La grippe A est depuis des années la principale cause de décès par pneumonie dans le monde développé. Mais envoyez des personnes désignées comme des patients atteints de Covid sévères dans quelques unités de soins intensifs, mettez constamment des caméras dessus, dites à quelques médecins qu’ils ne doivent discuter que des pires cas, et vous avez votre « pandémie télévisée ». L’argument « nous le faisons parce que sinon les soins seront surchargés » a été sapé par les gouvernements eux-mêmes il y a quelque temps, en rejetant les offres de lits ou de personnel de soins intensifs supplémentaires, car « ce n’est pas nécessaire ». (Était-ce peut-être la première et la seule fois où la vérité était dite ?)

Chiffres officiels : rien d’inquiétant (mais ça ne revient jamais à la normale)

Maintenant que les chiffres officiels montrent également qu’après la saison normale de la grippe traditionnelle, tout va bien, et selon les statistiques de l’UE (EuroMOMO), il y a même une baisse significative de la mortalité, la société – s’il s’agissait vraiment d’un virus et de la santé publique – devrait revenir immédiatement à la normale pour commencer à réparer les énormes dégâts causés par les politiques gouvernementales. Cependant, comme vous le savez, cela ne se fera jamais, et c’est parce que ce canular pandémique soigneusement planifié poursuit un programme idéologique, le « Grand Reset », qui vise à démolir en grande partie la société et l’économie de l’Occident, puis à soumettre à une dictature technocratique communiste mondiale des vaccins climatiques, dans laquelle toutes nos libertés, droits civils et droits à l’autodétermination seront supprimés une fois pour toutes. C’était du moins leur plan.


EN COMPLÉMENTAIRE

 

Mais où est ce satané virus ? Personne ne l’a vu ou isolé !

L’appel à l’autorité est une erreur logique. Pourtant, au cours de cette longue simulation Covid-19 de l’autoritarisme mondial, on nous dit encore et encore de faire confiance au CDC, qui s’est trompé tout au long du chemin. La clé d’une république saine est de remettre continuellement en question l’autorité. Et la question la plus importante à poser à cette autorité autocratique est la suivante : le virus Sars-CoV-2 a-t-il déjà été vraiment isolé ? Et si oui, montrez-nous la preuve.

Les Centers for Disease Control (CDC) des États-Unis à Atlanta ont confirmé par écrit qu’ils n’avaient aucun échantillon réel, isolé et purifié du virus SARS-CoV-2 et ne pouvaient fournir aucun enregistrement sur ce virus, qui aurait causé COVID-19.
Au cours des derniers mois, des demandes de Freedom of Information Act (FOIA) ont été adressées aux Centers for Disease Control (CDC) pour demander des preuves que le CDC a isolé ou purifié le virus SARS-CoV-2.
Le 7 juin 2021, le CDC a confirmé (à nouveau) par écrit qu’il n’avait aucun dossier montrant qu’il avait déjà isolé ou purifié le virus qui serait à l’origine de la maladie appelée COVID-19.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Ces demandes écrites ont été faites par Mme Christine Massey au directeur général du CDC/ATSDR FOIA, M. Robert Andoh, pour localiser et fournir TOUS les enregistrements, recherches et/ou résultats pour TOUT isolement et purification « virale » (par quiconque, n’importe où, n’importe quand dans le Monde) à partir d’un échantillon de patient, par macération, filtration et/ou l’utilisation d’une ultracentrifugeuse . . . ce qu’on appelle le « Gold Standard » pour isoler et identifier un micro-organisme pathologique ou nana organisme.
Le « Gold Standard » pour l’isolement et l’identification des microbes sont appelés postulats de Koch et Rivers, qui ont été établis il y a de nombreuses années pour isoler les postulats de bactéries (Koch) ou de virus (Rivers).
Voici une comparaison côte à côte des postulats de Koch et des postulats de Rivers :

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Statement On Virus Isolation (SOVI)

Isolation: The action of isolating; the fact or condition of being isolated or standing alone; separation from other things or persons; solitariness.

– Oxford English Dictionary

La controverse sur la question de savoir si le virus du SRAS-CoV-2 a déjà été isolé ou purifié se poursuit. Cependant, en utilisant la définition ci-dessus, le bon sens, les lois de la logique et les préceptes de la science, toute personne impartiale doit arriver à la conclusion que le virus SARS-CoV-2 n’a jamais été isolé ou purifié. En conséquence, aucune confirmation de l’existence du virus ne peut être trouvée. Les conséquences logiques, de bon sens et scientifiques de ce fait sont :

  • la structure et la composition de quelque chose dont l’existence n’a pas été démontrée ne peuvent pas être connues, y compris la présence, la structure et la fonction de tout spike hypothétique ou d’autres protéines ;
  • la séquence génétique de quelque chose qui n’a jamais été trouvée ne peut pas être connue ;
  • les « variantes » de quelque chose dont l’existence n’a pas été démontrée ne peuvent pas être connues ;
  • il est impossible de démontrer que le SARS-CoV-2 provoque une maladie appelée Covid-19.

En termes aussi concis que possible, voici la bonne façon d’isoler, de caractériser et de démontrer un nouveau virus. Tout d’abord, on prélève des échantillons (sang, crachats, sécrétions) de nombreuses personnes (par exemple 500) présentant des symptômes suffisamment uniques et spécifiques pour caractériser une maladie. Sans mélanger ces échantillons avec AUCUN tissu ou produit contenant également du matériel génétique, le virologue macère, filtre et ultra-centrifuge, c’est-à-dire purifie l’échantillon. Cette technique de virologie courante, utilisée depuis des décennies pour isoler les bactériophages1 et les virus dits géants dans chaque laboratoire de virologie, permet ensuite au virologue de démontrer en microscopie électronique des milliers de particules de taille et de forme identiques. Ces particules sont le virus isolé et purifié.

L’uniformité de ces particules identiques est ensuite vérifiée par des techniques physiques et/ou microscopiques. Une fois la pureté déterminée, les particules peuvent être davantage caractérisées. Cela comprendrait l’examen de la structure, de la morphologie et de la composition chimique des particules. Ensuite, leur constitution génétique se caractérise par l’extraction du matériel génétique directement des particules purifiées et l’utilisation de techniques de séquençage génétique, telles que le séquençage de Sanger, qui existent également depuis des décennies. Ensuite, on fait une analyse pour confirmer que ces particules uniformes sont d’origine exogène (extérieure) conformément au concept de virus, et non les produits de dégradation normaux des tissus morts et mourants.2 (En mai 2020, nous savons que les virologues ont aucun moyen de déterminer si les particules qu’ils voient sont des virus ou simplement des produits de décomposition normaux de tissus morts et mourants.)3

Si nous sommes arrivés jusqu’ici, nous avons complètement isolé, caractérisé et séquencé génétiquement une particule virale exogène. Cependant, nous devons encore montrer qu’il est causalement lié à une maladie. Ceci est réalisé en exposant un groupe de sujets sains (des animaux sont généralement utilisés) à ce virus isolé et purifié de la manière dont la maladie est supposée se transmettre. Si les animaux tombent malades avec la même maladie, comme le confirment les résultats cliniques et d’autopsie, on a maintenant montré que le virus provoque en fait une maladie. Cela démontre l’infectiosité et la transmission d’un agent infectieux.

Aucune de ces étapes n’a même été tentée avec le virus SARS-CoV-2, et toutes ces étapes n’ont pas été non plus réalisées avec succès pour un virus dit pathogène. Notre recherche indique qu’aucune étude montrant ces étapes n’existe dans la littérature médicale.

Au lieu de cela, depuis 1954, les virologues ont prélevé des échantillons non purifiés sur un nombre relativement restreint de personnes, souvent moins de dix, atteintes d’une maladie similaire. Ils traitent ensuite cet échantillon de manière minimale et inoculent cet échantillon non purifié sur une culture tissulaire contenant généralement quatre à six autres types de matériel – qui contiennent tous un matériel génétique identique à ce qu’on appelle un « virus ». La culture tissulaire est affamée et empoisonnée et se désintègre naturellement en de nombreux types de particules, dont certaines contiennent du matériel génétique. Contre tout bon sens, logique, utilisation de la langue anglaise et intégrité scientifique, ce processus est appelé « isolement du virus ». Ce breuvage contenant des fragments de matériel génétique provenant de nombreuses sources est ensuite soumis à une analyse génétique, qui crée ensuite dans un processus de simulation informatique la séquence présumée du virus présumé, un soi-disant génome in silico. A aucun moment un virus réel n’est confirmé par microscopie électronique. A aucun moment un génome n’est extrait et séquencé d’un virus réel. C’est de la fraude scientifique.

L’observation que l’échantillon non purifié – inoculé sur une culture tissulaire avec des antibiotiques toxiques, du tissu fœtal bovin, du liquide amniotique et d’autres tissus – détruit le tissu rénal sur lequel il est inoculé est donnée comme preuve de l’existence et de la pathogénicité du virus. C’est de la fraude scientifique.

À partir de maintenant, lorsque quelqu’un vous remet un article suggérant que le virus SARS-CoV-2 a été isolé, veuillez consulter les sections méthodes. Si les chercheurs ont utilisé des cellules Vero ou toute autre méthode de culture, vous savez que leur processus n’était pas l’isolement. Vous entendrez les excuses suivantes pour lesquelles l’isolement réel n’est pas fait :

  1. Il n’y avait pas assez de particules virales trouvées dans les échantillons de patients pour être analysées.
  2. Les virus sont des parasites intracellulaires ; ils ne peuvent pas être trouvés en dehors de la cellule de cette manière.

Si le numéro 1 est vrai et que nous ne pouvons pas trouver le virus dans les crachats des personnes malades, alors sur quelles preuves pensons-nous que le virus est dangereux ou même mortel ? Si le numéro 2 est correct, alors comment le virus se transmet-il d’une personne à l’autre ? On nous dit qu’il sort de la cellule pour infecter les autres. Alors pourquoi n’est-il pas possible de le trouver?

Enfin, remettre en question ces techniques et conclusions de virologie n’est pas un problème de distraction ou de division. Faire la lumière sur cette vérité est essentiel pour arrêter cette terrible fraude à laquelle l’humanité est confrontée. Car, comme nous le savons maintenant, si le virus n’a jamais été isolé, séquencé ou montré comme provoquant une maladie, si le virus est imaginaire, alors pourquoi portons-nous des masques, prenons-nous des distances sociales et mettons-nous le monde entier en prison ?

Enfin, si les virus pathogènes n’existent pas, alors qu’est-ce qui se passe dans ces dispositifs injectables appelés à tort « vaccins », et à quoi servent-ils ? Cette question scientifique est la plus urgente et la plus pertinente de notre époque.

1 Isolement, caractérisation et analyse des bactériophages du lac halo-alcalin Elmenteita, KenyaJuliah Khayeli Akhwale et al, PLOS One, publié le 25 avril 2019. https://journals.plos.org/plosone/article?id=10.1371/journal. pone.0215734 — consulté le 15/02/21

2 « Vésicules extracellulaires dérivées de cellules apoptotiques : un lien essentiel entre la mort et la régénération », Maojiao Li1 et al, Frontiers in Cell and Developmental Biology, 2 octobre 2020. https://www.frontiersin.org/articles/10.3389/fcell. 2020.573511/complet — consulté le 15/02/21

3 « Le rôle des vésicules extracellulaires en tant qu’alliés des virus du VIH, du VHC et du SRAS », Flavia Giannessi, et al, Virus, 2020 mai

Source : Has the Sars-CoV-2 Virus Ever Really Been Isolated?


VENEZ VISITER NOTRE BOUTIQUE ENB LIGNE QUI ASSUME NOTRE EXISTENCE FINANCIÈRE ACTUELLE:

Sur ce lien:VintageparMichel

 

 

 

 

La Gigantesque Arnaque du COVID-19:Les animaux malades de la peste / politique du bouc émissaire au Québec [et ailleurs]

Un mal qui répand la terreur,
Mal que le Ciel en sa fureur
Inventa pour punir les crimes de la terre,
La Peste (puisqu’il faut l’appeler par son nom),
Capable d’enrichir en un jour l’Achéron, [1]
Faisait aux animaux la guerre.
Ils ne mouraient pas tous, mais tous étaient frappés

– Jean de La Fontaine

 

Le covid 19 c’est, bel et bien, ce mal inventé par les marchés financiers afin de punir un prolétariat par trop populeux et qui ne sert plus à rien dans un contexte où l’économie réelle est moribonde en Occident. Tous frappés par ce fléau difficile à circonscrire, pas vraiment mortel en définitive, les anciens consommateurs sont pris d’un accès de panique et ne savent plus à quel saint se vouer. Joggant sur la voie publique tels des volatiles sans têtes, nos concitoyens réclament une voie de sortie qui, l’espèrent-ils, leur permettra de renouer avec leurs bonnes vieilles habitudes.

Mais, la peste de DAVOS est coriace et ses innombrables variants – véritables surgeons d’un mal qui sévit malgré les médecines de cheval qui nous sont administrées – font leur apparition le temps d’une saison, comme autant de modes éphémères qui dictent les tenues de circonstance. La muselière est de mise en toutes circonstances, que ce soit à l’intérieur ou à l’extérieur, par beau temps ou tempête de verglas, complément obligé d’une tenue élégante ou négligée. Et, le téléphone intelligent, accessoire indispensable, représente la laisse qui permet aux appariteurs sadiques de cette habile mise en scène de faire danser les consommateurs sur les musiques de l’heure.

 

Les maîtres chanteurs

Les marchés financiers qui façonnent de nouveaux produits spéculatifs représentent les maîtres chanteurs d’un système économique qui ne peut plus fonctionner qu’à partir de la coercition et de la terreur instillées par nos gouvernements qui n’en sont que les relais obligés. Les immenses fonds de pension à la BLACKROCK [2] – après avoir détourné le fruit du labeur de la génération du boom de l’après-guerre – ont décidé d’investir du côté de BIG PHARMA, dans un contexte où cette fausse pandémie représente une chance inespérée de faire d’une pierre, plusieurs coups … en effet, les gouvernements, tout en étant saignés à blanc par l’ARN MESSAGER, se disent qu’il faut bien que cette panacée serve à quelque chose. Alors, on vaticine et vaccine à tout va. Après que la Fondation Rockefeller a étudié divers scénarios de pandémies, après que le Seigneur de DAVOS a annoncé la venue d’une grande réinitialisation censée nous délivrer de nous-même, et que l’Organisation Mondiale de la Santé s’est perdue en conjectures à propos d’une flopée de variants préalablement baptisés par des gnostiques déjantés, le champ de bataille était libre pour une mise en quarantaine définitive de nos sociétés décadentes.

Sésame, ouvre-toi !

Le PASS SANITAIRE ou VACCINAL, véritable prélude à un contrôle biométrique complet du bétail humain, permet de faire en sorte que les brebis galeuses ne puissent pas être tentées de contaminer l’eau de la mangeoire commune. À l’instar de cette fable des Animaux malades de la peste, les consommateurs sevrés par cette crise sanitaire orchestrée sentent qu’il faudra bien sacrifier quelques-uns parmi les marginaux qui refusent de se conformer aux diktats de l’heure. C’est ici que la théorie du bouc émissaire, complément indispensable des stratégies de triangulation de l’ingénierie sociale, fait son entrée en scène de manière magistrale. Puisque dans une triangulation réussie il faut bien qu’une victime expiatoire tienne lieu de médiation entre les captifs et leurs bourreaux. Pétries d’un christianisme couvant sous les braises, bien que décharné, nos sociétés ont cherché à se délester de leurs responsabilités en sacrifiant des boucs émissaires.

Crier haro sur le baudet

Ainsi, incapables de justifier l’inoculation d’un poison qui ne protège pas vraiment des séquelles de cette flopées de variants créés en laboratoire, ne trouvant pas les mots afin d’expliquer pourquoi il faut imposer un nouveau couvre-feu à partir du temps des fêtes et en quoi la destruction de nos liens filiaux nous protègerait-elle contre ce prétendu fléau, nos bourreaux s’en remettent aux non-injectés et à tous ceux qui refusent de se plier aux injonctions de cette tyrannie techno-médicale.

Le Lion tint conseil, et dit : « Mes chers amis,
Je crois que le Ciel a permis
Pour nos péchés cette infortune ;
Que le plus coupable de nous
Se sacrifie aux traits du céleste courroux ;
Peut-être il obtiendra la guérison commune. »

 – Jean de La Fontaine

Ne plus couper les cheveux en quatre

Et, dans un contexte où les « non-vaccinés » pourraient bien représenter un groupe témoin gênant, il devient urgent de les isoler afin de les contraindre à se plier aux exigences du sacrifice collectif qui nous est proposé. Quitte à faire crever les plus irréductibles dans les meilleurs délais, puisqu’il y a péril en la demeure à l’heure où nos sadiques tortionnaires ambitionnent d’implémenter un système de contrôle biométrique sanitaire et sociétal de manière permanente. Il faut donc aller au plus pressant et cesser, séance tenante, de tergiverser sur une question qui a déjà été tranchée des lustres avant le signal de départ de ce véritable coup d’état néofasciste.

Les entités maléfiques qui ont pris le contrôle du Parlement du Québec (en France et ailleurs) ne coupent plus les cheveux en quatre puisque leurs commanditaires de l’industrie pharmaceutique et du Forum économique mondial de Davos réclament des mesures plus musclées et expéditives avant la venue du printemps. Le bon peuple étant manifestement excédé par tous ces excès de zèle, réalisant que l’économie est sur le point de rendre l’âme et que les effets secondaires de la potion magique épuisent une masse grandissante parmi les animaux conformes, [3] il faut faire vite avant que la coupe ne déborde.

Chez nous, au Québec, les responsables de ce carnage socioéconomique sont littéralement pris d’une rage indescriptible. Il faut faire vite et bien. Et, surtout pas dans la dentelle. Alors, les brebis galeuses, non-conformes, n’ayant plus accès à aucune forme de divertissement, ne pouvant plus entrer dans les musées et autres édifices publics, ne pouvant plus se restaurer ou festoyer avec les autres animaux, et, après s’être fait mettre à l’écart par les membres de leurs familles respectives, devront payer un pactole pour être admis à l’hôpital et la JUNTE aux manettes a même tenté, à l’instar de la province du Nouveau Brunswick, de les priver de nourriture en forçant les distributeurs alimentaires à imposer le sésame sanitaire. Heureusement, jusqu’à nouvel ordre, les petits commerçants et les grandes chaînes ont refusé d’obtempérer [4]. Et, alors que près d’un million de Québécois vivent comme des chiens, en ne sachant pas ce que DEMAIN leur réservera, une flopée de chroniqueurs stipendiés par le grand capital réclame que des sanctions à la hauteur du crime tombent. Il faut anéantir ceux et celles qui osent toujours défier les injonctions de nos maîtres véritables. Dans ces conditions, on comprend facilement l’empressement des psychopathes de service au Parlement de Québec. On ne sait jamais ce qui pourrait advenir si, d’office, une plainte pour CRIMES CONTRE L’HUMANITÉ, finissait par être traitée en bonne et due forme à la Cour internationale de Justice.

L’Âne vint à son tour, et dit : « J’ai souvenance
Qu’en un pré de moines passant,
La faim, l’occasion, l’herbe tendre, et je pense
Quelque diable aussi me poussant,
Je tondis de ce pré la largeur de ma langue.
Je n’en avais nul droit, puisqu’il faut parler net. »
À ces mots, on cria haro sur le baudet.

 – Jean de La Fontaine

Patrice-Hans Perrier
Source Le Saker Francophone


NOTES

1-Les charognards se gaventPfizer, BioNtech et Moderna réalisent un bénéfice de 1.000 dollars par seconde.

L’arnaque Covid a décidément fait beaucoup d’heureux aux côtés des centaines de milliers de morts et des millions d’éclopés, et cela ne pourra que s’accentuer, avec les booster 3, puis 4, puis ad vitam aeternam.

Selon People’s Vaccine Alliance, chaque seconde, Pfizer, BioNtech et Moderna réalisent un bénéfice de 1.000 dollars. Cette manne représente, pour l’année en cours, un bénéfice avant impôts estimé à 34 milliards de dollars, soit 65.000 par minute ou 93,5 millions de dollars par jour,. 

Comparons ce montant, gagné chaque seconde par les trois larrons pharmaceutiques,  au salaire moyen annuel en France, dans le monde, dans l’UE et en Afrique, on obtient :

  France Monde UE Afrique
Salaire annuel moyen en k$ 46,5 9,5 28,8 1,3
1,4 6,8 2,3 50,0

Cela veut dire que les trois mousquetaires de Big Pharma gagnent en une minute, 1,4 fois le salaire annuel d’un Français, 2,3 fois celui d’un Européen (UE) et 50 fois celui d’un Africain

Ces trois fabricants ont  aussi perçu plus de 8 milliards de dollars d’aides publiques américaines pour développer leurs vaccins tueurs et invalidants.

Par ailleurs, selon une étude commandée par le groupe de La Gauche au Parlement européen, la taxation des multinationales qui ont enregistré des bénéfices exceptionnels pendant la pandémie, pourrait rapporter 25 milliards d’euros à l’Union européenne, dont 5,6 milliards à la France. De quoi répondre aux besoins en hôpitaux ou en personnels de santé.

On n’est jamais mieux servi que par … les siens

Premier exemple
Ce mercredi 1er décembre, la présidente de la Commission européenne, Ursula von der Leyen, a déclaré en conférence de presse que le temps était venu de réfléchir à l’option d’une vaccination obligatoire.  Elle a donc déclaré qu’il était temps de créer des plans COVID destinés à obliger TOUS les états européens à vacciner (3 doses et plus) les 445 millions d’Européens.

Ursula von der Leyen est la femme du directeur d’un fabricant de vaccins Covid ARNm.  Son mari, Heiko von der Leyen est le directeur médical de Orgenesis, une société américaine de biotechnologie spécialisée dans les « vaccins à base de cellules » et de thérapies de géniques, qui se proclame fièrement « l’Uber de l’espace de thérapie cellulaire et génique« .

Il a occupé ce poste depuis le 20 septembre et a servi sur son comité consultatif scientifique depuis 2019.

Deuxième exemple. En Russie…aussi

Tatyana Golikova, commissaire de Covid de Russie a travaillé sans relâche pour imposer les passeports vaccinaux. Bien sûr, cela n’a rien à voir avec le fait que son beau-fils Vladimir Khristenko fabrique le vaccin Kovivak (approuvé pour une utilisation depuis le 2021).

La population de la Fédération de Russie est de 145,9 millions de personnes, il y a donc des milliards à glaner.

Le vaccin KoviVac est produit la société Nanolek. L’un des fondateurs, ainsi que le président de Nanolek, est le beau-fils Tatyana Golikova, cheffe du siège de la lutte contre le coronavirus.

La conclusion de tout cela est simple : la vaccination, rendue quasi obligatoire en Russie, rapporte des revenus colossaux à un groupe de personnes bien spécifique.

Il est difficile de croire qu’en promettant 189 milliards de roubles pour la vaccination des Russes, le gouvernement n’a pas calculé à qui iront ces fonds.

2-Seules DEUX sociétés, Vanguard et BlackRock, contrôlent la planète, alors que les 1 % les plus riches du monde possèdent 82 % de la richesse mondiale

 

Les actions des plus grandes entreprises du monde sont détenues par les mêmes investisseurs institutionnels. Ils sont tous propriétaires les uns des autres.
Cela signifie que des marques « concurrentes », comme Coke et Pepsi, ne le sont pas vraiment, puisque leurs actions sont détenues par exactement les mêmes sociétés d’investissement, fonds de placement, compagnies d’assurance, banques et, dans certains cas, gouvernements. C’est le cas dans toutes les industries.
Les petits investisseurs sont détenus par de plus gros investisseurs. Ceux-ci sont détenus par des investisseurs encore plus grands. Le sommet visible de cette pyramide ne comporte que deux sociétés dont nous avons souvent vu le nom…

Ce sont Vanguard et BlackRock.

3-Pandémie Vaccinale. Les personnes ayant reçu un vaccin Covid-19 représentent 70% des décès toutes causes confondues au cours des 6 premiers mois de 2021, 20% survenant dans les 21 jours suivant la vaccination
4-La situation est pire en Tunisie, dans laquelle un gouvernement fantoche [i.e. soumis aux oukases de ceux qui décident OMS, Big Pharma, Empire anglo-sioniste, …] , seuls le petits commerces sont accessibles aux pestiférés (i.e. sans pass nasitaire). Les grandes surfaces ont été les premières à exiger le pass de la honte.

N’OUBLIEZ PAS DE VISITER LA BOUTIQUE EN LIGNE DE VOTRE SITE WEB FAVORI

Sur ce lien:Vintage par Michel

La Criminelle Arnaque du COVID-19:93% des autopsies révèlent que des personnes vaccinées contre le Covid-19 sont mortes du vaccin

La piqûre de vax Covid-19 a été impliquée dans 93% des décès de personnes autopsiées. Le point le plus intéressant à noter est que le coroner ou le procureur général a affirmé qu’ils n’étaient pas dus aux piqûres du génocide. Au départ, quinze corps ont été examinés, âgés de 28 à 95 ans. Ils étaient décédés de 7 jours à 6 mois après la « vaccination ». Cependant, un examen plus approfondi a révélé que la piqûre ayant provoqué un caillot était la cause du décès de 14 des 15 patients. L’organe le plus attaqué était le cœur, mais d’autres organes étaient touchés comme les poumons et le foie. La signification de ces découvertes est déconcertante, car cela signifie qu’il existe un potentiel de millions de décès.

Dr Sucharit Bakdi
Dr Sucharit Bakdi

 

 

Le Dr Sucharit Bhakdi et le Dr Arne Burkhardt ont fait un travail merveilleux pour sensibiliser le public à ces dangereux piqûres de vax Covid-19. Les membres des familles ont demandé que les corps de ces victimes soient minutieusement examinés. Le Dr Bhakdi a consacré toute sa vie à la pratique, à l’enseignement et à la recherche en microbiologie et en maladies infectieuses. Le Dr Burkhardt est un pathologiste et virologue de renommée mondiale qui a publié plus de 300 articles dans les domaines de l’immunologie, de la bactériologie et de la virologie. Les deux hommes travaillent actuellement en Allemagne. Ironiquement, le Dr Bhakdi envisage de quitter le pays parce que les autorités sanitaires veulent que son enfant de 4 ans soit piqué par vax Covid.

Le Dr Bhakdi et le Dr Burkhardt ont tous deux remarqué que chez 14 des 15 patients témoins, il y avait de nombreuses preuves de l’attaque du corps contre lui-même, ce qu’ils n’avaient jamais vu auparavant. Ces patients étaient des personnes décédées à la maison, lors d’événements sportifs, dans la voiture ou au travail. Le Dr Burkhardt a pu ajouter 55 patients supplémentaires à ses examens, portant le nombre total à 70. Chez plus de 90 % des personnes décédées, le Dr Burkhardt a découvert une auto-attaque auto-immune dans les tissus de ces organes par des lymphocytes T tueurs, dans la plage d’âges de 28 à 90 ans. Dans tous les décès, ils ont trouvé les mêmes résultats pathologiques. Le seul dénominateur commun à toutes ces personnes était le vax génocidaire Covid, une thérapie génique, qui a causé des dommages aux protéines de pointe aux tissus. Quatre des victimes du vax Covid-19, n’ont reçu qu’une seule dose. À chaque piqûre de Covid, le système immunitaire s’aggrave progressivement. Le Dr Bhakdi décrit les injections comme «fuyantes», produisant des protéines de pointe qui préparent les organes à l’attaque des lymphocytes tueurs. Il a également noté que ces lymphocytes du système lymphatique sont en train de mourir. Ces cellules sont responsables de la destruction des virus et des bactéries déjà présents dans notre corps, tels que la mononucléose infectieuse, le cytomégalovirus, le virus de l’herpès, le virus d’Epstein-Barr, la tuberculose, la toxoplasmose et tout autre virus dormant. Le Dr Bhakdi a également noté qu’il y a « une explosion de tumeurs et de cancers parmi les vaccinés que personne ne peut expliquer« . Les lymphocytes sont les cellules responsables du contrôle des cancers dans notre corps.

 

 

Le Dr Hoffe avait découvert plus tôt cette année dans ses propres recherches que 60% des patients qui avaient reçu la piqûre de génocide Covid avaient des niveaux élevés de D-dimères, ce qui est un indicateur de coagulation sur les parois des petits vaisseaux sanguins. Le Dr Ryan Cole, un autre pathologiste, constate une multiplication par vingt du cancer de l’utérus, ainsi que d’autres tumeurs. Le Dr Cole a noté que les « vaccins » n’incitent pas les patients à produire suffisamment d’IgA sécrétoires. L’immunoglobuline A est la première ligne de défense contre les microbes nocifs, tout en maintenant une réponse immunologique équilibrée. Enfin, le Dr Cole reconnaît que les infiltrats de lymphocytes T dans la population piquée sont destructeurs de tissus. Il veut faire une étude pour voir comment la protéine de pointe se dépose dans les organes au site des infiltrats.

CONCLUSION

Le fameux docteur Bhakdi a été nominé pour un prix Nobel en 2021.Il est actuellement le scientifique le plus censuré de la planète!

Le travail de l’équipe Bhakdi/Burkhardt est une bombe. C’est la première fois qu’une étude explique comment les piqûres du vax du génocide tuent les lymphocytes dans le système lymphatique, ce qui équivaut à une station d’épuration du corps. Cela conduira par conséquent à l’émergence d’agents pathogènes dormants infectant l’hôte. Je connais personnellement une infirmière praticienne en Pennsylvanie qui a contracté le zona et une infection au Covid-19, après sa troisième injection de rappel. L’une des questions que je me pose et sur laquelle je pense que nous avons besoin de plus de recherches est la suivante : la mort des lymphocytes est-elle une conséquence permanente de l’injection de Covid ? Nous savons par des études antérieures que chaque injection semble détruire l’immunité. Les piquants se préparent-ils à une facilitation de l’infection par des anticorps (Antibodydependant enhancement ou ADE en anglais), ce qui conduirait à des infections percées ? [Une infection percée est un cas de maladie dans lequel un individu vacciné devient infecté par la maladie, en raison du fait que le vaccin n’a pas réussi à fournir une immunité complète contre l’agent pathogène]

Le travail de l’équipe Bhakdi/Burkhardt, ainsi que du Dr Hoffe et du Dr Cole, peut être décrit comme suit.
– Premièrement, les événements inflammatoires dans les petits vaisseaux sanguins sont caractérisés par une abondance de lymphocytes T et de cellules endothéliales mortes, qui à leur tour peuvent conduire à des caillots sanguins.
– Deuxièmement, il y a une accumulation importante de lymphocytes T dans les tissus entourant les vaisseaux sanguins.
– Troisièmement, il y a une infiltration massive des organes et des tissus avec ces cellules tueuses.
D’après les travaux de tous ces scientifiques, nous voyons que le cœur est le principal organe impliqué, mais la coagulation peut se produire n’importe où avec ces piqûres Covid, du cerveau aux vaisseaux sanguins. Ces « injections de caillots » doivent être stoppées immédiatement !

Source
Réseau d’actualités Nemos – 11 janvier 2022


N’OUBLIEZ PAS DE VISITER NOTRE BOUTIQUE EN LIGNE 

Sur ce lien:Vintage parMichel

 

 

 

 

Poésie:Des nouvelles de la cigale et la fourmi

Nous avons des nouvelles de la cigale et la fourmi
La Cigale, s’étant faite vaccinée ,
Se trouva fort dépourvue
Quand le Variant fut venu.
Les vaccins ne protégeaient
Point plus qu’un stock de PQ,
Point plus qu’un bout de tissu.

Elle va pleurer grise mine
Chez la Fourmi sa voisine,
l’accusant de l’avoir infectée
n’étant, elle, pas vaccinée !
Mais la Fourmi reste digne,
face à cette verve assassine.

Elle connait la plandémie honteuse,
Et répondit à cette emmerdeuse :
– Que faisiez-vous sur les réseaux ?
N’étiez-vous pas hier du côté des collabos?
Aviez-vous cherché d’autres pistes ?
Non bien sûr ! vous n’êtes pas complotiste !

– Nuit et jour à tout venant,
J’ai écouté le gouvernement,
Suivi la bien-pensance sans faille,
Les vaccinés n’sont pas cobayes !
BigPharma le jure, foi d’animal,
Nos vies sont leur intérêt principal !

– J’en suis fort aise…
Eh bien, toussez maintenant et PASSez votre chemin !

Jean de La Quarantaine

 


AUTRE VERSION

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 


N’OUBLIEZ PAS DE VISITEZ NOTRE BOUTIQUE EN LIGNE

Sur ce lien:Vintage par Michel

 

 

 

 

Courte opinion du jour:Message D’Espoir d’Alejandro Jodorowsky :

Message d’espoir d’Alejandro Jodorowsky :

 

 

« Leur plus grosse erreur : ils savaient que le collectif humain atteignait une vibration très élevée, mais ils n’étaient pas conscients de la quantité d’âmes éveillées.
Ils ont réalisé une erreur de jugement.
Et ils ont eu peur.
Maintenant, ils ne se cachent plus.
Ils sont maintenant pressés de lancer officiellement un « nouvel ordre mondial ».
Maintenant, leurs attaques sont directes et frontales.
Et les attaques vont augmenter.
Ils vont essayer par tous les moyens d’empêcher les gens de se réveiller.
Ils essaieront par tous les moyens que les personnes « éveillées » ne puissent pas communiquer afin de ne pas réveiller les autres.
Ils tenteront par tous les moyens de faire en sorte que les éveillés soient considérés comme des fous ou des criminels.
Quoi qu’ils fassent, ça n’a pas d’importance.
Le saut quantique a déjà eu lieu.
Il est inarrêtable.
L’humanité considère déjà les plantes et les animaux comme des âmes qui les animent.
L’humanité respecte déjà la Terre Mère.
L’humanité comprend déjà qu’il n’y a pas de séparation.
Les âmes qui s’incarnent maintenant arrivent déjà en tant qu’enseignants.
Il ne s’agit plus d’expérimenter.
Ils ne s’incarnent que pour enseigner comment aimer.
Nous pourrons ou non assister à ce changement total.
La transition peut prendre une semaine ou 300 ans.
Mais elle est inarrêtable.
Quoi qu’il arrive pendant la transition, n’oubliez pas une chose : c’est vous qui vous êtes proposé.
Pour être ici et maintenant.
Quoi qu’il arrive.
Tout ce que vous voyez.
Vous êtes les moteurs du changement.
Une seule chose est requise de vous.
Une seule.
Ne soyez pas de la nourriture.
C’est la seule chose que vous devez faire.
Une chose simple.
Ne soyez pas de la nourriture.
L’être humain est l’un des générateurs les plus puissants qui soient.
Nous sommes des vortex.
En fonction de la polarité vers laquelle vous vous alignez, vous créez des fréquences hautes ou basses. De
Ces entités sombres se nourrissent de basses fréquences, nous les nourrissons depuis des millénaires.
L’éveil de l’humanité a fait basculer le vortex collectif vers les hautes fréquences.
C’est pourquoi ils attaquent avec une telle férocité.
Ils sont affamés.
Connectez-vous avec votre âme.
Et observez-vous.
Si votre âme résonne avec ces mots, ne donnez pas une seconde de plus de votre existence pour être de la nourriture.
Éliminez les passions de base de votre vie.
Haine, ressentiment, envie, peur, vices, malbouffe, mensonges, ambition, égoïsme, tristesse, méfiance.
Tout cela génère une énergie dense.
De la nourriture pour les sombres.
Soyez conscient de vos émotions.
Écoutez-vous.
A vous.
Et si, à une occasion quelconque, vous vous sentez dans l’une de ces basses vibrations, changez ipso facto votre énergie.
Mettez de la musique qui vous soulève.
Chantez pour elle.
Dansez.
Respirez.
Allumez de l’encens.
Embrassez vos chats.
Embrassez votre ami.
Embrassez votre chien.
Embrassez votre mère.
Embrassez votre famille animale.
Faites une promenade dans la Nature.
Méditez.
Faites de l’exercice.
Faites ce que vous devez faire, mais changez cette énergie immédiatement.
Parce que vous servez de nourriture.
Soyez toujours conscient.
Et la seule chose qui vous est demandée est de ne pas nourrir les hordes sombres.
Nourrissez votre âme de tout ce qui vous aide à vous élever.
Si vous vous habituez à vivre dans la fréquence de l’amour, votre réalité se transformera à votre volonté sans effort.
Vous êtes un être puissant.
Vous êtes inarrêtable.
Ne craignez rien.
Libérez votre esprit de la Matrice.
Concentrez votre attention sur ce que vous désirez.
Mais surtout, amusez-vous, soyez heureux, souriez, chantez, dansez.
L’amour.
Nous sommes vivants en aimant le tout.
Et vous en faites partie.
Avec les étoiles et le Soleil.
Et toutes les galaxies de l’Univers.
Vous êtes l’Amour. »



 

Source: https://t.me/alliancehumainegalactique20

La Nouvelle Société du Vril:comprendre la personne de Maria Orsic

Afin de donner un côté humain à la Grande Prêtresse de la Société du Vril (celle d’origine) voici un article que j’ai monté à partir des messages et informations de mon ami en Europe.Ce texte commence véritablement les enseignements sur le Vril.Dans ce texte et dans les prochains,l’AZP désigne un organisme secret du gouvernement allemand chargé d’étudier les sociétés secrètes allemandes .Ces documents sont traduit d’archives qui sont resté secrètes…jusqu’à aujourd’hui!

La « cheville ouvrière du Vril » Maria Orschitsch, cette belle femme blonde et directrice de la société Vril Antriebstechnische Werkstätten, est entourée d’un flair à la fois historique et personnel. Elle était considérée comme une personnalité stricte et volontaire qui lui subordonnait tout.Elle était déterminée et aussi égocentrique. Cela l’a grandie, mais pas particulièrement sympathique. Elle a développé une grandeur purement humaine peut-être seulement dans la dernière phase de l’histoire de Vril, mais ensuite elle devient extrêmement agréable.

En règle générale, le chapitre Vril n’est pas du ressort de l’AZP, même s’il devrait le rester. Puisqu’il y a ici beaucoup d’expérience dans la recherche de traces de femmes disparues, et que l’AZP est tombée sur la piste de la  Vrildamen Traute A.  par hasard , nous voulons faire une exception aujourd’hui. Ces femmes sont un sujet passionnant et attrayant.

Si vous essayez de vous renseigner sur l’une des Vrildamen, comme avec l’AZP sur Traute A., vous apprendrez forcément quelque chose sur les autres. Traute s’est particulièrement intéressée à l’AZP, et elle semble mériter d’être particulièrement mise en valeur, du moins en tant que femme. Elle avait certainement un comportement plus agréable que Maria Orschitsch, qui était certes plus forte en leadership mais aussi vaniteuse et capricieuse, sur laquelle beaucoup plus a été publié jusqu’à présent, ce qui doit être compris, car Maria Orschitsch était à la tête de la communauté Vril, depuis sa fondation en tant que société entièrement allemande pour la métaphysique jusqu’aux ateliers d’ingénierie d’entraînement de l’entreprise. C’était sans aucun doute une femme d’une intelligence extrêmement élevée. Et il ne fait aucun doute que la « boss du Vril »

Maria Orschitsch avait des qualités atypiques pour une femme. Elle « pensait comme un homme » (écrit Angelika) et possédait ce qu’on appelle aujourd’hui des qualités de leadership dans les affaires. Apparemment, elle avait un talent ingénieux pour l’organisation. De nos jours, elle pourrait probablement aussi succéder à Josef Ackermann à Deutsche. Son manque de compétences en langues étrangères seule l’aurait empêchée, car elle ne parlait qu’un peu de français, presque pas d’anglais et, d’ailleurs, pas non plus de croate, la langue maternelle de son père. Son allemand était poli, elle pouvait le formuler avec brio. pourrait plus tard facilement apprendre le suédois  qui est étroitement lié.

 

 

 

 

 

Quelles traces de Maria Orschitsch peut-on encore trouver aujourd’hui, notamment en ce qui concerne sa vie future à partir du printemps 1945 ?

L’appartement de ses parents existait au-delà de la fin de la guerre (Seilerstätte, dans le 1er arrondissement de Vienne, une très bonne adresse). Aucun courrier de sa part n’y est arrivé, pas depuis 1940 environ. Avec ses grands-parents maternels (près de Zwettl, Basse-Autriche), elle a entretenu une correspondance sporadique et sans signification jusqu’en 1944. Elle ne semble pas du tout avoir été une grande écrivaine de lettres. Elle ne répondit aux lettres relativement nombreuses d’Erika B. que sous forme de télégramme, de sorte qu’à partir de 1941, elle ne lui écrivit plus. Par conséquent, il n’y a pratiquement pas de lettres de Maria, contrairement aux autres Vrildamen. De toute évidence, Maria O. n’était pas particulièrement émotive par nature. Ça n’avait pas l’air cool, mais ça pourrait l’être. Elle était probablement tellement impliquée dans les affaires du Vril qu’il n’y avait de place dans sa vie pour rien d’autre. C’était sans doute une grande idéaliste, soucieuse dans les années de guerre de contribuer le plus possible à la victoire, d’autant plus qu’elle reconnut très tôt la difficulté de la situation. Certains pensent que toute leur puissance émotionnelle a été investie dans leurs tâches. Cela semble tout à fait envisageable.

D’un point de vue humain, Maria Orschitsch n’était pas seulement sympathique. Elle était autoritaire, elle ne supportait pas la contradiction. De plus, elle était considérée comme trop vaniteuse et elle était sujette à des sentiments de rivalité avec d’autres belles femmes. Cela aurait conduit à certaines décisions que d’autres considéraient comme injustes. Sauf avec Traute, Maria s’entendait mieux avec Gudrun (même si elle violait systématiquement la règle des cheveux longs). Maria ne s’entendait pas avec Sigrun, qu’elle a elle-même gagnée pour la cause du Vril en 1941, cela a été maintes fois attesté. Malgré cette disparité personnelle, les deux femmes ont bien travaillé ensemble sur le sujet. Tous deux placent le patriotisme, particulièrement nécessaire à la guerre, au-dessus du personnel.

Contrairement à ce qu’on prétend souvent, Maria O. n’a jamais été particulièrement encline au spirituel. Elle laissa les choses magiques à d’autres, notamment Traute puis Sigrun. Maria O. était la gestionnaire idéale si vous définissez la gestion comme la capacité de bien déléguer. Ses capacités de réflexion analytique devaient être excellentes, de sorte qu’elle pouvait étonner même les officiers de haut rang, dont elle connaissait bien certains. Maria O. avait également une compréhension des questions militaires. Par exemple, elle a qualifié l’ordre d’Hitler de prendre des mesures contre Stalingrad et le Caucase en même temps qu’une grave erreur stratégique (le GFM Erich von Manstein le mentionne également). Elle semble avoir remis en question la compétence d’Hitler en tant que général, alors qu’elle pensait qu’il était un bon chancelier. Elle ne l’a jamais vu coupable du déclenchement de la Seconde Guerre mondiale. Contrairement à Erika, par exemple, qui en 1935 exprimait sa crainte dans une lettre (que Leonie / Leona a également signée) que la politique d’Hitler puisse conduire l’Allemagne à mener une guerre qui manquait victorieusement de moyens. Maria ne partageait pas initialement cette préoccupation. De plus, elle avait une aversion personnelle pour Léonie et Erika, d’autant plus qu’il s’agissait de deux très jolies femmes qui – contrairement à l’épouse toujours renfermée – aimaient aussi briller. La querelle de coiffure de 1922 n’a pas non plus été oubliée par Maria. 

Deux magnifiques portraits de Maria Orsic sur un mur de mon ami ,en Allemagne.

 

 

 

 

 

 

 

 

Depuis 1934, date à laquelle Maria est devenue directrice de l’entreprise, elle faisait rarement sa coiffure en fer à cheval, elle préférait désormais un nœud de cou. On dit que cela lui va très bien. Tous ceux qui la connaissaient rapportent que Maria Orschitsch était particulièrement attirante lorsqu’elle avait la mi-trentaine. Il y a des femmes qui ne développent leur plus grande beauté qu’à l’âge mûr et, lorsqu’elles ont plus de 30 ans, rayonnent plus qu’elles ne l’étaient lorsqu’elles étaient jeunes filles. Cela semble avoir été le cas de Maria Orschitsch. Bien que Maria O. attirait les hommes et sache utiliser cela pour atteindre ses objectifs, on ne sait pas qu’elle a jamais trompé son fiancé, qui était un soldat à partir de 1939.

Pour les agendas du Vril, les dix années les plus importantes de la vie de Maria sont probablement celles de 1935 à 1945. Pendant ce temps, elle change souvent de lieu de résidence, mais reste inscrite à la police à son ancienne adresse munichoise, Augustenstrasse. Maria était toujours là où le « projet Vril » était en cours d’exécution. Elle a donc vécu un certain temps dans le « Hauneburg », cette ferme adaptée près d’Osnabrück où les choses Vril étaient temporairement travaillées, puis, puisque le site de Brandebourg était occupé, à Berlin, et temporairement aussi dans la banlieue berlinoise de Hoppegarten. Comme sa résidence officielle est restée à Munich, bien qu’elle ait depuis longtemps renoncé à l’appartement de l’Augustenstrasse (elle n’y gardait qu’une chambre pro forma),

On ne sait pas du tout où Maria O. est allée à la fin de la guerre. Il est extrèmement possible qu’elle se soit envolée pour Aldebaran à bord d’un astronef de type  Vril Odin. Il y a des indications que ce projet a réellement existé, mais même s’il existait, cela ne signifierait pas que Maria doit avoir participé à ce vol. Après tout, Traute est resté sur terre, et nous ne savons pas quelles relations de pouvoir ont prévalu pour la dernière fois dans les affaires du Vril. Les critiques répétées de Maria sur l’art supposé général du « Führer » ne l’avaient certainement pas rendue populaire auprès des dirigeants nazi. La jeune Sigrun aurait pu facilement accéder à la première place dans la hiérarchie des Vrildamen (Dames du Vril). Les nazis ont essayé partout, par exemple, toujours dans la Wehrmacht, pour faire avancer les jeunes, les gens qui manquaient de maturité et de capacité de critique. En revanche, Maria O. n’était certainement pas une opposante au Parti Nazi, pas plus que Traute, qui critiquait aussi beaucoup de choses. Dans tout l’environnement Vril, ce n’est définitivement qu’Erika B, elle, qui avait initialement ouvertement sympathisé avec les nazis, qui est devenue une opposante clairement positionnée au système nazi (on ne sait pas pour Léonie). En ce qui concerne Maria, il est seulement certain qu’elle a reconnu des erreurs et les a également mentionnées par leur nom. Compte tenu de sa grande confiance en elle, elle pensait pouvoir se le permettre. Et même si elle n’a pas fait face à l’emprisonnement alors peut-être la déresponsabilisation de votre fonction de chef de projet Vril ? Cela ne semble pas du tout impossible ! Peut-être que la mission risquée sur laquelle elle a envoyé sa plus proche collègue, Traute, était même une dernière tentative pour renverser la vapeur sur cette affaire ? (Voir aussi notre article sur « La  Mission Secrète des Dames du Vril » qui sera publié parallèlement à cet article).

 

 

 

 

 

 

 

Si l’on suppose que c’était le cas, Maria O. n’était plus en charge du projet Vril, du moins pas seule, mais que d’autres instances se seraient massivement resserrées. Puis, connaissant son caractère, il est concevable que Maria ait refusé de jouer du second violon car elle était habituée au premier. Il est concevable que Maria aurait alors suivi son propre chemin, semblable à Traute. Et réfléchit plus loin : peut-être que Maria et Traute avaient déjà arrangé cela dans le Brandebourg au cas où la mission de Traute n’aurait pas le plein succès espéré (par exemple avec Kammler) ?

Le fiancé de Maria avait été sur le front de l’Est et avec l’une de ces unités allemandes qui voulaient échapper à la captivité soviétique via la Suède. La Suède a malheureusement extradé ces Allemands, ce qui n’est pas un papier glorieux dans l’histoire de l’État suédois. La majorité des Suédois pensaient que c’était mal en l’honneur de leur nation. Et Maria avait des contacts en Suède. Avant la guerre, elle s’était rendue deux fois en Suède avec Traute et son fiancé Hannes. Hannes y avait des amis. Peut-être que grâce à ses relations de défense, Maria a réussi à établir des contacts là-bas afin de sauver son fiancé de l’extradition vers les Soviétiques ?

 

 

 

 

 

 

Cet homme, Heinz H., était l’amour de sa vie pour Maria O. Elle le suivit à Munich en 1919. Et maintenant que tout le reste semblait perdu, elle aurait dû enfin régler sa vie privée. Cela aurait été son droit en tant que femme !

Tout ce qui suit n’est que spéculation, mais mérite réflexion : supposons qu’un arrangement avec Traute ait existé, comme on vient de le supposer hypothétiquement. Traute aurait eu l’occasion d’informer Maria des résultats de ses conversations (supposées) avec Canaris dans le camp de concentration de Flossenbürg et avec Kammler à Prague, comme elle les a elle-même évalués. En fin de compte, il s’agissait probablement d’arracher l’influence continue de Kammler dans le projet Vril. En tout cas, les contacts des Vrildamen étaient toujours bons. C’est pourquoi Traute a pu commencer le voyage en Uruguay. Maria avait certainement des gens fidèles qui ont pu l’aider en Suède. Peut-être même par le biais d’une visite spéciale du Vril 7, sinon avec l’une des machines spéciales, dont disposaient les organisations secrètes. Il ne fait aucun doute que Maria O. pourrait le faire. Elle serait donc arrivée en Suède à la fin du mois d’avril 1945. Soit d’abord aux officiers de liaison de l’Abwehr là-bas, soit directement aux amis de Hannes. Et – on peut aussi supposer que – Maria a de nouveau rencontré son fiancé en Suède. On sait de lui qu’il a été blessé à plusieurs reprises dans les combats en retraite sur le front de l’Est, mais il était vivant. Et – on peut aussi supposer que – Maria a de nouveau rencontré son fiancé en Suède. On sait de lui qu’il a été blessé à plusieurs reprises dans les combats en retraite sur le front de l’Est, mais il était vivant. Et – on peut aussi supposer que – Maria a de nouveau rencontré son fiancé en Suède. On sait de lui qu’il a été blessé à plusieurs reprises dans les combats en retraite sur le front de l’Est, mais il était vivant.

 

 

 

 

 

 

 

Pensons plus loin dans cette direction et supposons que Maria s’est remise ensemble heureusement avec son Heinz. Les bonnes relations en Suède, éventuellement complétées par de telles organisations secrètes allemandes, ont permis à Maria et à son fiancé d’obtenir des papiers suédois sous un nouveau nom. Et puis ils se seraient mariés là-bas – enfin. Et enfin Maria aurait retrouvé un petit bonheur intime, dont elle avait dû se passer si longtemps et qu’elle avait bien mérité.

Rien de tout cela n’a encore été prouvé, mais c’est hautement logique,mais c’est une histoire pleine d’humanité !


Bienvenue sur notre nouvelle chaîne sur Odysé:

Sur ce lien:Michel Duchaine Web Radio & Tv

 

 

 

 

 

 

 

 

 


EN VEDETTE SUR NOTRE BOUTIQUE VINTAGE PAR MICHEL:

Sur ce lien:VintageParMichel

Un magnifique billet de 10 francs suisses…considéré comme le plus beau billet au monde…en spécial.

 

 

 

 

 

L’HORREUR VACCINALE DE LA CRIMINELLE ARNAQUE DU COVID-19: La protéine de pointe du vaccin déclenche une explosion de cancers, d’immunodéficiences, de troubles auto-immuns et un vieillissement accéléré

La protéine de pointe du vaccin pénètre dans les noyaux cellulaires, supprime le moteur de réparation de l’ADN du corps humain, déclenchera une explosion de cancer, d’immunodéficience, de troubles auto-immuns et de vieillissement accéléré.
Cette découverte ne peut être décrite que comme une véritable « horreur » dans ses implications. De nouvelles recherches ahurissantes publiées dans Viruses, qui font partie de l’édition SARS-CoV-2 Host Cell Interactions de MDPI (Open Access Journals) révèlent que les protéines de pointe du vaccin pénètrent dans les noyaux cellulaires et font des ravages dans le mécanisme de réparation de l’ADN des cellules, supprimant jusqu’à 90% de la réparation de l’ADN .

Le document de recherche est intitulé «SARS-CoV-2 Spike Impairs DNA Damage Repair and Inhibits V(D)J Recombination In Vitro» et est rédigé par Hui Jiang et Ya-Fang Mei, au Département de biosciences moléculaires, The Wenner- Gren Institute, Stockholm University, SE-10691 Stockholm, Suède, et le Département de microbiologie clinique, virologie, Umeå University, SE-90185 Umeå, Suède, respectivement.
Nous avons enregistré une copie du document de recherche dans un document PDF sur les serveurs NN à cette URL :
https://www.naturalnews.com/files/viruses-13-02056-v2.pdf
Dans la conclusion de l’article, les auteurs écrivent: “Nous avons constaté que la protéine de pointe inhibait de manière marquée la formation de foyers BRCA1 et 53BP1 (Figure 3D-G). Ensemble, ces données montrent que la protéine de pointe pleine longueur du SRAS-CoV-2 inhibe la réparation des dommages à l’ADN en entravant le recrutement de la protéine de réparation de l’ADN. ”
Le mécanisme de réparation de l’ADN, connu sous le nom de NHEJ (Non-Homologous End Joining ; Jonction d’extrémités non homologues) La jonction d’extrémités non homologues (en anglais Non-Homologous End-Joining ou NHEJ) est un mécanisme de réparation de l’ADN qui permet de réparer des lésions provoquant des cassures double brin (CDB). C’est un mécanisme non-conservatif (contrairement par exemple à la réparation par recombinaison) c’est-à-dire qu’il ne restaure pas la séquence initiale de l’ADN; mais seulement la continuité de l’ADN endommagé par une cassure double brin. Cette réparation conduira ainsi au changement de l’information génétique, en général une délétion, et donc possiblement à l’apparition d’une mutation pour le gène concerné si la cassure survient à l’intérieur d’un gène. Sans le mécanisme NHEJ, toute vie multicellulaire avancée cesserait d’exister. Aucun être humain, animal ou végétal ne peut survivre si l’intégrité de son code génétique n’est pas protégée et constamment réparée par de multiples mécanismes.
Les dommages à l’ADN peuvent être causés par l’exposition aux rayonnements, aux produits chimiques présents dans les aliments et les produits de soins personnels, ou même l’exposition à des équipements de mammographie. Une exposition excessive au soleil peut également provoquer des ruptures d’ADN, et des mutations mineures de l’ADN se produisent spontanément dans tous les organismes vivants. Les pilotes de ligne, par exemple, sont régulièrement exposés aux rayonnements ionisants dus au vol en altitude.

Chez une personne normale et en bonne santé, le mécanisme NHEJ répare l’ADN et empêche une mutation pathogène de se produire. Mais en présence de la protéine de pointe du vaccin, l’efficacité du NHEJ est supprimée jusqu’à 90 %, ce qui signifie qu’il est incapable de faire son travail en raison de la capacité supprimée à recruter des protéines pour la réparation.
En conséquence, les « erreurs » suivantes sont introduites dans les chromosomes à l’intérieur des noyaux des cellules humaines, toutes dues à la présence de la protéine de pointe des vaccins à ARNm :
• Mutations ou « erreurs » dans la séquence génétique.
• Suppressions de segments entiers du code génétique.
• INSERTIONS de segments incorrects.
• Mélange et appariement / permutations du code génétique.
Ces erreurs, lorsqu’elles sont exprimées à travers la division cellulaire et la réplication, entraînent :
• Une explosion de cancers et de tumeurs cancéreuses dans tout le corps
• Perte de production de lymphocytes B et T du système immunitaire (c’est-à-dire immunodéficience induite)
• Troubles auto-immuns
• Vieillissement accéléré et longueur des télomères réduite
• Perte de fonctionnement de systèmes organiques complexes tels que circulatoire, neurologique, endocrinien, musculo-squelettique, etc.
• Dommages cellulaires ressemblant à un empoisonnement aux radiations, car les cellules se détruisent de l’intérieur
Beaucoup de ces effets sont, bien sûr, fatals. D’autres vont accabler les victimes du vaccin de blessures débilitantes horribles et de dysfonctionnements d’organes qui nécessiteront tout au long de la vie d’interventions médicales.

La protéine de pointe pénètre dans le noyau de la cellule

Du document lié ci-dessus:
Mécaniquement, nous avons constaté que la protéine de pointe se localise dans le noyau et inhibe la réparation des dommages à l’ADN en empêchant le recrutement des protéines clés de réparation de l’ADN BRCA1 et 53BP1 sur le lieu des dommages.
Cela signifie que la protéine de pointe, qui est générée dans les ribosomes cellulaires après que les cellules ont été détournées par les vaccins à ARNm, ne quitte pas toujours la cellule et ne pénètre pas dans la circulation sanguine, comme nous le disent les défenseurs du vaccin à ARNm. Dans certains cas, la protéine de pointe pénètre dans le noyau cellulaire. Là, elle interfère avec le mécanisme de réparation de l’ADN tel que décrit tout au long de cet article.

« Étonnamment, nous avons trouvé beaucoup de protéines de pointe dans le noyau (figure 1A) », ont conclu les auteurs de l’étude.
Cela signifie, sans aucun doute, que les vaccins à ARNm entraînent des altérations chromosomiques dans les cellules du corps. C’est la confirmation que de tels vaccins font effectivement des ravages dans l’intégrité génétique et présentent des effets secondaires qui n’ont pas été anticipés ou décrits par les partisans du vaccin à ARNm.
Dr. Thomas Levy écrit sur la toxicité de la protéine de pointe sur Orthomolecular.org::
Des inquiétudes ont été soulevées concernant la dissémination de la protéine de pointe dans tout le corps après la vaccination. Plutôt que de rester localisé au site d’injection afin de provoquer la réponse immunitaire et rien de plus, la présence de protéines de pointe a été détectée dans tout le corps de certains individus vaccinés. De plus, il semble que certaines des protéines de pointe circulantes se lient simplement aux récepteurs ACE2 sans pénétrer dans la cellule, induisant une réponse auto-immune à l’ensemble de l’entité protéine de pointe cellule. Selon le type de cellule qui se lie à la protéine de pointe, l’un des nombreux problèmes médicaux auto-immuns peut en résulter.
Plus alarmant encore, le Dr. Levy explique que les preuves actuelles montrent que la protéine de pointe continue à être produite dans le corps, après l’injection initiale d’ARNm. Il explique:
Bien que la pathologie sous-jacente reste à définir complètement, une explication des problèmes de tendances thrombotiques et d’autres symptômes observés chez les patients COVID chroniques et post-vaccination est directement liée à la présence persistante de la protéine de pointe du coronavirus. Certains rapports affirment que la protéine de pointe peut continuer à être produite après la liaison initiale aux récepteurs ACE2 et l’entrée dans certaines des cellules qu’elle cible initialement. Les images cliniques de la COVID chronique et de la toxicité post-vaccinale semblent très similaires, et les deux sont probablement dus à cette présence continue et à cette diffusion à l’échelle du corps de la protéine de pointe (Mendelson et al., 2020 ; Aucott et Rebman, 2021 ; Levy Ravenendran, 2021).

La protéine de pointe pleine longueur a entraîné la plus grande suppression du mécanisme de réparation de l’ADN NHEJ
Voir les chiffres ci-dessous. Les fragments viraux du SRAS-CoV-2 sont nommés « Nsp1, Nsp5 » et ainsi de suite. La pointe pleine longueur est appelée « Spike » et la nucléocapside – une autre partie structurelle de l’agent pathogène de la protéine de pointe entière – est identifiée séparément.
De l’étude :
La surexpression de Nsp1, Nsp5, Nsp13, Nsp14 et des protéines de pointe a diminué l’efficacité de la réparation HR et NHEJ (Figure 1B-E et Figure S2A,B).
Les figures C et E montrent la suppression de la réparation NHEJ par ces différentes portions de fragments viraux. (Voir les lignes graphiques verticales bleues représentant les niveaux d’activité / efficacité du mécanisme de réparation de l’ADN).

 

 

 

 

 

 

 

 

 

 

 

 

 

 

  Ce que ces données montrent, c’est que la plus grande suppression de l’activité NHEJ est mesurée lorsque la protéine de pointe complète est présente. De l’étude :

Ensemble, ces données montrent que la protéine de pointe pleine longueur du SRAS-CoV-2 inhibe la réparation des dommages à l’ADN en entravant le recrutement de la protéine de réparation de l’ADN.
Il s’a

git de la protéine de pointe qui est générée par les propres cellules du corps après avoir reçu l’injection d’un vaccin à ARNm :

 

 

 

 

 

 

 

 

 

Dans la figure 2, ci-dessous, nous voyons que la suppression de l’activité NHEJ présente une réponse dose-dépendante à la présence de protéine de pointe (figures 2B et 2C). Cela indique que plus il y a de protéines de pointe, plus la suppression de la réparation de l’ADN est importante :

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

La figure en bas à droite, 2G, montre comment la présence de la protéine de pointe inhibe la réparation de l’ADN à la suite de diverses agressions contre l’ADN, telles que les radiations, l’exposition chimique ou l’oxydation. Fait important, comme l’expliquent les auteurs de l’étude :
Après différents traitements des dommages à l’ADN, tels que l’irradiation , le traitement à la doxorubicine et le traitement au H2O2, il y a moins de réparation en présence de la protéine de pointe (Figure 2F, G). Ensemble, ces données démontrent que la protéine de pointe affecte directement la réparation de l’ADN dans le noyau.

L’exposition à la 5G, l’exposition aux chemtrails, l’exposition aux produits chimiques alimentaires, la mammographie et même l’exposition au soleil feront des ravages chez ceux qui ont pris des vaccins à ARNm
Le résultat horrible de cette découverte est que les personnes qui ont pris des vaccins à ADN subiront la suppression de la réparation de l’ADN , augmentant les expositions qui étaient autrefois considérées comme des problèmes mineurs à des menaces importantes pour leur santé.

En d’autres termes, les personnes exposées aux rayonnements 5G, aux examens de mammographie, aux produits chimiques plastifiants dans les produits alimentaires et aux agents cancérigènes dans les produits de soins personnels (détergents à lessive, parfums, shampooings, lotions pour la peau, etc.) seront incapables de réparer les dommages à l’ADN causés par ceux-ci. expositions. Après des expositions relativement faibles, ils commenceront à muter et à développer des cancers dans tout leur corps.
N’oubliez pas que l’exposition à la 5G entraîne la production de peroxynitrite dans le sang, un radical libre extrêmement dangereux qui endommage l’ADN des cellules du cerveau et des tissus du corps.
Cela pourrait même être décrit comme une sorte de système d’arme binaire où les vaccins à ARNm affaiblissent la réparation de l’ADN, et l’exposition à la 5G (ou exposition chimique dans l’approvisionnement alimentaire) fournit l’arme qui brise les brins d’ADN et empêche le corps de maintenir l’intégrité génétique pendant réplication cellulaire. Cela ne prend pas longtemps pour s’exprimer de manières physiques horribles, telles que la tentative de croissance de tissus d’organes internes à la surface de la peau ou du visage, c’est pourquoi j’ai intitulé le podcast d’aujourd’hui, “Monstres, zombies et mutants. « 

La présence de la protéine de pointe interfère avec la fonction immunitaire normale et conduit à une immunodéficience (une affection semblable au SIDA)
Cette recherche révèle également que les protéines de pointe des vaccins à ARNm peuvent conduire à des conditions d’immunodéficience, similaires au SIDA. Cela est cohérent avec ce que nous avons précédemment rapporté sur la baisse de la fonction immunitaire d’environ 5% par semaine chez ceux qui ont pris des vaccins contre le covid. De l’étude :

La perte de fonction de protéines clés de réparation de l’ADN telles que ATM, DNA-PKcs, 53BP1, et al., entraîne des défauts dans la réparation NHEJ qui inhibent la production de cellules B et T fonctionnelles, entraînant une immunodéficience.
La fonction immunitaire est également affectée de manière critique par la présence de la protéine de pointe, pouvant conduire à des mutations cancéreuses dans toutes les cellules du corps. Comme l’explique l’étude :

La réparation des dommages à l’ADN, en particulier la réparation NHEJ, est essentielle pour la recombinaison V(D)J, qui est au cœur de l’immunité des cellules B et T.
Comme l’explique également Science Direct :

Le maintien de l’intégrité génomique est impératif pour la survie d’un organisme. Parmi les différents dommages à l’ADN, les cassures double brin (double-strand breaks DSB) sont considérées comme les plus délétères car elles peuvent entraîner la mort cellulaire si elles ne sont pas réparées ou entraîner des réarrangements chromosomiques lorsqu’ils sont mal réparés, entraînant un cancer.
De plus, des mutations dans les gènes NHEJ, notamment Ku70 et Ku80, ont été associées à une durée de vie raccourcie chez la souris [54]. De plus, des défauts dans l’ADN-PKcs (protéine kinase dépendante de l’ADN) ont entraîné une altération du maintien des télomères et une durée de vie raccourcie chez la souris [55] . Pris ensemble, ces éléments de preuve suggèrent que NHEJ joue un rôle important dans la prévention de l’augmentation liée à l’âge de l’instabilité génomique et du déclin fonctionnel.

En effet, cela signifie que la suppression par la protéine de pointe du mécanisme de réparation de l’ADN NHEJ conduit également à une durée de vie réduite et à un vieillissement accéléré.
Selon certaines estimations, 50% des personnes injectées avec des vaccins à ARNm mourront dans les cinq ans. Nous avons maintenant une meilleure compréhension des mécanismes par lesquels ces décès induits par le vaccin peuvent se produire.
Écoutez l’explication verbale de tout cela dans le podcast Situation Update suivant:
Brighteon.com/cb351cd3-6c94-4f2b-a05d-bbda757d4472

Source : SCIENCE HORROR: Vaccine spike protein enters cell nuclei, suppresses DNA repair engine of the human body, will unleash explosion of cancer, immunodeficiency, autoimmune disorders and accelerated aging
November 02, 2021 by: Mike Adams

==========================================================
Livre : PANDEMIA

Au moment où j’écris ceci, je termine A Shot to Save the World, le nouveau livre sur la chasse au vaccin Covid. Ce que – étonnamment – je ne déteste pas. Écrit par Gregory Zuckerman du Wall Street Journal, le livre est un regard sérieux sur les décennies de travaux scientifiques qui ont aidé à produire les vaccins mRNA et ADN/AAV Covid.

Mais à lire ce livre, on comprend que le développement de ces nouvelles biotechnologies par rapport t au développement de médicaments à petites molécules ordinaires, c’est  comme comparer une mission habitée vers Mars à un voyage en voiture à travers votre région. Ils sont tellement compliqués que même le fait d’essayer de les expliquer de manière cohérente est une rude tâche.

Les médicaments à petites molécules à l’ancienne comme l’aspirine sont généralement des produits chimiques relativement simples avec des structures atomiques qui peuvent être esquissées sur une serviette de table.

 

 

 

 

 

 

 

 

 

En général, ces médicaments agissent de manière simple, en se fixant aux récepteurs sur la surface de nos cellules et en les activant ou en les empêchant d’être activés.
Le corps les détruit ensuite, généralement assez rapidement, et leurs effets cellulaires s’estompent. Ils doivent être à nouveau dosés après quelques heures ou une journée. À ce stade, après des générations à les développer, les scientifiques et les médecins comprennent très bien comment ils fonctionnent. Même ainsi, ils doivent être soigneusement testés car ils peuvent avoir des effets indésirables ou être toxiques de manière inattendue.
Mais nous sommes assez bons pour les fabriquer. En fait, il y a encore 20 ans, nous étions si bons à les fabriquer que nous avions atteint la plupart des cibles visées par ces médicaments, comme le cholestérol, la tension artérielle et le diabète.
Malheureusement, jouer avec les récepteurs cellulaires ne peut pas faire grand-chose. La plupart des cancers, des maladies du cerveau, des maladies auto-immunes et des troubles génétiques ne se prêtent tout simplement pas aux traitements à base de petites molécules. Les traiter nécessite des protéines et des enzymes plus grosses et plus compliquées qui imitent les protéines existantes du corps, se fixent à des parties spécifiques des cellules dérangées (cancer ou autre) ou ont d’autres effets.
Pendant des décennies, ces protéines étaient généralement cultivées à l’extérieur du corps, puis injectées dans celui-ci.
L’érythropoïétine produite artificiellement, ou EPO – une molécule que nos propres reins fabriquent pour aider à stimuler la production de globules rouges – est un exemple relativement simple d’un tel traitement.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Mais les vaccins ARNm/LNP et ADN/AAV vont encore plus loin.
Ils impliquent de ne pas utiliser un simple produit chimique pour interférer avec un seul récepteur ou d’injecter une protéine que nous avons cultivée dans des cellules spécifiquement purifiées, mais de détourner les processus fondamentaux de création biologique du corps.
OR, NOS CORPS N’AIMENT PAS SE FAIRE PIRATER LEURS PROCESSUS FONDAMENTAUX DE CRÉATION BIOLOGIQUE. PAS PAR DES VIRUS, NI  PAR DES SCIENTIFIQUES. Ils combattent le processus à chaque étape. C’est pourquoi nous avons des systèmes immunitaires.
Ainsi, l’utilisation de l’ARNm ou de l’ADN pour que nos cellules produisent des protéines comporte un risque à chaque étape. Au moment de l’injection, l’ARNm doit être à la fois déguisé ET caché dans une minuscule boule de graisse (et l’ADN attaché à un virus du rhume), sinon notre corps le détruira probablement avant même qu’il puisse atteindre nos cellules
Comme l’explique Zuckerman dans son livre, “ les scientifiques [modernes] se sont heurtés à un nouveau problème énorme… les administrations suivantes ont vu la production de protéines s’effondrer. C’était comme si la défense du corps avait appris à repousser la molécule injectée et sa charge génétique. »
Moderna a fini par se détourner de la fabrication de médicaments à ARNm pour des doses répétées et se concentrer sur les vaccins pour cette seule raison ; un vaccin efficace ne devrait avoir besoin que d’une ou deux doses pour produire une réponse immunitaire soutenue sinon permanente, éliminant ainsi le besoin d’un dosage régulier.
Mais les problèmes ne s’arrêtent pas là. Si les particules injectées laissent tomber leur charge utile génétique dans les mauvaises cellules, elles peuvent également causer des dommages.
Les scientifiques ont également démontré à plusieurs reprises que les protéines de pointe créées par les vaccins à ARNm Covid peuvent être toxiques – en particulier pour les cellules des vaisseaux sanguins – toutes seules, sans le reste de Sars-Cov-2 attaché. (Voir, par exemple : https://www.frontiersin.org/articles/10.3389/fcvm.2021.687783/full)
Ce qui n’a pas d’importance, nous ont dit les fanatiques du vaccin Covid, car la protéine de pointe que les vaccins génèrent ne circule pas.
Sauf que Si, elle circule.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Mais attendez, il y a encore pire.

Nous savons qu’à court terme, les vaccins à ARNm entraînent une baisse des globules blancs essentiels appelés lymphocytes – Pfizer et BioNTech ont eux-mêmes reconnu ce problème.

(SOURCE : https://www.nature.com/articles/s41586-020-2814-7)

Maintenant, le gouvernement britannique avertit que les personnes qui reçoivent les vaccins semblent avoir une réponse immunitaire moins complète au Sars-Cov-2 après l’infection.

Encore plus inquiétant, les scientifiques ont maintenant trouvé des preuves que les vaccins peuvent produire des changements inquiétants à long terme dans le système immunitaire :

Le vaccin à ARNm BNT162b2 contre le SRAS-CoV-2 reprogramme les réponses immunitaires adaptatives et innées

(SOURCE : https://www.medrxiv.org/content/10.1101/2021.05.03.21256520v1)

Pour être clair, une preuve n’est pas une preuve. Ces changements peuvent ne pas avoir d’importance pour notre réponse immunitaire globale. Même la gravité du risque est une question extrêmement complexe que je ne suis pas qualifié pour discuter en profondeur.

Mais personne d’autre non plus.

Et bon nombre des personnes qui comprennent le mieux ces problèmes ont un énorme intérêt financier dans le succès des vaccins Sars-Cov-2. Le livre de Zuckerman montre clairement que Moderna faisait face à de vrais problèmes en 2019, avant que Covid ne frappe. Bancel avait passé trop d’années à faire des promesses qui ne s’étaient pas réalisées, et Moderna brûlait de l’argent à un rythme effarant sans aucun médicament commercialisable à montrer pour les dépenses.

Maintenant, bien sûr, Bancel et Moderna n’ont plus de tels soucis.

Quant aux régulateurs, ils ont eu assez de mal à l’époque des petites molécules. En 1999, ils ont été incapables de comprendre que le Vioxx provoquait des crises cardiaques, même lorsque Merck leur a présenté des données claires montrant que le Vioxx provoquait des crises cardiaques.

Cela ne veut pas dire que les vaccins Covid à ARNm (et ADN/AAV) sont nécessairement dangereux, ou que leurs risques l’emportent sur leurs avantages. Mais nous devrions tous comprendre à quel point ces thérapies sont radicales et combien d’inconnues elles comportent.

La seule solution à ces inconnues est de très grands essais menés pendant de longues périodes.

Un essai clinique de 40 000 personnes peut sembler important, ce n’est pas le cas, pas dans le contexte d’un médicament que les gouvernements vont donner (ou plus précisément imposer) à des MILLIARDS de personnes en bonne santé. En 1954, l’essai du vaccin contre la polio de Salk couvrait près de deux millions d’enfants – oui, 2 000 000 – dont 400 000 qui ont reçu le vaccin. Et la polio était bien plus dangereuse pour les enfants que Sars-Cov-2.

Mais un péché tout aussi important contre la science était le fait que les régulateurs ont permis à Pfizer/BioNTech et Moderna de lever l’aveugle et ainsi de détruire leurs essais pivots quelques semaines après avoir présenté les premières données.

Maintenant, nous dégringolons dans le noir.

Et cela n’aurait peut-être pas beaucoup d’importance si les vaccins Covid avaient mis fin à l’épidémie de Covid. Mais ils ne l’ont pas fait. Pas même dans des endroits où presque tous les adultes les ont reçus, comme à Waterford, en Irlande, où 99,7% de tous les adultes sont complètement vaccinés.

Maintenant, les autorités de santé publique et le reste des médias poussent les « boosters » – encore une fois, pour une biotechnologie qui a été réutilisée en tant que vaccin PARCE QU’ELLE A ÉCHOUÉ LORS DE L’ADMINISTRATION RÉPÉTÉE.

Pendant ce temps, ils ignorent simplement l’augmentation étrange de la mortalité toutes causes non-Covid que de nombreux pays constatent actuellement.

Où se termine ce voyage, je ne sais pas.

Mais je sais ceci : nous avons inventé le produit le plus complexe imaginable, l’avons testé sur une poignée relative de personnes pendant quelques mois, un calendrier bien plus court que ce qui est typique pour le développement de médicaments. Maintenant, nous le poussons sur tous les humains que nous pouvons atteindre – pour prévenir (ou plus précisément ne pas empêcher) une maladie qui n’est pas particulièrement dangereuse pour la plupart d’entre eux.

Pas d’aspirine

Qu’est-ce qui pourrait mal se passer?

Mieux encore, le livre contient cette ligne sur Stéphane Bancel, directeur général de Moderna, de Derrick Rossi : « Il me demandait de voler dans un hôpital qui soigne les enfants. Stéphane est quelqu’un sans boussole morale.

Qui est Derrick Rossi ? Un anti-vaccin fou amoureux de l’ivermectine, sans aucun doute !

Cofondateur de Moderna ? Oh, c’était ma deuxième supposition. Pendant ce temps, Stéphane a 10 milliards de dollars d’actions Moderna pour acheter une nouvelle boussole morale.

Alex Berenson est un ancien journaliste du New York Times et l’auteur de 13 romans, de deux ouvrages de non-fiction et des livrets Unreported Truths. Son troisième livre de non-fiction, PANDEMIA, sur le coronavirus et notre réponse à celui-ci, sera publié le 11 novembre. Cet article a été initialement publié sur son blog.

Source :         PANDEMIA  


APPUYEZ VOTRE SITE WEB FAVORI EN VISITANT  NOTRE BOUTIQUE EN LIGNE:

Sur ce lien:Vintage par Michel

 

 

 

La Gigantesque Arnaque du COVID-19:La « chasse aux sorcières » contre les médecins honnêtes s’intensifie

Le Dr Robert Malone, l’inventeur des vaccins à ARNm, dit qu’il a été qualifié de « terroriste » par les médias en Italie et avertit que les médecins qui s’expriment sont « traqués par les commissions médicales et la presse ».

« Je vais parler franchement », a tweeté Malone. « Les médecins qui s’expriment sont activement recherchés par les commissions médicales et la presse. Ils essaient de nous délégitimer et de nous éliminer un par un. Ce n’est pas une théorie du complot, c’est un fait. Veuillez vous réveiller. Cela se produit à l’échelle mondiale.

« J’ai été qualifié de ‘terroriste’ dans la presse italienne lorsque j’étais à Rome pour le Sommet international COVID. Mon crime ? Plaidoyer pour un traitement précoce de la maladie COVID-19. Je suggère que cela mérite un peu de méditation », a-t-il ajouté.

Malone est l’un des nombreux médecins qui ont été complètement persécutés simplement pour avoir discuté de problèmes liés aux traitements COVID et aux effets secondaires des vaccins.

Il a fait face à une vive opposition pour son affirmation selon laquelle les enfants ne devraient pas recevoir de vaccins COVID-19 et a également constamment souligné les inquiétudes concernant les liens avec le risque de myocardite.

Ces inquiétudes sont maintenant justifiées par la Finlande, le Danemark et la Suède qui arrêtent le vaxx Moderna pour les jeunes hommes après des rapports d’effets secondaires cardiovasculaires.

Malgré de telles inquiétudes régulièrement exprimées par les médecins, la Fédération des commissions médicales d’État a annoncé en juillet qu’elle envisagerait de retirer les licences médicales des médecins qui font de la « désinformation » sur COVID.

Dans un autre développement stupéfiant, l’adresse IP de Malone a été bloquée par le New England Journal of Medicine afin qu’il ne puisse pas lire les études sur leur site Web.

Le médecin a déclaré qu’il savait comment contourner le blocage IP, mais a qualifié cette décision de « petit acte minable ».

 


EN COMPLÉMENTAIRE

 

DR. MALONE : « L’immunité collective n’est pas possible »

Dans l’un des exemples les plus révoltants de Big Tech qui essaie de museler les  scientifiques qui refusent de mettre en sourdine  leurs critiques sur la technologie ARNm derrière les vaccins COVID ( comme Moderna et Pfizer-BioNTech), le Dr Robert Malone, un pionnier qui a aidé à développer la technologie de vaccin à ARNm, [1] a vu le mérite de sa contribution à la médecine effacé d’Internet par Wikipédia, car il avait fait part de ses inquiétudes concernant les problèmes auto-immunes potentiels à long terme et d’autres complications pouvant résulter des injections  de ces vaccins à ARNm [2].

Il a également partagé d’autres « hérésies médicales », y compris la possibilité que des vaccins « imparfaits » pourraient en fait aider à favoriser des variantes COVID plus virulentes en raison d’un phénomène appelé « ADE » – antibody-dependent enhancement (amélioration dépendante des anticorps). Essentiellement, ce qui ne tue pas le virus le rend plus fort. En représailles pour avoir partagé ces opinions, le Dr Malone a été ridiculisé par ses collègues comme un complotiste et un « anti-vaxxer ».

 

Mais plus tôt cette semaine, le Dr Malone a vu ses opinions subtilement confirmées par une source inattendue : un scientifique et universitaire britannique nommé le professeur Sir Andrew Pollard, qui est le directeur de l’Oxford Vaccine Group. Lors d’un briefing, Sir Pollard a averti le Parlement que le Royaume-Uni n’obtiendra probablement jamais l’immunité collective, à cause de la variante delta.

Dans des remarques qui risquaient de saper la campagne de vaccination du gouvernement, Sir Pollard, professeur d’infection et d’immunité pédiatriques, a averti mardi le Parlement britannique que l’obtention de l’immunité collective n’était probablement « pas une possibilité » en raison des variantes comme delta. Récemment, un groupe de scientifiques a estimé que le seuil d’immunité collective pourrait maintenant atteindre 90 % en raison de la variante delta. Selon Pollard, nous apprenons pour la première fois que l’immunité collective est une pensée magique – et a toujours été une pensée magique.

Étant donné que ceux qui sont vaccinés peuvent toujours être infectés par des variantes, « il n’y a pratiquement rien que le Royaume-Uni puisse faire » pour éradiquer complètement le COVID.

« Nous savons très clairement avec le coronavirus que cette variante actuelle, la variante Delta, infectera toujours les personnes qui ont été vaccinées, et cela signifie que quiconque n’est toujours pas vacciné, à un moment donné, rencontrera le virus« , a déclaré Pollard.

Il a déclaré qu’il était peu probable que l’immunité collective soit jamais atteinte, affirmant que la prochaine variante du nouveau coronavirus sera « peut-être encore plus facilement  transmissible aux les populations vaccinées« .

Pollard a également partagé ce qui ressemblait à une critique subtile des masques en disant que « Nous n’avons rien qui puisse arrêter cette transmission à d’autres personnes« . À titre d’exemple, il a cité Israël, qui a vu de nouveaux cas et hospitalisations presque disparaître avant que la nouvelle variante ne s’installe, provoquant une nouvelle augmentation des cas et des hospitalisations. Maintenant, il y a même eu une poignée de patients qui ont été testés positifs même après avoir reçu leur troisième dose du vaccin Pfizer (que les États-Unis viennent tout juste d’approuver pour une troisième dose également).

Le Dr Malone, quant à lui, a célébré les commentaires de Sir Pollard comme une justification.

As I have been saying. The « Noble Lie » is being revealed step by step. https://t.co/xDv8nvsm0A

— Robert W Malone, MD (@RWMaloneMD) August 10, 2021

This is what external validation looks and sounds like.
Now, watch carefully for how long it takes until Dr. Fauci and the USG/CDC get on board the bus.

— Robert W Malone, MD (@RWMaloneMD) August 10, 2021

Comme je l’ai dit. Le « Noble Mensonge » se révèle pas à pas. ]

Voici à quoi ressemble et apparaît la validation externe. Maintenant, surveillez attentivement le temps qu’il faut pour que le Dr Fauci et l’USG/CDC montent à bord du bus.]

– Robert W Malone, MD (@RWMaloneMD) 10 août 2021

Pour le contexte, le Dr Malone a tweeté en juin que les cibles d’immunité collective étaient effectivement inutiles.

Le gouvernement fédéral américain ne possède pas les données pour calculer la transmissibilité et donc aucune cible de vaccination ne peut prédire «l’immunité collective» https://t.co/ZktdsXx1hF

— Robert W Malone, MD (@RWMaloneMD) June 25, 2021

Même la Maison Blanche reconnaît enfin que les vaccins ne sont pas aussi efficaces qu’ils le croyaient autrefois, c’est pourquoi la FDA a décidé d’approuver la troisième dose. « Je pense que tout le monde pense que cela diminue avec le temps, la question est de savoir dans quelle mesure« , a déclaré un haut responsable de Biden à Axios. « Personne ne rater le coche. Nous voulons l’attraper avant qu’il n’y ait un problème, et c’est pourquoi il y a un examen très minutieux. »

N’oubliez pas que non seulement les personnes vaccinées peuvent être écœurées par des  « nouvelles » infections , mais elles peuvent également transmettre le virus à d’autres (y compris à d’autres vaccinés). Et plus le virus se propage, plus une variante résistante au vaccin est susceptible d’émerger.

Source : DR. MALONE: “Herd Immunity Is Not A Possibility”

L’inventeur du vaccin à ARNm : les vaccins COVID-19 peuvent rendre le virus plus dangereux

Le Dr Robert Malone avertit que le développement d’une amélioration dépendante des anticorps chez les personnes vaccinées avec des vaccins COVID  « est le pire cauchemar du vaccinologue ».
Le scientifique  appelle à l’arrêt immédiat des vaccinations.
En Suède, depuis qu’il n’a y plus de masques, il n’y quasiment plus de morts du Covid.

Le meilleur scientifique des vaccins, le Dr Robert Malone, a averti que les vaccins pourraient rendre le COVID-19 plus dangereux et a déclaré que la campagne de vaccination pourrait devoir être complètement interrompue dans une interview mercredi sur War Room de Steve Bannon.
Le Dr Malone déclare notamment avoir été le principal inventeur de la technologie de l’ARNm et des innovations en matière d’ARNm et d’ADN alors qu’il travaillait avec le Salk Institute dans les années 1980. Les vaccins Pfizer et Moderna COVID-19 reposent tous deux sur la technologie de l’ARNm. Malone est également un médecin agréé qui a reçu sa formation médicale à l’Université Northwestern, à la faculté de médecine de l’Université Harvard et à l’UC Davis.
Dans son entretien avec Bannon, Malone a répondu au récent revirement des Centers for Disease Control and Prevention (CDC) sur les masques faciaux, notant ce qu’il a appelé « des déploiements d’informations de plus en plus désespérées et abruptes ».

Plus tôt cette semaine, le CDC a mis à jour ses directives pour indiquer que les Américains devraient à nouveau se masquer à l’intérieur s’ils se trouvent dans des zones de transmission virale « élevée » ou « substantielle », même après avoir reçu des vaccins COVID-19. « Des preuves émergentes suggèrent que les personnes entièrement vaccinées qui sont infectées par la variante Delta risquent de la transmettre à d’autres« , indiquent maintenant les directives de l’agence, citant des « données non publiées », dont certaines ont été publiées vendredi.
«Nous avons assisté à une progression de déploiements d’informations de plus en plus désespérées et abruptes, à commencer par l’alerte de Pfizer il y a quelques semaines selon laquelle ils pensaient que nous allions avoir besoin d’un rappel après six mois, et Fauci les réprimandant, puis le gouvernement faire volte-face et dire que nous allions devoir avoir des rappels pour les bénéficiaires de Pfizer après six mois chez les personnes âgées et immunodéprimées, puis la bombe larguée la nuit dernière », a déclaré Malone. « Et j’ai peur que ce soit précisément ce qui m’a préoccupé.« 

Il a noté un rapport de NBC News mardi qui affirmait que le retour en arrière du CDC sur les masques reflétait des données montrant que les personnes vaccinées « pourraient être porteuses de niveaux de virus plus élevés que prévu » et éventuellement infecter d’autres, selon « plusieurs sources » proches du Biden administration. L’article de NBC a été fortement modifié depuis sa publication.

Sur la base des déclarations contenues dans le rapport, Malone a déduit que les niveaux viraux étaient plus élevés chez les personnes vaccinées que chez les personnes non vaccinées. Comme il l’a expliqué plus tard sur Twitter, cela n’a pas été résolu.

Un rapport du CDC publié aujourd’hui a déclaré que les charges virales entre les vaccinés et les non vaccinés sont probablement « similaires« , bien que « des études microbiologiques soient nécessaires pour confirmer ces résultats« .
« C’est précisément ce que l’on verrait si l’amélioration dépendante des anticorps (ADE) se produisait« , a déclaré Malone à propos des niveaux de virus plus élevés chez les vaccinés. “ Qu’est-ce que l’amélioration dépendante des anticorps ? En bref, c’est que le vaccin rend le virus plus infectieux qu’il ne le serait en l’absence de vaccination, provoquerait la réplication du virus à des niveaux plus élevés qu’en l’absence d’infection. ” (Voir plus d’explications ADE ici)

« C’est le pire cauchemar du vaccinologue. Cela s’est produit avec le virus respiratoire syncytial
, et dans les années 60, il a causé plus de décès d’enfants chez les vaccinés que chez les non vaccinés. C’est arrivé avec Dengvaxia, le vaccin contre la dengue
 », a poursuivi Malone.

« Et c’est arrivé avec pratiquement tous les autres programmes de développement de vaccins contre les coronavirus, certainement chez l’homme, connus dans l’histoire, et c’est ce contre quoi les vaccinologues comme moi ont mis en garde depuis le début, c’est le risque d’amélioration dépendante des anticorps. »

Malone a déclaré que l’amélioration dépendante des anticorps semble plus apparente chez les personnes injectées avec le vaccin de Pfizer. « Donc, nous savons maintenant que la protection Pfizer diminue au bout de six mois », a-t-il déclaré. « Et ce que les données semblent suggérer, ce sont ceux qui ont reçu Pfizer, qui est probablement le moins immunogènes des trois en termes de durabilité, de durée de protection, les personnes qui sont maintenant dans la phase décroissante de la réponse immunitaire du vaccin Pfizer semblent être infectés. ”
« Remarquez qu’ils n’arrêtent pas de parler de Pfizer et pas des deux autres. Donc, cela suggère que c’est exactement ce que vous attendez, c’est que la fenêtre de plus grande sensibilité à l’amélioration dépendante des anticorps se situe dans cette longue phase de diminution à mesure que la réponse vaccinale diminue. »

Le meilleur expert en vaccins à ARNm a également critiqué le Dr Anthony Fauci, qui a déclaré lors d’une apparition sur MSNBC cette semaine que les niveaux de virus dans le nez des personnes vaccinées qui contractent COVID-19 sont “exactement les mêmes que le niveau de virus chez une personne non vaccinée qui est infectée. ”
« Et je pense que le Dr Fauci est très malhonnête« , a déclaré Malone. “ On m’accuse d’être désormais un anti-vaccin et de promouvoir la désinformation. Mais à mes yeux, le gouvernement obscurcit ce qui se passe ici. ”
«Et je ne veux pas paraître alarmiste, mais ce qui semble se dérouler est le pire des cas, où le vaccin en phase décroissante provoque la réplication du virus plus efficacement qu’il ne le ferait autrement, c’est ce que nous appelons amélioration dépendante des anticorps est ce que le mot est. Et les gens ont mis en garde à ce sujet depuis le début de cette campagne de vaccination précipitée. »

Le Dr Malone a également critiqué Fauci, qui a récemment blâmé les personnes non vaccinées pour les variantes, pour un «ensemble de déclarations trompeuses» sur les mutations. Malone a déclaré que « les mutants d’évasion qui échappent à la pression sélective du vaccin se développent très probablement chez les personnes qui ont été vaccinées, pas chez les non vaccinés ». « C’est donc juste un autre mensonge pratique« , a-t-il déclaré, ajoutant que « l’amélioration dépendante des anticorps peut être influencée par des mutants échappés« .
“ Si les données sont cohérentes avec [l’amélioration dépendante des anticorps], nous devons arrêter la campagne de vaccination », a souligné Malone. « Nous devons nous orienter pour accélérer autant que possible les traitements médicamenteux, qui ont été largement bloqués et supprimés au niveau de la FDA, en particulier pour les médicaments connus à réutiliser. »

Vaccin « pensée de groupe »
Commentant la décision de l’administration Biden d’imposer de nouvelles exigences en matière de vaccins COVID-19 pour tous les employés fédéraux, Malone a déclaré qu’il assistait à « l’exemple le plus imagé, à mes yeux, de pensée de groupe que j’aie jamais vu dans ma vie« .

«Je pense qu’ils sont tous dans la logique selon laquelle nous avons besoin d’une vaccination universelle pour ouvrir l’économie. Nous ne le pensons pas », a-t-il déclaré. « Ils pensent que les vaccins sont la voie pour parvenir à l’immunité collective. C’est faux. »
« Et ils pensent que les vaccins sont parfaitement sûrs. Or, non seulement ils ne sont pas parfaitement sûrs, si cela est vrai, que NBC rapporte, et les niveaux sont plus élevés chez les vaccinés que chez les non vaccinés, cela signifie que nous avons le pire type d’événement indésirable qui effraie les tous les vaccinologues, qui est une amélioration dépendante des anticorps ”
« Ils y sont tous, et ils semblent incapables de traiter ces nouvelles informations, et cela semble provoquer une dissonance cognitive et rendre ces personnes de plus en plus frénétiques et transparentes dans leurs messages chaotiques« , a poursuivi le Dr Malone.

Dans un épisode précédent de Bannon’s War Room la semaine dernière, le Dr Malone a souligné le risque de complications à cause des vaccins COVID-19, soulignant « des preuves assez claires que la protéine de pointe exprimée à partir des vaccins est causée par la toxicité chez un petit sous-ensemble de patients ».
 La question est de savoir quelle est la taille de ce sous-ensemble et quelle est la gravité et l’étendue de ces toxicités ? La vérité honnête est que nous ne savons pas, et de plus il y a beaucoup de signes que cette information nous est cachée. 

De multiples sources lui ont dit que le CDC avait « largement sous-déclaré » les effets secondaires indésirables tels que la cardiotoxicité. « Mes collègues seniors de la FDA savent que c’est le cas depuis des mois et sont très frustrés« , a déclaré Malone. « Nous avons plusieurs exemples où le CDC semble modifier des données à l’appui du » noble mensonge « . « 

Des centaines de milliers de complications après la vaccination contre le coronavirus ont été signalées par les autorités fédérales, dont plus de 6300 décès, bien que des recherches aient montré que le système de suivi des blessures vaccinales (effets secondaires) dirigé par le CDC et la FDA sous-estimait considérablement les événements indésirables.
Des experts, comme le Dr Peter McCullough, cardiologue de renom et rédacteur en chef de deux revues médicales, ont estimé que le nombre total de décès attribuables aux vaccins pourrait être supérieur à 50.000.

Source : mRNA Vaccine Inventor: COVID-19 Vaccines May Make Virus More Dangerous


Bill Gates bailleur de fonds de la MHRA et détient des actions majoritaires dans Pfizer et BioNTech

 

 

Une enquête a révélé que la Fondation Bill & Melinda Gates est le principal bailleur de fonds de l’Agence britannique de réglementation des produits médicaux et de santé (Medicine & Healthcare products Regulatory Agency ) MHRA et que la Fondation détient également des actions importantes dans Pfizer et BioNTech. Est-il étonnant que la MHRA ait recommandé le vaccin Pfizer pour les enfants ?

Il parait que Macron possèderait aussi des actions Pfizer, mais je n’ai pas trouvé de confirmation sérieuse. Je reste ouvert aux suggestions des lecteurs.

La MHRA a prolongé l’autorisation d’urgence du jab ARNm Pfizer / BioNTech au Royaume-Uni pour permettre son administration aux enfants âgés de 12 à 15 ans le 4 juin 2021.

À l’époque, le directeur général de la MHRA, le Dr June Raine, a déclaré que la MHRA avait “ examiné attentivement les données d’essais cliniques chez les enfants âgés de 12 à 15 ans et avait conclu que le vaccin Pfizer est sûr et efficace dans ce groupe d’âge et que le les avantages l’emportent sur les risques. »
Nous nous demandons si le Dr June Raine et la MHRA ont même lu les résultats 

de l’étude extrêmement courte. S’ils l’avaient fait, ils auraient vu que 86% des enfants de l’étude ont subi une réaction indésirable allant de légère à extrêmement grave.
Seuls 1.127 enfants ont participé à l’essai, mais seulement 1.097 enfants ont terminé l’essai, dont 30 n’ont pas participé après avoir reçu la première dose du vaccin Pfizer. Les résultats n’indiquent pas pourquoi les 30 enfants n’ont pas terminé l’essai.
L’information est accessible au public et contenue dans une fiche d’information de la FDA qui peut être consultée ici (voir page 25, tableau 5 à la salle).
Il ne faisait aucun doute que la MHRA autoriserait d’urgence le vaccin Pfizer / BioNTech à utiliser chez les enfants si l’on considère qu’un certain M. Bill Gates détient des actions à la fois dans Pfizer et BioNTech et qu’il est le principal bailleur de fonds de la MHRA.
La Fondation Bill & Melinda Gates a acheté des actions de Pfizer en 2002, et en septembre 2020, Bill Gates a veillé à ce que la valeur de ces actions augmente en annonçant aux médias grand public dans une interview à CNBC qu’il considérait le jab de Pfizer comme le leader dans la course au vaccin contre le Covid-19.
« Le seul vaccin qui, si tout se passait parfaitement, pourrait demander la licence d’utilisation d’urgence d’ici la fin octobre, serait Pfizer. »
La Fondation Bill & Melinda Gates a également acheté « par coïncidence » pour 55 millions de dollars d’actions de BioNTech en septembre 2019, juste avant que la prétendue pandémie de Covid 19 ne frappe.

La MHRA a reçu une subvention de la Fondation Bill & Melinda Gates en 2017 à hauteur de 980.000 £ pour une « collaboration » avec la fondation. Cependant, une demande d’accès à l’information à laquelle a répondu la MHRA en mai 2021, a révélé que le niveau actuel des subventions reçues de la Fondation Gates s’élève à 3 millions de dollars et couvre « un certain nombre de projets ».
Peut-on vraiment faire confiance à la MHRA pour rester impartiale alors que son principal bailleur de fonds est la Fondation Bill & Melinda Gates, qui détient également des parts dans Pfizer et BioNTech ? Nous ne le pensons pas.
Mais ce n’est pas seulement à la MHRA de décider si oui ou non les enfants doivent recevoir le vaccin Pfizer / BioNTech. Cette décision revient finalement au gouvernement, mais il s’appuie sur les conseils donnés par le Comité conjoint sur la vaccination et l’immunisation (JCVI).
Le JCVI est un groupe indépendant d’experts qui conseillent les services de santé gouvernementaux des quatre pays du Royaume-Uni sur la vaccination et la prévention des maladies infectieuses. Ils examinent l’innocuité et l’efficacité des vaccins et examinent l’impact et la rentabilité des stratégies de vaccination.
Malheureusement, le JCVI a décidé d’émettre l’avis suivant sur l’utilisation du vaccin Pfizer Covid-19 chez les enfants le 19 juillet 2021 –
« À partir d’aujourd’hui, le JCVI propose, pour les enfants à risque de maladie grave COVID-19, le vaccin BioNTech Pfizer.
Cela comprend les enfants âgés de 12 à 15 ans atteints de troubles neurologiques graves, du syndrome de Down, d’immunosuppression et de troubles d’apprentissage multiples ou graves.
Le JCVI recommande également que les enfants et les jeunes de 12 à 17 ans vivant avec une personne immunodéprimée d’offrir le vaccin. Il s’agit de protéger indirectement leurs contacts familiaux immunodéprimés, qui présentent un risque élevé de maladie grave du COVID-19 et peuvent ne pas générer une réponse immunitaire complète à la vaccination.
 »

Mais heureusement, un groupe de médecins, de scientifiques et d’avocats se préparent à poursuivre la MHRA en justice pour faire annuler la décision de donner la piqouze Pfizer / BioNTech aux enfants.
La Covid-19 Assembly est une organisation à but non lucratif basée au Royaume-Uni qui s’efforce de mettre fin à toutes les restrictions liées au coronavirus et d’empêcher qu’elles ne se reproduisent. Ils ont réuni un groupe de médecins et de scientifiques experts de classe mondiale, dont le Dr Roger Hopkinson, le Dr Robert Malone, le Dr Tess Lawrie, le Dr Ross Jones et bien d’autres.
Au nom des nombreux parents extrêmement inquiets, l’Assemblée Covid-19 intente une action en justice pour contester la décision de la MHRA d’approuver le vaccin Pfizer / BioNtech pour une utilisation chez les 12-15 ans.
Le groupe déclare avoir des preuves substantielles qui établissent clairement qu’il n’y a aucune justification légale, morale ou médicale pour que les enfants reçoivent un vaccin contre le 19-Covid. Arguant que le « vaccin » est nouveau et comporte des risques associés.
Ils déclarent également que le vaccin Pfizer n’a pas encore terminé les essais cliniques pour démontrer l’efficacité au-delà de quelques mois, donc il n’y a pas de données de sécurité à long terme pour justifier l’approbation de la MHRA.
Une déclaration publiée par l’assemblée de Covid-19 a déclaré qu’ils « croient fermement qu’il est contraire à l’éthique et inutile que ce traitement soit largement utilisé par les moins de 18 ans, et il y a des centaines de médecins et de scientifiques seniors qui sont d’accord avec nous, dont plus de 60 ont mis leurs noms dans une lettre ouverte à la MHRA des semaines avant l’autorisation. »
« Il y a maintenant eu plusieurs rapports d’issues graves et mortelles chez les moins de 18 ans soupçonnées d’avoir été causées par le vaccin Pfizer aux États-Unis.
« En contestant l’autorisation d’utilisation chez les 12-15 ans, notre espoir est d’éviter que des enfants souffrent inutilement. En cas de succès, nous prévoyons que nous aurons sauvé la santé et la vie de nombreux enfants et le chagrin de leurs familles. »

Bev Turner

Bev Turner, un diffuseur de télévision grand public, a exhorté à plusieurs reprises à la prudence dans les médias grand public quant à l’utilisation des vaccins expérimentaux Covid-19, et est désormais porte-parole de l’assemblée 19-Covid. Elle a réalisé la vidéo suivante faisant connaître la décision de l’Assemblée Covid-19 d’intenter une action en justice contre la décision de la MHRA d’autoriser  l’administration d’urgence du vaccin Pfizer / BioNTech aux enfants.

Source : Bill Gates is the primary funder of the MHRA & owns major shares in both Pfizer & BioNTech – Is there any wonder the MHRA authorised the jab for use in children?

By Daily Expose on


SUPPORTEZ VOTRE SITE WEB FAVORI EN VISITANT SA BOUTIQUE EN LIGNE:

Sur ce lien: Vintage par Michel