Réécrire l’histoire:devant la découverte de Glozel,les scientifiques refusent l’idée de la « primhistoire »

Glozel, petit hameau de la montagne Bourbonnaise, est situé sur la commune de Ferrières/Sichon dans l’Allier à une vingtaine de kilomètres au sud-est de Vichy.

Les fouilles débutèrent il y a presque 100 ans.

Le 1er mars 1924, dans le champ Duranthon ( rebaptisé plus tard le champ des morts ), un jeune agriculteur de 17 ans, Emile, et son grand-père, Claude Fradin, font une découverte impossible qui déclenche l’une des plus violentes controverses archéologiques du XXe siècle car elle remet en cause ce que l’on savait sur les origines de l’écriture.

En défrichant un morceau de terrain, l’une des vaches tirant la charrue tombe dans un trou, à l’intérieur duquel Emile trouve des ossements humains. Avec la découverte de ce tombeau, ils pensent avoir mis la main sur un trésor, les premières fouilles se font à coups de pelle et de pioche. Ils trouvent divers objets, des urnes, des vases, des haches et des tablettes gravées. Ils brisent les urnes mais elles ne contiennent que de la terre, déception, le trou est rebouché et l’avoine est semée.

Au cours de l’été, la Société d’Emulation du Bourbonnais se déplace, recueille des échantillons et les envoie au Dr Capitan des Beaux-Arts.
A l’époque, le Dr Capitan, l’abbé Breuil et le conservateur du musée des Eyzies, M. Peyroni, composaient le triumvirat incontournable de la préhistoire.

Émile Fradin nous présente une formidable tablette gravée en 1976.

Entre temps, en 1925, Antonin Morlet, médecin à Vichy, passionné d’archéologie, entend parler de la découverte et se rend sur place avec son épouse. Fasciné par ce qu’il trouve, il obtient le droit de publication sur les objets qui restent la propriété de M. Emile Fradin.

13 mois après avoir reçu les premières pièces, le Dr Capitan se rend sur place. « Vous avez là un gisement merveilleux..« , il demande au Dr Morlet un rapport détaillé.

Mais au lieu d’envoyer son rapport, le Dr Morlet le publie le 23 septembre 1925 sous le titre « Nouvelle station néolithique« . Morlet est convoqué par Capitan, furieux, « …mettez mon nom à la place de celui d’Emile Fradin..« , ( fait rapporté et publié par le chanoine Cote, « Glozel, 30 ans après« , 1959 ; toutes les personnes « baignant » dans le milieu scientifique savent l’importance d’avoir son nom au sein d’une publication ) ; Morlet refuse.
Puis l’abbé Breuil écrit un article en faveur de Glozel mais sans citer le nom du Dr Morlet, qui à son tour s’insurge et accuse l’abbé de vouloir s’approprier la découverte. L’abbé se retournera alors lui aussi contre Glozel.
On est bien loin des argumentations scientifiques !

Les grands pontes de la préhistoire, tout d’abord très favorables à Glozel, pris de court par cette fabuleuse découverte, se retrouvant « hors jeu« , prennent alors position contre Glozel.
D’autant plus qu’à cette même période un éminent épigraphiste, René Dussaud, vient de publier officiellement que l’écriture est née en Phénicie, 1 600 ans av. J.C. ( après la mise à jour du sarcophage du roi Ahiram de Byblos, recouvert d’inscriptions ).
Or le Dr Morlet estime les tablettes gravées à 5 ou 6 000 ans av. J.C..

Les deux découvertes sont contradictoires et cela va déclencher une véritable guerre chez les hommes de science. Les glozeliens et les anti-glozeliens s’affrontent, Glozel devient l’affaire Dreyfus de l’archéologie.

L’artéfact le plus médiatisé depuis les années 1960.

Et dans cette guerre, tous les coups ( bas ) sont permis, lettres anonymes, injures, etc. ; un jour le Dr Morlet surprend même miss Garrod, secrétaire de l’abbé Breuil, en flagrant délit de truquage lors d’une enquête sur place de la Commission des fouilles ( nommée par le Dr. Capitan, impartialité quand tu nous tiens !!! ).
Le Dr Morlet, Emile Fradin sont traînés dans la boue, tout est mis en oeuvre pour les déshonorer, « calomniez, calomniez, il en restera toujours quelque chose« .

Le Président de la Société Préhistorique de France se rend à Glozel, il paye 4 francs pour entrer dans le musée ( mis en place sommairement par Emile Fradin pour satisfaire le nombre croissant de visiteurs, curieux de voir ces fantastiques objets si controversés ), puis il prétend qu’on lui montre des choses fausses. Il porte plainte contre X pour « entreprise pécuniaire pour montrer les produits d’une mystification« .

Le 25 février 1928, la police de Clermond-Ferrand fait une descente pour perquisitionner chez les Fradin ; leur but, trouver l’atelier où Emile fabrique ses objets. Ils brisent les vitrines, certains objets, ils molestent le pauvre Emile et emportent plus de 200 objets, soit disant pour les faire dater mais à l’époque il n’y a aucun moyen pour faire cela.

Le 4 juin 1929, Emile Fradin est inculpé d’escroquerie, le juge d’instruction va le cuisiner pendant les 63 heures de l’interrogatoire.
On veut qu’il avoue avoir fabriqué ces objets, mais ce jeune paysan du Bourbonnais, ignorant tout de la préhistoire, a sa conscience pour lui, il n’a pas fabriqué ces objets surgis de la nuit des temps.

Son courrier est ouvert, il est constamment surveillé par la police qui veut le surprendre en flagrant délit de fabrication et vérifier s’il enterre lui-même les objets.

Finalement, deux ans plus tard, l’inculpation finit par un non-lieu.
Emile Fradin peut enfin profiter de la vie, il se marie et a des enfants.
Le Dr Morlet continue ses fouilles, toujours à ses frais, pendant 16 ans. Il trouvera plus de 3000 objets, jusqu’en 1941 où la loi Carcopino est votée. Il est désormais interdit de fouiller le sol français sans l’autorisation de l’Etat. Ceci met fin au fouilles de Glozel.
Le Dr Morlet meurt en 1966, il ne verra pas la reconnaissance de Glozel.

En 1972, Henri François, ingénieur au Commissariat à l’Energie Atomique, en visite à Glozel, fait des prélèvements et les envoie à 3 laboratoires étrangers pour datation. On utilisera la méthode de datation au carbone 14 pour les os gravés et la thermoluminescence pour les céramiques et la terre cuite.
Pour les trois laboratoires indépendants ,les résultats sont clairs et irréfutables, Glozel est ancien !
Henri François écrira à Emile Fradin :
« …Seuls quelques attardés mal informés pourront encore prétendre que vous êtes un faussaire, les regroupements des mesures faites indépendamment dans chaque laboratoire sont parfaits et indiscutables…« 

Les résultats sont les suivants :

  • les ossements ont entre 15 000 et 17 000 ans,
  • les céramiques ont 5 000 ans,
  • les tablettes gravées ont 2 500 ans.

En 1974, une équipe du Centre de Recherche Nucléaire de Grenoble passe le site au magnétomètre, montrant qu’il existerait encore des objets enfouis.

En 1975, après un congrès d’archéométrie tenu à Oxford, la lumière est enfin faite sur l’authenticité du site. L’Etat reconnaît l’authenticité de Glozel, mais la communauté scientifique continue de douter.

De 1983 à 1990, de nouvelles fouilles sont entreprises, bizarrement, à plusieurs kilomètres du champ des morts, ensuite, aucun résultat n’est publié (?).

Alors pourquoi ?
Je cite M. Remy Chauvin, biologiste, « père spirituel des hérétiques en France » :
« …S’ils ne publient pas c’est qu’ils ont probablement trouvé des choses qui les ennuient, alors pourquoi ?
De quoi a-t-on peur ?
On a peur de contrarier quelques vieux professeurs, on a peur de démolir les théories en cours ?
Mais, est-ce que les théories scientifiques sont des monuments religieux ?
Qu’y a-t-il donc à Glozel qui soit responsable d’une telle levée de boucliers ?
Faisons donc des fouilles méthodiques et raisonnées à l’endroit où Emile Fradin les fit ! …
« 

M. Emile Fradin s’est vu proposé des sommes fabuleuses pour ses découvertes mais il n’a cédé aucun objet. Le 16 juin 1990, il reçut les Palmes Académiques.

En 1995, suite à la diffusion d’une émission télévisée,  le résumé provisoire des recherches précédentes est enfin publié mais ne révèle rien, si ce n’est ce que l’on savait déjà, qu’il y a une grande disparité dans l’âge des objets de Glozel.


Plus de 3000 objets ont été retrouvés, des poteries, des tablettes gravées, des pierres polies, des bijoux en os, des têtes de flèches, des aiguilles, et il ne semble pas que les signes écrits aient été superposés à des gravures animalières antérieures.

Tous les ossements, humains ( n’appartenant pas à des squelettes d’homme moderne ), et d’animaux ( ayant été transformés en outils, bijoux, certains portant des signes d’écriture ), tous, présentent une fossilisation avancée.

Les haches en pierre polie ont leur tranchant trop peu usé et sont donc certainement votives.

Les galets, gravés notamment de splendides rennes, ont soulevé l’admiration des spécialistes en art préhistorique.

Les objets en céramique, idoles, vases mortuaires aux masques étranges dépourvus de bouche et les fameuses tablettes couvertes d’inscriptions toujours inconnues, ont été fabriqués dans un four ovale qui fut tout d’abord pris pour une tombe. 


Même s’il n’y a plus de doute sur l’authenticité du site, Glozel conserve encore de nombreux mystères.

En effet, sans doute à cause de la très forte radioactivité naturelle de la région, les datations sont extrêmement disparates, et on a du mal à comprendre et à fortiori à expliquer la présence sur le même lieu, d’objets âgés de 17 000 ans, de 5 000 ans, de 2 500 ans, de 1 500 ans, et même du moyen âge !

Reste également l’énigme de l’écriture que l’on retrouve sur des os gravés de 17 000 ans, toujours non déchiffrée…
Elle présente de grandes ressemblances avec :

  • des formes très anciennes de l’écriture phénicienne.
  • Mais aussi avec un certain nombre d’inscriptions alphabétiformes retrouvées dans des sites magdaléniens, au Portugal, en Roumanie et en France.

Glozel serait peut-être un ancien lieu de culte, magique, où auraient été regroupés des objets de diverses provenances ? …

On ne pourra lever le voile du mystère que si l’on étudie sérieusement et systématiquement ce site exceptionnel.


 

UNE INVITATION À VISITER NOS BOUTIQUES EN LIGNE

Passez une bonne journée,mes ami(e)s!

 

 

 

 

 

 

Nos animaux domestiques en fin de vie…ont besoin de nous

Même si c’est dur, c’est important
 » Il s’avère que les animaux de compagnie ont aussi des dernières volontés avant de m.o.u.r.i.r, mais seulement connues des vétérinaires qui endorment les animaux vieux et malades. Un utilisateur de Twitter, Jesse Dietrich, a demandé à un vétérinaire quelle était la partie la plus difficile de son travail.
Le spécialiste a répondu sans hésiter que le plus dur pour lui était de voir comment les animaux vieux ou malades cherchent leurs propriétaires du regard avant de s’endormir. Le fait est que 90 % des propriétaires ne veulent pas se trouver dans une pièce avec un animal m.o.u.r.a.n.t. Les gens partent pour ne pas voir leur animal partir. Mais ils ne réalisent pas que c’est dans ces derniers moments de la vie que leur animal a le plus besoin d’eux.
Les vétérinaires demandent aux propriétaires d’être proches des animaux jusqu’à la toute fin. ′′Il est inévitable qu’ils m.e.u.r.e.n.t avant vous. N’oubliez pas que vous étiez le centre de leur vie. Peut-être n’étaient-ils qu’une partie de vous. Mais ils sont aussi votre famille. Même si c’est difficile, ne les quittez pas.
Ne les laissez pas m.o.u.r.i.r dans une pièce avec un étranger dans un endroit qu’ils n’aiment pas. Il est très douloureux pour les vétérinaires de voir comment les animaux de compagnie ne retrouvent pas leur propriétaire dans les dernières minutes de leur vie. Ils ne comprennent pas pourquoi leur maître les a quittés. Après tout, ils avaient besoin de la consolation de leur maître.
Les vétérinaires font tout leur possible pour que les animaux n’aient pas si peur, mais ils leur sont totalement étrangers. Ne soyez pas un lâche parce que c’est trop douloureux pour vous. Pensez à l’animal. Endurez cette douleur par égard pour eux. Soyez avec eux jusqu’à la fin. »
Aime Les Animaux ❤️

Lorsqu’un animal est en fin de vie, en dehors des modifications physiologiques et physiques, on observe des changements comportementaux particuliers. Cela veut-il dire que l’animal a conscience que sa vie arrive à son terme ?

De nombreux récits évoquent des comportements spécifiques d’un animal envers un proche décédé, que ce soit une mère envers son petit mort-né, ou un adulte envers son compagnon de vie. Des femelles dauphins (ou orques) ont ainsi été observées tentant de maintenir à la surface leur petit mort-né, comme pour lui permettre de respirer. Tout comme des femelles capucins attaquées par un prédateur peuvent essayer une « réanimation » sur leur petit tout juste tué. Dans ces deux cas, les mères s’occupent de leur petit un moment avec beaucoup de ténacité. Puis, après avoir réalisé que le jeune est sans vie, elles l’abandonnent.

UNE ATTITUDE PROTECTRICE ENVERS L’INDIVIDU MORT

Chez les éléphants, des réactions particulières envers les individus décédés durant les déplacements du groupe peuvent aussi exister. Les membres de la famille se postent alors plus ou moins longtemps -devant la dépouille, la flairent avec leur trompe, la touchent délicatement avec leurs pieds, affichant les signes d’un désarroi… Parfois, un membre s’attarde plus longtemps mais, en se tenant à l’écart, il risque de se mettre en danger. Il -finit donc généralement par reprendre la route et rejoindre ses congénères…

Une attitude protectrice envers l’individu mort, contre des con-génères, a aussi été rapportée chez certaines espèces. L’animal peut se poster à côté de son compagnon décédé et ne plus bouger. Des phases de deuil ont été observées chez le chimpanzé. Tous ces exemples témoignent que l’animal adopte des attitudes spécifiques lorsqu’un congénère décède, et qu’il ressent de l’émotion. L’animal se rend compte de la « disparition » de l’autre, la tristesse est présente, mais il n’est pas possible de conclure qu’il comprend l’irréversibilité de la situation.

Que ce soit un animal âgé, ou jeune mais malade ou accidenté, des signes annonciateurs du déclin et de la mort sont visibles.

Chez nos animaux de compagnie, des changements comportementaux sont également décrits lors de la perte de l’ami chien ou chat : baisse d’appétit, refus de sortie ou de jeu, attitude prostrée… Ces observations de terrain ont fait l’objet d’études scientifiques qui montrent les mêmes résultats. Cependant, il est évident que notre propre changement d’attitude face à la perte de l’un de nos compagnons, canin ou félin, affecte probablement l’animal qui est toujours là. Il est donc difficile de connaître avec exactitude l’élément déclencheur des variations comportementales.

L’animal est programmé génétiquement pour se prémunir contre un danger, contre la mort grâce à des stratégies de survie et de défense. Il met tout en œuvre pour vivre : trouver de l’eau et de la nourriture, se mettre à l’abri des intempéries et des prédateurs, se soigner des maladies et des blessures, etc. Cependant, l’animal non humain ne se rend pas compte de la durée de sa vie, il vit au jour le jour sans se projeter vers l’avenir. A ce jour, aucune étude scientifique n’a permis d’établir qu’il puisse avoir une quelconque conscience que sa vie est limitée dans le temps. L’homme semble être la seule espèce à pouvoir intégrer cette notion abstraite et donc à anticiper la fin de vie « naturelle ».

Pourtant, à l’approche de la fin de sa vie, des changements physiologiques et physiques se mettent en place ; des modifications que l’animal ressent sans aucun doute. Pour un individu en bonne santé, cela se fait progressivement, au fil des années. Pour l’animal malade, les alterations de son état peuvent aller beaucoup plus rapidement. Nombre de propriétaires de chien et de chat relatent des comportements singuliers de leur animal lors de cette période, comme s’il se rendait compte de l’évolution de son état.

UNE FORME DE COMPRÉHENSION DE LA SITUATION

Dans le cas de l’euthanasie, certains vétérinaires témoignent de l’attitude particulière et du regard du chien ou du chat qu’ils doivent aider à mourir, « comme s’il savait ». Il est possible que, dans ce cas-là, il y ait bien une forme de compréhension de la situation.

Que ce soit un animal âgé, ou jeune mais malade ou accidenté, des signes annonciateurs du déclin et de la mort sont visibles. Les premiers indices seront de la faiblesse, une perte d’énergie importante. Puis la perte d’appétit va suivre. L’animal peut également rencontrer des difficultés à contrôler ses sphincters et peut s’oublier dans son sommeil ou lorsqu’il se déplace. Sa respiration peut se modifier. Son regard et sa manière de se comporter varieront également. Le chat peut se mettre à ronronner quelques jours ou quelques heures avant son décès. Certains individus chercheront à se mettre à l’écart, voire à partir de chez eux, alors que d’autres rechercheront la présence d’un copain animal ou d’un humain dont ils sont proches.

Euthanasie : Ce vétérinaire révèle ce que ressent votre animal avant de  mourir, ne le laissez JAMAIS

Parfois, notre compagnon décédera dans son sommeil, mais parfois, il faut l’aider. La décision est toujours très difficile à prendre car nombre de personnes ne se sentent pas en droit de décider du moment où l’animal doit quitter ce monde ou ne veulent pas s’y résigner. Une discussion peut alors s’engager avec le vétérinaire référent qui sera à même de juger de la situation. L’animal s’intéresse-t-il toujours à sa nourriture ? Est-ce qu’il réagit quand on l’appelle ? Peut-il se déplacer ? Souffre-t-il ?

Finalement, c’est à nous, compagnon humain, de prendre la décision après nous être posé ce type de questions, y avoir réfléchi et en avoir parlé en famille. Chaque personne réagira différemment lors du deuil. Il est important de se faire accompagner en cas de difficultés.

RÉALISENT-ILS QUE LEUR CONGÉNÈRE EST MORT ?

En 2016, 153 praticiens de Caroline du Sud avaient été interrogés sur leurs observations relevées sur un animal lors de l’euthanasie d’un congénère. 54 % d’entre eux observaient « rarement, de temps en temps, souvent ou toujours » des réactions chez les animaux se trouvant proches de l’animal euthanasié, notamment des chiens qui exprimaient soit un silence soudain soit, au contraire, aboiements et agitation.
Les raisons avancées par les vétérinaires pour expliquer ces réponses sont variées : certains évoquent des modifications chimiques du corps lors de la mort, d’autres se disent persuadés que l’animal « se rend compte » du décès de son congénère, quelques autres évoquent une perception de l’émotion des humains présents au moment de l’euthanasie. 
Pour Antoine Bouvresse, docteur vétérinaire à Rueil-Malmaison, « c’est loin d’être choquant d’imaginer qu’une partie des animaux puisse avoir une réaction à l’euthanasie
d’un congénère 
». S’il ne souhaite pas la présence du compagnon de l’animal
à euthanasier, quand cela se produit, Antoine Bouvresse a été témoin de réactions que l’on peut expliquer par la mort de l’animal. « Un chien 
peut avoir deux types d’attitude : soit vouloir explorer, sentir le corps inanimé de son compagnon, soit adopter des comportements dirigés vers son maître comme pousser la main de son museau, aboyer ou gémir. » Mais, pour le scientifique qu’il est, ce type de réaction est difficile à interpréter comme étant la conscience de la mort de l’animal. Dans de nombreuses situations, le propriétaire se rend compte que l’animal sent la mort arriver. A nous de l’accompagner le mieux possible dans cette ultime étape de sa vie, dans le plus grand respect.



UNE INVITATION À VISITER NOS BOUTIQUES EN LIGNE

Passez une bonne journée,mes ami(e)s!

La Criminelle Arnaque du COVID-19:Les vaccins anti-Covid enfin reconnus dangereux !

La télévision Fox News vient de le révéler aux Américains. Or, Jean-Marc Sabatier ne cesse de le répéter : la multiplication des doses de vaccins affaiblit l’immunité naturelle.

 

 

 

 

 

 

 

 

La vérité a parfois du mal à s’imposer, surtout si elle dérange les consciences, si elle touche de gros intérêts financiers, si elle remet en cause le dogme. Toutes les vérités, même scientifiques, ne sont pas bonnes à dire. Rappelons-nous Galilée. Pour avoir affirmé que la terre était ronde, le mathématicien a failli connaître les tourments du bûcher.
Il en va ainsi des vaccins anti-Covid censés sauver l’humanité d’une pandémie dévastatrice. Administrés massivement et sous contrainte, ils n’ont empêché ni l’infection, ni la réinfection et encore moins la transmission du virus. Pire : la multiplication des doses s’est révélée être plus dangereuse que bénéfique en raison des effets secondaires nombreux et, parfois, très graves, qu’elles engendrent.

« Un facteur de risque majeur »

Un article du Lancet publié en février 2022 sur la population suédoise constatait « une diminution progressive de l’efficacité du vaccin contre l’infection par le SRAS-CoV-2 ». Au mois de juin, un médecin japonais, Kenji Yamamoto, publiait un article intitulé « Effets indésirables des vaccins et mesures pour les prévenir ».
Reprenant les éléments du Lancet, il écrit : « L’étude a montré que la fonction immunitaire des personnes vaccinées 8 mois après l’administration de deux doses de vaccin Covid-19 était inférieure à celle des personnes non vaccinées. Selon les recommandations de l’Agence européenne des médicaments, des injections de rappel fréquentes de la Covid-19 pourraient avoir un effet négatif sur la réponse immunitaire et ne sont peut-être pas réalisables. (…) Par mesure de sécurité, les nouvelles vaccinations de rappel doivent être interrompues. (…) En conclusion, la vaccination COVID-19 est un facteur de risque majeur pour les infections chez les patients en état critique. »

Un lien de causalité

D’autres scientifiques ont plus récemment alerté sur les dangers de la vaccination répétée. Stephanie Seneff, Greg Nigh, Anthony Kyriaakopoulos et Peter McCullough ont publié un article intitulé « Suppression de l’immunité innée par les vaccinations à l’ARNm du SRAS-CoV-2 : Le rôle des quadruplexes G, des exosomes et des micro-ARN. »

Dans cet article, les scientifiques présentent « des preuves que la vaccination induit une altération profonde de la signalisation de l’interféron de type I, qui a diverses conséquences néfastes sur la santé humaine. Les cellules immunitaires qui ont absorbé les nanoparticules du vaccin libèrent dans la circulation un grand nombre d’exosomes contenant une protéine de pointe ainsi que des microARN critiques qui induisent une réponse de signalisation dans les cellules réceptrices à distance… Ces perturbations ont potentiellement un lien de causalité avec les maladies neurodégénératives, la myocardite, la thrombocytopénie immunitaire, la paralysie de Bell, les maladies du foie, l’immunité adaptative altérée, la réponse altérée aux dommages de l’ADN et la tumorigenèse… Nous pensons qu’une évaluation complète des risques et des avantages des vaccins à ARNm remet en question leur contribution positive à la santé publique. »

Une découverte fondamentale

Jean-Marc sabatier
Jean-Marc sabatier

 

 

 

 

 

 

 

 

 

Si le public américain découvre aujourd’hui à la télévision les effets nocifs des vaccins (voir la vidéo ci-dessous), les lecteurs d’infodujour.fr sont alertés depuis longtemps par les articles de Jean-Marc Sabatier*.
Dès le mois d’avril 2020 le scientifique publiait un article révélant l’atteinte de l’immunité innée induite par le SARS-CoV-2 (via sa protéine Spike) et décrivait le dysfonctionnement du système rénine-angiotensine responsable des maladies Covid-19.
En décembre 2020, dans un article intitulé « Et si le SRA expliquait la Covid-19 ? » nous évoquions alors « l’histoire d’une découverte fondamentale française, celle du Pr Jean-Marc Sabatier, qui pourrait bouleverser la compréhension et le traitement de cette maladie décidément bien mystérieuse. »
Plus récemment, deux articles ont ébranlé les données scientifiques.
Le 29 juin, dans une interview qui a fait du bruit « Covid-19 : les limites de la vaccination » Jean-Marc Sabatier expliquait pourquoi « la vaccination pourrait, elle-même, favoriser l’infection ». En conclusion : « des injections vaccinales répétées d’un même antigène, quel qu’il soit (ici la protéine Spike du SARS-CoV-2), à des niveaux qui dépassent le seuil ‘’critique’’, conduisent inévitablement à un dérèglement de l’immunité innée, et à l’apparition de potentiels troubles auto-immuns. Ainsi, pour les vaccins anti-Covid-19 actuels, il existe au moins trois bonnes raisons scientifiques de ne pas procéder à des injections vaccinales multiples, avec l’action directe et néfaste de la protéine Spike sur le SRA et l’immunité innée, la répétition de ces injections qui dérègle également l’immunité innée de l’hôte et les effets nocifs potentiels de certains adjuvants, dont les nanoparticules lipidiques. »

Un fact checking bidon

Il est vrai qu’un fact checking de l’AFP est venu contredire les propos du scientifique. Un jeune ‘’vérificateur’’ (diplômé en histoire !) s’est cru autorisé à remettre en cause les infos contenues dans cet article.
Jean-Marc Sabatier et infodujour.fr ont donc apporté une réponse circonstanciée le 24 mai 2022 à ce fact checking à la sauce Pfizer.
L’historien-fact checker réfute l’idée selon laquelle le vaccin endommagerait le système immunitaire. Réponse de Jean-Marc Sabatier : « Les vaccins et rappels anti-Covid-19 altèrent (affaiblissent) le système immunitaire de l’hôte, car la protéine spike vaccinale est capable d’agir sur les cellules de l’immunité innée (via les récepteurs AT1R et Toll-like, notamment TLR4 et TLR2) et d’altérer leur fonctionnement.
La protéine Spike (vaccinale ou virale) affecte aussi l’immunité adaptative/acquise. Il existe ainsi une lymphocytopénie induite (liée au syndrome d’activation macrophagique et une hémo-phagocytose associée qui tue des lymphocytes T CD4+ auxiliaires et CD8+ cytotoxiques, les lymphocytes B et les cellules NK tueuses) conduisant à un syndrome d’immunodéficience acquise/induite.
Etudes : 1, 23, 4, 5, 6, etc. »

La vérité est parfois difficile à admettre et longue à s’imposer. Mais elle finit par triompher face à des faits tenaces. L’histoire tourmentée de la Covid-19 et de ses vaccins qui n’en sont pas, resteront dans les annales des mensonges de l’Histoire.

*Jean-Marc Sabatier est directeur de recherches au CNRS et docteur en Biologie Cellulaire et Microbiologie, HDR en Biochimie. Éditeur-en-Chef des revues scientifiques internationales : « Coronaviruses » et « Infectious Disorders – Drug Targets ». Il s’exprime ici en son nom propre.

 

 

 

 

 

 

 

 

 

Comme il s’agit de la Vérité,vous ne pouvez pas  l’écrire sur Facebook…vous serez traité comme un complotiste et perdrez peut-être votre  compte Facebook censuré que vous aimez tant!


UNE INVITATION À VISITER NOS BOUTIQUES EN LIGNE

Passez une bonne journée,mes ami(e)s!

 

 

 

 

 

La Criminelle Arnaque du COVID -19:Voici le Top 7 des « événements indésirables » post-vaccin les plus EFFRAYANTS

Ces « événements indésirables » deviennent de plus en plus courants, même si le complexe industriel du vaccin et les MSM les cachent totalement.

Le CDC et les MSM appellent cela « l’hésitation aux vaccins », mais il s’agit davantage de « la science des vaccins » qui montre que les piqûres de mutation du gène COVID-19 sont expérimentales, dangereuses et inefficaces. Ce n’est pas une « hésitation » si les statistiques révèlent que se faire un caillot est BEAUCOUP plus dangereux pour la majorité de la population que d’attraper le dernier coronavirus. Ce n’est pas une théorie du complot selon laquelle les injections de caillots sont au mieux expérimentales, avec des approbations « d’urgence uniquement » et des essais cliniques frauduleux qui révèlent des effets secondaires et des événements indésirables cauchemardesques.

Ce n’est pas parce que les médias grand public (fake news) ne couvrent pas les faits qu’ils ne se produisent pas tout autour de nous. Si un arbre tombe dans la forêt, mais que vous n’entendez pas ses craquements, cela ne signifie pas qu’il n’est jamais tombé. Lorsque des athlètes, des pilotes et des militaires en parfaite santé tombent morts suite à des caillots sanguins, de myocardite, de crises cardiaques et d’accidents vasculaires cérébraux, quelques jours ou semaines seulement après avoir reçu une injection de thérapie génique COVID-19, il y a de bonnes raisons d’être très inquiets.

Pourquoi donner à un adolescent, un préadolescent ou un enfant un caillot mortel du virus échappé d’un labo alors qu’il n’y a pratiquement aucune chance qu’il meure du COVID ?

Même après que le CDC et la FDA admettent que les adolescents et les enfants courent un très faible risque de contracter ou de mourir de la grippe Fauci, ils continuent de pousser et de propager la vaccination pour tous, à cause de… attendez… les profits astronomiques de la vache à lait et le programme de dépopulation . C’est comme pousser le vaccin contre le VPH (virus du papillome humain), une injection pour une maladie sexuellement transmissible, à des enfants de 9 ans. C’est comme rendre obligatoire le vaccin contre le sida pour chaque terrien.

Nous avons des droits, et l’un d’entre eux est de savoir si des toxines doivent ou non être injectées dans notre sang par des médecins voyous et des scientifiques intrigants qui profitent énormément de leur médicament à la poudre de perlimpinpin. Quelle est la prochaine étape, la chimiothérapie pré-cancéreuse obligatoire pour tous ?

Le complexe industriel des vaccins a déboursé plus de 4 milliards de dollars pour les effets secondaires néfastes et handicapants  et les décès induits par les vaccins au cours des deux dernières décennies, et les injections de COVID-19 sont PLUS MORTELLES que tous les autres vaccins combinés, depuis les années 1960.

Bill Gates, l’empereur des vaccins

Les deux tiers de tous les Américains ont subi un lavage de cerveau par une campagne de propagande basée sur la peur pour obtenir les piqûres COVID

Les jours de la science fondée sur des preuves sont morts en Amérique et en Europe. L’époque des freins et des contrepoids est révolue. Les agences de réglementation regorgent de gourous de Big Pharma qui établissent toutes les règles et tous les mandats en se basant sur la science zéro. Seule la peur pourrait faire que des centaines de millions d’êtres humains se retrouvent coincés avec des injections qui obstruent le sang, inondent les organes et provoquent le «syndrome de la mort subite de l’adulte».

Seule une campagne basée sur la peur pour un virus (dont l’existence n’a JAMAIS été démontrée) qui cause un taux de mortalité très inférieur à 1% pourrait convaincre les deux tiers des Américains de porter un masque antibactérien pendant deux années consécutives.

Seule une escroquerie pourrait prendre autant d’argent des contribuables et le remettre aux corrompus scientifiques, politiciens et crétins de la réglementation qui l’ont financé, conçu et propagé. Avouons-le, il n’y a RIEN de « sûr » ou « d’efficace » dans les vaccins contre la grippe Fauci. Évitez-les comme la peste.

Les 7 « événements indésirables » post-vaccin les plus effrayants de COVID-19 que les MSM et les CDC ne mentionnent jamais par crainte d’une « hésitation à la vaccination »

#1. Tomber mort subitement de « causes inattendues » alias SADS (Sudden Adult Death Syndrome) syndrome de mort subite de l’adulte

#2. Caillots sanguins étranges, longs, caoutchouteux et fibreux (bio-structures)

#3. Myocardite, battements cardiaques irréguliers et crises cardiaques

#4. Le cancer et les tumeurs éclatent à l’improviste

#5. Attraper et/ou mourir du COVID-19 ou de ses variantes

#6. Paralysie des bras, des jambes ou du visage (syndrome “Ramsay Hunt” de Justin Bieber)

#7. Souffrant soudainement de SGB (Guillain-Barre Syndrome), AIDS, ADE, ou VAED

Ajoutez Vaccines.news  à vos sites Web indépendants préférés pour obtenir des mises à jour.

Les sources de cet article incluent : Health.ClevelandClinic.orgTheGatewayPundit.comNaturalNews.com

————————————————————————-

EN COMPLÉMENTAIRE

Rudolf Steiner, un visionnaire qui dérange…

Rudolf Steiner

Rudolf Steiner a connu, jeune, la réalité de ce qu’il nommera plus tard  » le monde suprasensible « . Il cherche à établir la base philosophique de ses connaissances élargies à ce monde.

Il trouve dans l’approche goethéenne un exemple du passage de l’observation de la nature à celle du monde spirituel.
C’est avec la  » Philosophie de la liberté  » qu’il établit en 1894 les fondements de sa recherche.

Ses investigations dans le domaine spirituel ne cesseront de se développer, apportant des connaissances sur la nature de l’homme, (corps, âme, esprit), la réincarnation et le karma (Théosophie, 1904), la cosmogonie et l’histoire de la terre (Science de l’occulte, 1910), la Christologie. Il a favorisé la création artistique (théâtre, architecture, eurythmie).

Steiner donne des conférences dans de nombreuses villes d’Europe jusqu’à la fin de sa vie, et répond aux questions concrètes qui lui sont posées.

Ainsi est lancé en 1919, le mouvement pour la triple articulation sociale (Liberté dans la vie culturelle, Égalité dans les rapports entre les êtres, Fraternité dans la vie économique), et sont donnés, de 1921 à 1924, les cours aux pédagogues (Écoles Steiner / Waldorf), aux médecins (médecine anthroposophique), aux thérapeutes (pédagogie curative) et aux agriculteurs (Agriculture bio-dynamique).

Source : https://www.anthroposophie.fr/

Il y a plus de cent ans, Rudolf Steiner a écrit ce qui suit :

« Dans le futur, on éliminera l’âme par des médicaments.

Sous prétexte d’un « point de vue sain » se trouvera un vaccin par lequel l’organisme humain sera traité, dès que possible, éventuellement directement à la naissance, afin que l’être humain ne puisse développer la pensée de l’existence d’âme et Esprit.

Aux médecins matérialistes sera confiée la tâche d’éliminer l’âme de l’humanité.

Comme aujourd’hui, on vaccine les gens contre cette maladie ou telle maladie, ainsi à l’avenir, on vaccinera les enfants avec une substance qui pourra être produite précisément de telle sorte que les gens, grâce à cette vaccination, seront immunisés d’être soumis à la « folie » de la vie spirituelle.

Il serait extrêmement intelligent mais il ne développerait pas une conscience et c’est le véritable objectif de certains cercles matérialistes.

Avec un tel vaccin, vous pouvez facilement faire en sorte que le corps éthérique se détache dans le corps physique.

Une fois le corps éthérique détaché, la relation entre l’univers et le corps éthérique deviendrait extrêmement instable et l’homme deviendrait un automate, car le corps physique de l’homme doit être poli sur cette Terre par une volonté spirituelle.

Alors le vaccin devient une sorte de force arymanique ; l’homme ne peut plus se débarrasser d’un sentiment matérialiste donné. Il devient matérialiste de constitution et ne peut plus s’élever au spirituel. »

Rudolf Steiner (1861-1925) dans « La chute des esprits des ténèbres » aux éditions Triades.
Le passage cité est à la fin de la page 79 et au début de la page 80 – cinquième conférence, du 7 octobre 1917. Un autre passage sur le même thème (les vaccins) se trouve à la page 188 – treizième conférence, du 27 octobre 1917.

 

 

 

 

 

 

 

 


 

UNE INVITATION À VISITER NOS BOUTIQUES EN LIGNE

Passez une bonne journée,mes ami(e)s!

 

 

 

 

Remise en question:notre vrai dieu n’a jamais été la religion.!!

En 325, au concile de Nicée, Constantin le Grand, créa l’église catholique après un génocide de 45 000 chrétiens, où il les tortura pour renoncer à la réincarnation. En même temps, des livres religieux de tous les villages de l’empire sont collectés et créent ainsi la BIBLE.
En 327, Constantin, connu sous le nom d’empereur de Rome, ordonne à Jérôme de traduire la version Vulgate en latin, changeant les noms hébreux et adultères qui s’appelèrent les Écritures.
En 431, le culte de la VIERGE a été inventé.
En 594, le PURGATOIRE a été inventé.
En 610, le titre de PAPE a été inventé.
En 788 le culte a été imposé aux journaux intimes païens.
En 995 la signification de kadosh (section) a été changée pour le tître de saint.
En 1079, le célibat des prêtres est imposé .
En 1090 le Rosaire est imposé.
En 1184, l’Inquisition a été perpétrée.
Dans les années 1190, les indulgences étaient vendues.
En 1215, la confession a été imposée aux prêtres.
Innocent III, le pape absolu
Innocent III
En 1216, le conte du pape Innocent sur la terreur du pain (un dieu de la mythologie grecque), qui devient chair humaine, a été inventé.
En 1311 le baptême est imposé.
En 1439, le PURGATOIRE inexistant a été dogmatisé.
En 1854, l’immaculée conception a été inventée.
En 1870, l’absurdité d’un pape infaillible s’impose, dans laquelle le concept de recrutement est inventé.
Il y a plus de 2500 choses inventées par cette religion pour asservir les êtres humains avec le christianisme..
Les religions et leurs dieux ont été créés comme un moyen de MANIPULATION et d’AFFAIRE. Dans le cadre de l’ÉVOLUTION de l’être humain est la LIBÉRATION de ces moyens de manipulation. Même si petit à petit l’humanité est à l’ère du RÉVEIL, les jeunes tous les jours sont moins religieux deux générations de plus et la religion catholique sera dans son crépuscule. (Je veux voir ce moment)
Tout fera partie de notre ÉVOLUTION.
C’est à vous de continuer à croire ce que vous croyez maintenant être la vérité absolue parce que vous ne vous êtes pas remis en question……
Donc  remets-toi en question et tu verras que toutes les religions sont une invention…. de l’homme.
Ce qu’il faut croire:c’est aux message d’amour,de paix et la philosophie de vie de Jésus Christ,de Mahomet et de Bouddha!
L’histoire humaine ne fait que commencer!

EN COMPLÉMENTAIRE

1215 INNOCENT III ET LE CONCILE DE LATRAN IV
Le pape Innocent III (1198-1216) réunit à Rome en 1215 un concile œcuménique (le quatrième siégeant au Latran) pour instituer une réforme de l’Église et de la société chrétiennes face aux hérétiques, aux musulmans et aux juifs. (Voir « L’antijudaïsme dans l’Europe chrétienne ».)Ce concile œcuménique fréquenté par 404 évêques venus de toute l’Église occidentale et de l’Église orientale de rite latin, un très grand nombre d’abbés, chanoines et représentants du pouvoir civil édicta les mesures sur l’ensemble de l’activité spirituelle et sociale des clercs et des laïcs, notamment sur le célibat et les mœurs des prêtres, l’élection des évêques, la perception des dîmes, le droit canon, le mariage. Le décret 21 rendit obligatoire la confession individuelle. Cette mesure, prise en charge surtout par les nouveaux ordres religieux, dominicains et franciscains, fut assez rapidement respectée par tous, avec ses compléments, l’attachement des fidèles à leurs paroisses et à leurs curés, le respect absolu par les prêtres du secret de la confession.La décision de Latran IV révolutionna les habitudes du clergé (des manuels initièrent les curés à cette nouvelle charge) et de l’ensemble des fidèles : examen de conscience, repentir, pénitence. L’examen de conscience inaugura une sensibilité et des pratiques qu’on peut considérer comme une formation à des attitudes propres à l’héritage occidental : l’introspection
et une technique d’exonération du poids des malaises existentiels .

UNE INVITATION À VISITER NOS BOUTIQUES EN LIGNE

D’énormes « chiens-ours » peuplaient les Pyrénées il y a 12 millions d’années

Une mandibule fossilisée mise au jour dans les Pyrénées-Atlantiques en France appartient à une espèce d’amphicyonidés inconnue à ce jour, affirment des paléontologues associés au Musée d’histoire naturelle de Bâle, en Suisse.

Mieux connus sous le nom de chiens-ours», les amphicyonidés forment une famille éteinte de grands mammifères carnivores. Ces animaux étroitement apparentés aux canidés peuplaient une bonne partie de l’hémisphère Nord.

Apparus à l’éocène (il y a 36 millions d’années) et disparus au miocène moyen (il y a 7,5 millions d’années), ils représentent l’un des groupes de prédateurs les plus caractéristiques de l’ancienne faune européenne.

Tartarocyon cazanavei
Leur masse corporelle variait de 9 à 320 kg et leur régime alimentaire était typiquement mésocarnivore, omnivore, broyeur d’os et hypercarnivore», note le paléontologue Bastien Mennecart dans un communiqué publié par le musée.
La mandibule a été mise au jour dans la petite commune de Sallespisse, dans le département des Pyrénées-Atlantiques, dans le sud-ouest de la France. Elle a été extirpée d’un dépôt marin vieux de 12 à 12,8 millions d’années.
La mandibule a été mise au jour dans un dépôt marin vieux de 12 à 12,8 millions d’années.

Les scientifiques ont été frappés par la dentition de la mâchoire inférieure.

L’équipe a nommé la bête Tartarocyon cazanavei, nom inspiré du personnage de Tartaro, un borgne géant de la mythologie basque.

La masse corporelle d’un Tartarocyon est estimée à 200 kg, ce qui en fait l’un des plus gros prédateurs qui vivaient sur le territoire européen au miocène.

Les découvertes de fossiles de vertébrés terrestres qui vivaient il y a 13 à 11 millions d’années dans le nord des Pyrénées sont très rares, note le communiqué. Cette découverte et la description de la mâchoire inférieure sont d’autant plus importantes. Elles offrent l’occasion de mieux comprendre l’évolution des chiens-ours européens dans le contexte environnemental de l’époque.»

Le détail de ces travaux est publié dans la revue PeerJ (en anglais).

Holotype de Tartarocyon cazanavei de Sallespisse, France, en vues occlusale, linguale et labiale. Barre d’échelle – 5 cm. Crédit image : Sole et al ., doi : 10.7717/peerj.13457.

N’OUBLIEZ PAS DE VISITER NOS BOUTIQUES EN LIGNE QUI SOUTIENNENT NOS SITES WEB EN DÉVELOPPEMENT
Sur ces liens:

La Criminelle Arnaque du COVID-19:Le département de la Défense des États-Unis a attribué un contrat pour la «recherche sur la COVID-19» en Ukraine 3 mois avant même que l’existence la Covid ne soit connue

Le monde a commencé à entendre parler d’un nouveau coronavirus au début de janvier 2020, avec des rapports faisant état d’une nouvelle pneumonie présumée comme une maladie se propageant à Wuhan, en Chine. Cependant, le monde n’a réellement connu la Covid-19 qu’en février 2020, car ce n’est que le 11 de ce mois que l’Organisation mondiale de la santé a officiellement nommé la nouvelle maladie à coronavirus, la Covid-19.

Donc, ceci étant la vérité officielle, pourquoi les données du gouvernement des États-Unis montrent-elles que le département américain de la Défense (DOD) a attribué un contrat le 12 novembre 2019 à Labyrinth Global Health INC. pour la «recherche COVID-19», au moins un mois avant l’émergence présumée du nouveau coronavirus, et trois mois avant qu’il ne soit officiellement surnommé [virus de la] Covid-19 (Coronavirus Desease 2019 ] ?

 

Cependant, les résultats choquants ne s’arrêtent pas là. Le contrat attribué en novembre 2019 pour la «recherche COVID-19» n’était pas seulement chargé de se dérouler en Ukraine, il faisait en fait partie d’un contrat beaucoup plus vaste pour un «programme de réduction des menaces biologiques en Ukraine».

Cela explique peut-être pourquoi Labyrinth Global Health collabore avec l’EcoHealth Alliance de Peter Daszak et Metabiota d’Ernest Wolfe depuis sa création en 2017.

Le gouvernement des États-Unis a un site Web appelé  » USA Spending » , une source officielle de données ouvertes sur les dépenses fédérales. Selon le site, au 12 avril 2021, le gouvernement américain a dépensé un montant époustouflant de 3630 milliards de dollars « en réponse à la COVID-19 ». Mais ce ne sont pas les seules informations sur Covid qui peuvent être trouvées sur le site.

Cachés dans la « recherche d’attribution », se trouvent des détails sur un contrat attribué par le ministère de la Défense à une société nommée  » Black & Veatch Special Projects Corp » , qui serait « une société mondiale d’ingénierie, d’approvisionnement, de conseil et de construction spécialisée dans le développement d’infrastructures ».

Le contrat a été attribué le 20 septembre 2012 et est décrit comme « Services professionnels, scientifiques et techniques ». Évidemment, c’est très vague et très probablement de peu d’intérêt pour quiconque tombe dessus. Mais il y a quelque chose de profond dans les détails qui devrait intéresser tout le monde.

L’« Historique des attributions » du contrat contient un onglet pour les « Sous-attributions » détaillant les bénéficiaires, la date d’action, le montant et une très brève description pour 115 transactions de sous-attribution. La plupart des sous-prix sont extrêmement banals pour des choses telles que « l’équipement de laboratoire pour Kiev » ou « le mobilier de bureau pour Kiev ».

Mais il y a un sous-prix qui se démarque parmi les autres, et il a été décerné à Labyrinth Global Health INC pour « SME Manuscript Documentation and COVID-19 Research ».

Un prix pour la recherche sur la Covid-19 n’est pas vraiment choquant alors que le monde est prétendument en proie à une pandémie de Covid-19, mais compte tenu du fait que le contrat de sous-traitance a été attribué le 12 novembre 2019, au moins un mois avant l’émergence présumée de le nouveau coronavirus, et trois mois avant qu’il ne soit officiellement surnommé Covid-19 [Coronavirus Desease 2019 ], le prix de la recherche sur la Covid-19 devrait être un choc pour tout le monde.

Mais le choc ne s’arrête pas là, car le lieu où le contact pour la recherche sur Covid-19 a été chargé d’avoir lieu était l’Ukraine, tout comme l’ensemble du contrat attribué par le DOD à Black & Veatch Special Projects Corp.

Les détails du contrat trouvés sur le site « USA Spending » révèlent en fait que le département spécifique du DOD qui a attribué le contact était la Defense Threat Reduction Agency (DTRA). Le contrat a été attribué le 20 septembre 2012 et conclu le 13 octobre 2020.

Bien que les détails soient vagues, le site du gouvernement américain révèle également que 21,7 millions de dollars sur les 116,6 millions de dollars de contact ont été dépensés pour un « programme de réduction des menaces biologiques en Ukraine ».

Pourquoi le ministère de la Défense a-t-il payé une entreprise qui est prétendument « une société mondiale d’ingénierie, d’approvisionnement, de conseil et de construction spécialisée dans le développement d’infrastructures », pour l’aider à mettre en œuvre un « programme de réduction des menaces biologiques en Ukraine » ?

Et pourquoi le DOD et ladite société ont-ils ensuite payé Labyrinth Global Health INC pour mener des recherches sur la COVID-19 en Ukraine au moins un mois avant l’émergence présumée du nouveau coronavirus, et trois mois avant qu’il ne soit officiellement surnommé Covid-19 ?

Fondée en 2017, Labyrinth Global Health serait une « petite entreprise détenue par des femmes avec une expertise approfondie et une expérience éprouvée dans le soutien d’initiatives pour le progrès scientifique et médical ».

Elle se décrit comme  » une organisation multiculturelle et internationale avec des bureaux dans quatre pays et une équipe d’experts aux parcours et compétences divers, notamment en microbiologie, virologie, santé mondiale, soins infirmiers en maladies infectieuses émergentes, anthropologie médicale, épidémiologie de terrain, recherche clinique, et les systèmes d’information sur la santé. »

Il se trouve que l’un de ces bureaux se trouve à Kiev, en Ukraine, que la société qualifie de «porte d’entrée vers l’Europe de l’Est».

L’équipe de direction de Labyrinth Global se compose de Karen Saylors, PHD, qui est la directrice générale ; Mary Guttieri, PHS, qui est la directrice scientifique ; et Murat Tartan qui est le directeur financier.

Karen Saylors, PhD, qui a cofondé Labyrinth Global Health, aurait travaillé dans le domaine de la santé publique internationale pendant plus d’une décennie et a passé de nombreuses années à vivre en Afrique pour établir des réseaux de surveillance mondiaux, « travailler avec des partenaires pour améliorer la politique de santé mondiale sur la détection, la réponse et le contrôle des maladies infectieuses ».

Au Labyrinthe, le Dr Saylors se spécialise dans les études qui visent à comprendre et à atténuer le risque biologique et comportemental de transmission de maladies. Le Dr Saylors a travaillé avec le réseau d’essais cliniques de l’Université d’Oxford au Vietnam sur la recherche sur la surveillance des maladies zoonotiques et continue de coordonner avec des partenaires régionaux les épidémies émergentes dans les populations animales et humaines.

Mais avec qui le Dr Karen Saylors et Labyrinth Global Health choisissent-ils de travailler ? Ce ne sont autres que « Eco Health Alliance » et « Metabiota ».

Le Dr Karen Saylors, Eco Health Alliance et Metabiota ont travaillé ensemble sur le programme « PREDICT » de l’Agence des États-Unis pour le développement international (USAID) à partir de 2009, tandis que Labyrinth Global Health a travaillé aux côtés de l’EHA et de Metabiota sur le programme PREDICT à partir de 2017.

Lancé en 2009 et financé par l’USAID, PREDICT était un système d’alerte précoce pour les maladies nouvelles et émergentes dans 21 pays. Il a été dirigé par le Davis One Health Institute de l’Université de Californie («UC») et les principaux partenaires comprenaient EcoHealth Alliance («EHA»), Metabiota, Wildlife Conservation Society et Smithsonian Institution, et comme nous venons de le révéler; Santé globale du labyrinthe. PREDICT a été un précurseur du projet plus ambitieux Global Virome.

L’USAID décrit PREDICT comme ayant apporté  » des contributions significatives au renforcement des capacités mondiales de surveillance et de diagnostic en laboratoire pour les virus connus et nouvellement découverts au sein de plusieurs groupes de virus importants, tels que les filovirus (y compris les virus Ebola), les virus de la grippe, les paramyxovirus et les coronavirus  » .

Voici l’une des nombreuses études publiées par Eco Health Alliance, Metabiota et Labyrinth Global Health prouvant le lien –

PREDICT s’est associé à l’Eco Health Alliance (EHA) à but non lucratif pour mener à bien ses efforts de 9 ans pour cataloguer des centaines de milliers d’échantillons biologiques,  » dont plus de 10 000 chauves-souris  » . Une étude financée par PREDICT en 2015 sur la « diversité des coronavirus chez les chauves-souris » comprenait également Peter Daszak, président de l’EHA, parmi ses participants.

Eco Health Alliance est répertorié comme partenaire de l’Institut de virologie de Wuhan (« WIV ») sur les pages archivées de son site Web et a été mentionné comme l’un des « partenaires stratégiques » de l’institut par le directeur général adjoint du WIV en 2018.

Notamment, la relation entre le WIV et l’établissement américain de biodéfense a été avancée par le conseiller politique de l’EHA, David R. Franz, ancien commandant du laboratoire américain d’armes biologiques à Fort Detrick.

Le Dr Shi Zhengli de WIV, alias « Batwoman », avait également travaillé avec Daszak de l’EHA sur des études liées aux chauves-souris. Dès 2005, Daszak et Zhengli menaient des recherches sur les coronavirus de type SRAS chez les chauves-souris. Plusieurs études financées par PREDICT sur les coronavirus de type SRAS et la grippe porcine comptent à la fois sur les contributions de Zhengli et de Daszak. La plus remarquable d’entre elles est peut-être une étude financée par PREDICT et NIH en 2015, qu’elle a co-écrite et intitulée : « Un groupe de coronavirus circulants de chauve-souris de type SRAS montre un potentiel d’émergence humaine ».

Pendant ce temps, Nathan Wolfe est le fondateur de Metabiota et de l’organisation à but non lucratif Global Viral. Il a passé plus de huit ans à mener des recherches biomédicales en Afrique subsaharienne et en Asie du Sud-Est. Sans surprise, le juif Wolfe est un  leader mondial du Forum économique mondial. Plus particulièrement, depuis 2008, il était membre du DSRC (Defense Science Research Council) de la DARPAjusqu’à sa dissolution.

Toutes ces personnes et organisations travaillent depuis au moins la dernière décennie à étudier les coronavirus et à aider à mettre en place des Biolabs en Ukraine. Tous utilisent des fonds du département américain de la Défense pour le faire. Vous pouvez en savoir plus à ce sujet iciici et ici.

Laissant de côté pour l’instant les biolabs en Ukraine, revenons au sujet de la Covid-19. Si le gouvernement américain finançait la recherche sur la Covid-19 avant que l’existence de la Covid-19 ne soit connue du public, cela suggère qu’ils savaient soit que la Covid-19 existait naturellement, soit qu’ils étaient impliqués dans la construction de ce virus dans un laboratoire.

Mais si les preuves contractuelles ne suffisent pas pour que vous parveniez à cette conclusion (ce devrait être le cas), alors associez-les peut-être à des preuves que l’Institut national américain des allergies et des maladies infectieuses (NIAID) et Moderna avaient un candidat coronavirus dans Décembre 2019 le sera.

Un accord confidentiel qui peut être consulté ici, stipule que les fournisseurs « Moderna » aux côtés de « l’Institut national des allergies et des maladies infectieuses » (NIAID) ont accepté de transférer les « candidats vaccins contre le coronavirus à ARNm » développés et détenus conjointement par le NIAID et Moderna aux destinataires. L’Université de Caroline du Nord à Chapel Hill’ le 12 décembre 2019.

L’accord a également été signé par deux représentants du NIAID, dont Amy F. Petrik PhD, spécialiste du transfert de technologie qui a signé l’accord le 12 décembre 2019 à 8h05. L’autre signataire était Barney Graham MD PhD, chercheur pour le NIAID, mais cette signature n’était pas datée.

Les derniers signataires de l’accord étaient Sunny Himansu, enquêteur de Moderna, et Shaun Ryan, conseiller général adjoint de Moderna. Les deux signatures ont été faites le 17 décembre 2019.

Toutes ces signatures ont été faites avant toute connaissance de l’émergence présumée du nouveau coronavirus. Ce n’est que le 31 décembre 2019 que l’Organisation mondiale de la santé (OMS) a pris connaissance d’un groupe présumé de cas de pneumonie virale à Wuhan, en Chine. Mais même à ce stade, ils n’avaient pas déterminé qu’un nouveau coronavirus présumé était à blâmer, déclarant plutôt que la pneumonie était de « cause inconnue ».

Tout cela nécessite des recherches beaucoup plus poussées pour assembler toutes les pièces du puzzle, mais voici ce que nous savons définitivement jusqu’à présent :

    Un nouveau coronavirus est apparu à Wuhan en décembre 2019.

    Le monde n’a entendu parler de ce nouveau coronavirus que début janvier 2020.

    Le monde ne savait pas que ce nouveau coronavirus s’appelait  Covid-19 jusqu’en février 2020, lorsque l’Organisation mondiale de la santé l’a officiellement nommé ainsi.

    Le département américain de la Défense a attribué un contrat de services professionnels, scientifiques et techniques à Black & Veatch Special Projects Corp‘, qui serait « une société mondiale d’ingénierie, d’approvisionnement, de conseil et de construction spécialisée dans le développement d’infrastructures ».

    Ce contrat concernait un programme de réduction des menaces biologiques en Ukraine.

    Dans le cadre de ce contrat plus important, un autre contrat a été attribué à Labyrinth Global Health pour la «recherche COVID-19» le 12 novembre 2019.

    Ce prix a été décerné au moins un mois avant l’émergence présumée du nouveau coronavirus et trois mois avant qu’il ne soit officiellement surnommé [virus de la maladie – MIRASTNEWS] Covid-19.

    Labyrinth Global Health travaille aux côtés de « Eco Health Alliance » et de « Metabiota », et a participé au programme USAID PREDICT. Toutes ces personnes et organisations travaillent depuis au moins la dernière décennie à étudier les coronavirus et à aider à mettre en place des Biolabs en Ukraine. Tous utilisent des fonds du département américain de la Défense pour le faire.

    Les informations trouvées ici indiquent qu’Eco Health Alliance a participé à la création du virus de la Covid-19.

    Les informations trouvées ici indiquent que Moderna a participé à la création du virus de la Covid-19.

    « Moderna », aux côtés du « National Institute of Allergy and Infectious Diseases » (NIAID), a accepté de transférer des « candidats de vaccins contre le coronavirus à ARNm » développés et détenus conjointement par le NIAID et Moderna, aux destinataires « l’Université de Caroline du Nord à Chapel Hill » le le 12 décembre 2019.

A quoi tout cela renvoie-t-il ? C’est à vous de réfléchir et de décider. Mais nous vous promettons qu’il y a beaucoup plus à venir sur ce qui précède…

Traduction : MIRASTNEWS


Je vous invite à visiter nos  boutiques en ligne conçues pour financer notre site web:

Sur ce lien: Vintage par Michel sur Etsy

Sur cet autre lien:Vintage par Michel sur E Bay

Le film du mois pour souligner la fête de Paques:Risen de 2016

 

L’HISTOIRE DU FILM

À Jérusalem lors des quarante jours qui succèdent à la résurrection du Christ, puis en Galilée. Clavius, un tribun militaire romain, et son aide de camp Lucius sont mandatés par Ponce Pilate pour superviser la crucifixion d’un juif nommé Jésus de Nazareth. Après la mort du condamné et sous la pression du Sanhédrin, Pilate ordonne de faire sceller et garder le tombeau mais le lendemain, les deux sentinelles ont disparu et le tombeau est vide. Pilate charge Clavius d’enquêter sur la disparition du corps du Nazaréen. Pourchassant les disciples du Christ soupçonnés d’avoir enlevé le corps, Clavius se convertit progressivement lorsqu’il les retrouve dans une petite maison de Jérusalem autour de Jésus ressuscité. Il finit par les rejoindre en Galilée. Pilate, se sentant trahi, envoie Lucius le tuer, mais Clavius s’en va se perdre au désert, incertain de ce qu’il a vu.

 

 

 

 

 

 

 

 

 

 

Mon évaluation

Il s’agit de mon film biblique favori car il fait un lien avec d’autres univers,entre la vision antique des dieux et la notre qui y voit une intervention extraterrestre.

 

 

 

La Criminelle Arnaque du COVID-19:Des preuves biochimiques et statistiques officielles confirment à 100 % que Moderna a créé le Covid-19

1) Lorsque  Kadhafi avait annoncé dans les années 60, en parlant des Américains, « ils fabriqueront des médicaments, et pour vous les fourguer, ils fabriqueront les maladies qui vont avec »; les « experts » l’avaient traité de « fou ». Les mêmes qui traitent aujourd’hui Poutine de fou.
2) Les Big Pharma (Pfizer, Moderna, J&J, etc.) ont sorti leur vaccin Covid en quelques mois, alors qu’habituellement il faut au moins 10 ans, prouve qu’ils étaient tous « au parfum »  de l’arnaque covid qui se préparait chez Moderna.
3) Dès le début de cette pseudo pandémie, nous avons été parmi les premiers à dénoncer cette arnaque et à affirmer que cette « maladie » est artificielle et qu’elle était conçue dans les labos de l’Oncle Sam.  H. Genséric

Des preuves sont apparues prouvant au-delà de tout doute raisonnable que le géant pharmaceutique Moderna, la société qui a gagné des milliards grâce à la vente d’une injection expérimentale appelée vaccin de Covid-19, a en fait créé le virus Covid-19.

Le 23 février, le Daily Mail a publié un article montrant que Moderna avait breveté la séquence de 19 lettres de base (nucléotides) qui code pour le site Furin Cleavage dans Covid-19. 

Il a cité un article rédigé par des scientifiques en Inde, en Suisse, en Italie et aux États-Unis ( avec prudence intitulé : MSH3 Homology and Potential Recombination Link to SARS-CoV-2 Furin Cleavage Site ) dans lequel ils ont calculé que les chances d’une séquence de 19 nucléotides, brevetée par Moderna, apparaissant au hasard dans Covid-19 , dans des circonstances où il n’apparaît nulle part ailleurs dans la nature sont de 1 sur 3 milliards [1].

Mais ils n’ont pas réussi à en tirer la déduction évidente. S’ils avaient fait cette déduction évidente, je crains que cela n’ait été la dernière déduction scientifique qu’ils aient jamais publiée !

Ils ont décidé d’enquêter sur la séquence d’ARN du site de clivage de la furine dans la protéine de pointe Covid-19 pour voir si cela se produisait ailleurs dans la nature. .

Heureusement, le NCBI/NIH a produit la merveilleuse base de données BLAST qui répertorie toutes les séquences de gènes dans la nature connues de l’homme et toutes les séquences de gènes synthétiques brevetées connues de l’office des brevets.

Les chercheurs ont choisi la séquence Furin Cleavage car il s’agit de la seule séquence continue de lettres de gène (séquence de nucléotides) dans Covid-19 avec plus de 3 nucléotides, qui diffère des lettres respectives dans son parent naturel le plus proche, le Bat Coronavirus RaTG13 (toutes les autres différences sont 3 lettres ou moins). C’était donc de loin le meilleur candidat pour déterminer si le Covid-19 était ou non créé par l’homme.

 

De plus, le site de clivage de la furine est la clé de la pathogénicité de Covid-19 . Donc, s’il devait y avoir un gain de fonction créé par l’homme inclus dans le virus, c’est là que l’on pourrait s’attendre à le trouver.

La séquence d’acides aminés du site de clivage de la furine est PRRA (Proline Argenine Argenine Alanine). Chaque acide aminé est codé par un codon composé de 3 nucléotides (lettres de séquence génétique). Ainsi, toutes les différences dans le code génétique entre Covid-19 et RaTG13 sont au plus long d’un codon, d’un acide aminé, autre que la séquence de clivage de la furine, qui est…

CCT CGG CGG GCA

La séquence complémentaire (le brin d’ADN opposé de la double hélice est (GGAGCCGCCCGT) car C se lie à G et A se lie à T

Le compliment inverse (la même chose écrite à l’envers) est donc TGCCCGCCGAGG

Les chercheurs ont effectué une recherche d’alignement BLAST (Basic Local Alignment Search Tool) (ce qui signifie qu’ils recherchent la séquence du gène, la séquence du gène inverse, la séquence du gène complémentaire et la séquence du gène complémentaire inverse) à travers chaque séquence de gènes dans la nature connue de l’homme depuis CTCCTCGGCGGGCACGTAG qui est la séquence de 19 nucléotides contenant la séquence de clivage de la furine, qui apparaît également dans Covid-19, et qui se trouve en fait sous la forme de complément inverse CTACGTGCCCCGCCGAGGAG brevetée par Moderna.

Leurs résultats de recherche peuvent être trouvés ici . 

Le tableau 1 montre qu’il existe bien dans les 5 brevets américains cités ci-dessous…

US9149506B2 : Polynucléotides modifiés codant pour la septine-4 – https://patents.google.com/patent/US9149506B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618953P
2013-12-16 Demande déposée par Moderna Therapeutics Inc
2014-05-22 Publication de US20140141067A1
2015-10-06 Publication de US9149506B2
2015-10-06 Demande accordée
2020-01-10 Premier litige familial mondial déposé

US9216205B2 : Polynucléotides modifiés codant pour la granulysine – https:// patents.google.com/patent/US9216205B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618873P
2013-12-16 Demande déposée par Moderna Therapeutics Inc
2014-04-24 Publication de US20140113960A1 2015-12-22
Publication de US9216205B2 2015-12-22
Demande accordée

SIAH encodant la polynucléotide E3subitine modifiée protéine ligase 1 – https://patents.google.com/patent/US9255129B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618868P
2013-12-16 Demande déposée par Moderna Therapeutics Inc
2014-05-22 Publication de US20140141068A1
2016-02-09 Demande accordée
2016-02-09 Publication de US9255129B2

US9301993B2 : Modified polynucleotides coding apoptosis inducing factor 1 – https://patents.google.com/patent/US9301993B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Mandataire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618957P
2013-12- 16 Demande déposée par Moderna Therapeutics Inc
2014-04-17 Publication de US20140107189A1
2016-04-05 Demande accordée
2016-04-05 Publication de US9301993B2
2020-01-10 Premier litige familial mondial déposé

US9587003B2 : Polynucléotides modifiés pour la production de protéines et de peptides liés à l’oncologie – https://patents.google.com/patent/US9587003B2/en 

Inventeur : Stephane Bancel, Tirtha Chakraborty, Antonin de Fougerolles, Sayda M. Elbashir, Matthias John, Atanu Roy, Susan Whoriskey, Kristy M. Wood, Paul Hatala, Jason P. Schrum, Kenechi Ejebe, Jeff Lynn Ellsworth, Justin Guild

Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618868P
2016-02-04 Demande déposée par ModernaTx Inc
2016-06-02 Publication de US20160152678A1
2017-03-07 Publication de US9587003B2
2017-03-07 Demande accordée

Ainsi, Moderna a déposé une première demande de brevet pour la séquence de 19 nucléotides en 2013 le 16 décembre. Peut-être que le 25 décembre aurait été plus approprié puisqu’il était destiné à devenir la couronne d’épines de Mathew27, Mark15 et John19.

Tableau 2 : montre que la séquence se produit dans Covid-19 du nucléotide 23601 à 23619.

Tableau 3 : montre que cette séquence de gène n’existe pas dans la nature (mais 14 parties nucléotidiques de celle-ci existent). 

J’ai décidé de vérifier leur travail. Oui. Je les ai effectivement vérifiés (j’enverrai une facture aux mondialistes). Cela s’est avéré être un voyage un peu épique. La page de brevet Google pour US9587003B2 ne contient pas la séquence du gène. Le pdf du brevet ne contient pas la séquence du gène et n’est pas consultable à partir des pages 101-304. Mais il a un lien vers une longue section « Liste des séquences » que l’on ne peut pas copier. Je l’ai donc transcrit manuellement de ma main juste –  http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US09587003B2 

À partir de cette page, vous pouvez entrer l’ID de séquence cité dans l’article sous la forme 11652 et accéder à https://seqdata.uspto.gov/?pageRequest=viewSequence&DocID=US09587003B2&seqID=11652 qui a ce qui suit aux nucléotides 2751-2733 en lisant à l’envers…

gccctgatca ccatcatggc ccagatcggc ag ctacgtgc ccgccgagga g gccaccatc 2760

CTACGTGCCCCGCCGAGGAG breveté par Moderna est le complément inverse de CTCCTCGGCGGGCACGTAG, la séquence de 19 nucléotides qui apparaît dans l’ADN de Covid-19 à partir du nucléotide 23601-23619 (qui serait donc couvert par leur brevet).

De même, vous pouvez rechercher la séquence dans US9149506B2 en allant sur https://seqdata.uspto.gov/?pageRequest=viewSequence&DocID=US09149506B2&seqID=11652 , après quoi vous retrouverez la même chose

gccctgatca ccatcatggc ccagatcggc ag ctacgtgc ccgccgagga g gccaccatc 2760

J’ai ensuite recherché la séquence génétique de Wuhan Hu1 (alpha) sur https://www.ncbi.nlm.nih.gov/nuccore/NC_045512 et j’ai trouvé 

23581 ttatcagact cagactaatt ct cctcggcg ggcacgtag t gtagctagtc aatccatcat de https://www.ncbi.nlm.nih.gov/nuccore/NC_045512 

Qui a la séquence de 19 nucléotides CTCCTCGGCGGGCACGTAG de 23601-23619 comme décrit dans le tableau 3. 

J’ai ensuite effectué ma propre recherche par explosion non alignée de toutes les séquences de gènes brevetées pour le compliment inverse directement (ou peut-être pour un compliment inversé) et j’ai obtenu les mêmes résultats que les chercheurs. 

Et pareil pour les 3 autres brevets américains.

Je peux donc confirmer, et le lecteur peut confirmer en utilisant les liens ci-dessus, que Moderna a demandé un brevet non seulement sur le complément inverse du site de clivage de la furine à 12 nucléotides dans Covid-19, mais en fait sur la séquence de 19 nucléotides le contenant comme décrit au dessus.

De plus, ils n’ont pas simplement déposé une demande de brevet le 4 février 2016 avec US9587003B2 : comme le rapporte le Daily Mail. Ils ont effectivement déposé le 16 décembre 2013 pour 4 brevets avec US9149506B2, US9216205B2, US9255129B2, US9301993B2 : également.

Ainsi, Moderna avait développé la séquence de gènes de 19 nucléotides contenant le site de clivage de la furine qui donne à Covid19 son infectivité pour l’homme grâce à une recherche brevetée sur le gain de fonction dès 2013, 6 ans avant l’épidémie de Wuhan. Pas 3 comme rapporté dans le Mail et viralement ailleurs.. 

Alors maintenant, nous examinons les chances que cela se produise naturellement. L’article calcule la probabilité que cette séquence particulière de 19 nucléotides se produise de manière aléatoire dans un virus de 30 000 nucléotides comme

(30 000-18) × (1/4) 19   = 1,09 × 10 -7

Ce qui est correct car il y a 30 000 à 18 places pour commencer la séquence étant donné qu’il faut encore 18 lettres supplémentaires pour la compléter. Mais il y a en fait 29 904 nucléotides dans Wuhan HU1 (alpha). Un calcul plus précis serait donc

(29 904-18) × (1/4) 19   = 1,087 × 10 -7

Ensuite, ils calculent les chances que la séquence de 19 nucléotides se produise dans la bibliothèque brevetée de 24 712 séquences d’une longueur moyenne de 3 300 nucléotides. Mais ce calcul n’est pas pertinent car la séquence n’est pas apparue au hasard dans 5 demandes de brevet Moderna. La séquence était connue pour coder pour un site de clivage de la furine, qui est connu pour fournir un gain de fonction aux coronavirus.

Il y a été mis délibérément et breveté en raison de son pouvoir infectieux chez l’homme, que nous verrons plus loin dans l’article, résulte du remplacement du codon viral normal de l’arginine (R) AGA (utilisé dans 45 % des codons viraux de l’arginine) par le le codon de l’arginine humaine CGG (utilisé dans 0 % des codons de l’arginine virale) dans le site de clivage de la furine.

Tout ce que nous essayons de déterminer ici, c’est quelles sont les chances qu’une séquence de 19 nucléotides brevetée par Moderna apparaisse dans Covid-19 par des causes naturelles, les mutations naturelles du Bat Coronavirus RaTG13 ou d’un autre virus.

Les nucléotides forment des codons qui sont des triplets. Il y a donc 64 triplets possibles des 4 nucléotides d’ADN ACGT (4x4x4 = 64). Mais tous les triplés se produisent. 61 codent pour 20 acides aminés de manière redondante et 3 sont des codons stop qui indiquent au ribosome d’arrêter de fabriquer la protéine.

Mais les choses ne sont pas aussi simples car le site de clivage Furin apparaît dans la protéine de pointe là où il doit être et la protéine de pointe n’a que 1273 × 3 = 3819 nucléotides. Les chances que la séquence de 19 nucléotides Furin Cleavage apparaisse dans la protéine de pointe sont 

(3 819-18) × (1/4) 19   = 1,389 × 10 -8

Soit 1 sur 72 millions. Ce seraient donc les chances qu’une variante particulière, disons la première variante de Covid-19, ait la séquence de 19 nucléotides au bon endroit (le pic). Et il l’a fait. Donc, certainement selon la prépondérance des probabilités, et certainement au-delà de tout doute raisonnable (1 sur 72 millions étant un doute déraisonnable), Moderna a créé Covid-19. 

Preuve 100% biochimique que Covid19 a été créé par l’homme

Le double codon CGG utilisé dans le site de clivage spécifique de la furine Moderna ne se produit dans aucun autre site de clivage de la furine dans aucun autre virus dans la nature. Les sites de clivage de la furine se produisent dans d’autres virus mais PAS du tout dans d’autres bétacoronavirus comme Covid-19 et PAS du tout avec le double codon CGG.

L’arginine (R), peut être codée par l’un des 6 triplets : AGG, AGA, CGA, CGC, CGG, CGT. Dans le Covid-19, le site de la furine (PRRA), compte 12 nucléotides (3 x 4). Dans le Covid-19, le doublet RR du site de la furine est codé par CGG-CGG.  

Antonio R. Romeu

Deux biochimistes, le professeur Antonio R. Romeu et le professeur assistant Enric Ollé, ont analysé le doublet RR à partir d’un large échantillon de sites de clivage de la furine de plusieurs types de virus . Ils ont découvert qu’il n’y avait aucun doublet RR codé par les codons CGG-CGG dans aucun virus dans la nature. Ils ont observé que le triplet AGA était le codon majoritaire impliqué dans ces doublets RR viraux.

Dans toute recombinaison génétique (où une partie d’un génome fusionne avec un autre génome), le code donneur est transmis à l’accepteur. Mais il n’y a tout simplement AUCUN VIRUS CONNU avec un site de clivage de la furine spécifique de Moderna (ayant la paire de codons CGG-CGG) qui existe pour donner un site de clivage de la furine spécifique de Moderna à Covid19. Donc, la seule façon dont cette séquence pourrait entrer dans Covid-19 est de Moderna. Moderna était le donateur. La nature ne l’était pas. CQFD. Affaire classée..  

Mais ça empire.

Les professeurs espagnols ont décidé d’analyser l’utilisation du codon de l’arginine dans chaque protéine de Covid-19. Le constat suivant…
AGG (13%)
AGA (45%)
CGA (5%)
CGC (10%)
CGG (3%)
CGT (24%). 

Ainsi, le triplet de codons AGA était majoritaire et, fait intéressant, CGG était le codon minoritaire de l’arginine dans le virus. 

Mais c’est encore pire.

Dans le cas particulier de la protéine S, sur les 42 Arginines (R) dont elle dispose, 20 sont codées par AGA, et seulement 2 par CGG. Ces 2 bien sûr, sont les deux dans le site de clivage Moderna Specific Furin.

Ainsi, la seule arginine dans la protéine de pointe qui est codée à la Moderna se trouve sur le site Furin Cleavage. Les 40 autres instances n’utilisent pas du tout CGG. 

Ils poursuivent ensuite en commentant que chaque espèce individuelle dans la nature a ses propres préférences de codons. De toute évidence, les virus aiment AGA, et n’aiment pas du tout CGG, dans la nature.

Mais devinez quelle espèce utilise CGG pour l’arginine plus que les 5 autres codons concurrents – oui, son vieil homo sapiens. Nos préférences de codage pour l’arginine sont

AGG (20 %)
AGA (20 %)
CGA (11 %)
CGC (19 %)
CGG (21 %)
CGT (9 %).

Ainsi, le codon CGG dans le site de clivage de la furine SERA issu de la recherche sur le gain de fonction chimère (combinaison homme-animal). 

Quelqu’un d’autre que Moderna aurait-il pu créer le Covid-19 en utilisant le site de clivage de la furine spécifique de Moderna ?

« De nouveaux documents montrent que 18 mois seulement avant l’apparition des premiers cas de Covid-19, les chercheurs avaient soumis des plans pour libérer des nanoparticules et des aérosols pénétrant dans la peau contenant de « nouvelles protéines de pointe  » de coronavirus de chauve-souris  des cavernes du Yunnan, en Chine. Ils prévoyaient également de créer des virus chimériques, génétiquement améliorés pour infecter plus facilement les humains, et ont demandé 14 millions de dollars à la Defense Advanced Research Projects Agency (Darpa) pour financer les travaux.

Des articles, confirmés comme authentiques par un ancien membre de l’administration Trump, montrent qu’ils espéraient introduire des «sites de clivage spécifiques à l’homme» pour les coronavirus de chauve-souris, ce qui faciliterait l’entrée du virus dans les cellules humaines.
Lorsque Covid-19 a été séquencé génétiquement pour la première fois, les scientifiques étaient perplexes quant à la façon dont le virus avait développé une telle adaptation spécifique à l’homme au site de clivage de la protéine de pointe, raison pour laquelle il est si infectieux. – le Telegraph

Je peux voir tous les grands journalistes du Daily Mail et du Telegraph (sans parler des scientifiques du monde entier) faire toutes ces recherches sur Covid19 et arriver à la conclusion logique inévitable qu’il y a eu une fuite accidentelle ou délibérée d’un laboratoire et doivent ensuite formuler leurs conclusions de manière à étiqueter cette forte probabilité comme une possibilité faible. 

Mais ci-dessus, nous l’avons prouvé comme un fait (puisque le codon CGG de la séquence de clivage spécifique de la furine de Moderna n’apparaît dans aucun site de clivage de la furine dans aucun virus naturel et, par conséquent, il ne peut pas avoir été le résultat d’une recombinaison génétique naturelle. Il doit donc être le résultat d’une insertion génétique faite par l’homme. 

En théorie, une autre partie impliquée avec le NAIAD ou le NIH aurait pu utiliser le site de clivage de la furine breveté par Moderna et fabriquer Covid19 eux-mêmes. Cela n’aurait brisé aucun brevet de Moderna. Le site de clivage Furin lui-même n’est pas brevetable étant connu depuis au moins 2004

US7223390B2 : Insertion de sites de clivage de la furine protéase dans les protéines membranaires 
et leurs
utilisations

Bien que Moderna ait en fait pu breveter le codage Moderna Specific (CGG pour AGA) du site de clivage de la furine qui n’était pas connu dans la nature même aujourd’hui (si nous acceptons que Covid-19 soit créé par l’homme).

Mais étant donné que la fuite de laboratoire (délibérée ou accidentelle) est venue de Wuhan, et compte tenu de la dissimulation chinoise et des démentis de Fauci exposés par le sénateur Rand Paul, et étant donné les dissimulations du NIH, du NIAID et des services de renseignement américains, quand leur Un rapport de 3 mois sur l’origine de Covid-19 commandé par l’imitateur présidentiel Biden n’a rien donné, et compte tenu des relations entre le NIAID, le NIH, le WIV, l’EcoHealth Alliance, l’Université de Caroline du Nord et Moderna, je ne vois aucune pièce pour quelqu’un d’autre.

De plus, toute la cabale impie des mauvais acteurs a commencé à développer le vaccin Moderna avant que la pandémie ne frappe – https://www.infowars.com/posts/must-watch-nih-claimed-joint-ownership-of-moderna-mrna-vaccine- a commencé-le-développement-des-semaines-avant-la-pandémie/ 

Mais les choses ne sont pas aussi simples que cela parce que la nature a certainement eu 100 000 ans pour fabriquer des virus humains et elle n’a jamais mis une seule fois un site de clivage de furine spécifique à Moderna (CGG pour AGA) dans quoi que ce soit, ni mis la séquence de 19 nucléotides dans quoi que ce soit auparavant.

Pourtant, dans les 6 ans suivant le brevetage de Moderna, nous le trouvons dans Covid-19 dans des circonstances où Moderna travaille avec ce virus. Donc juste là, la probabilité n’est pas de 100 000 contre 6 ou 16 666 contre 1 que Moderna soit responsable plutôt que la nature. Non c’est à 100% car la nature ne l’a pas fait. Il ne l’a jamais fait et rien ne prouve qu’il le fera un jour.

C’est l’homme qui mélange les codons humains et viraux de l’arginine, pas la nature. 

Le prof. Luc Montagnier a passé les dernières années de sa vie à prouver que le COVID-19 était créé par l’homme et qu’il contenait une grande partie du code génétique du VIH1

Le professeur Luc Montagnier, avant de mourir le 8 février 2022, a totalement détruit le concept selon lequel Covid-19 a évolué naturellement en montrant qu’il avait une équivalence massive avec VIH. Le diagramme ci-dessous montre une région de 275 nucléotides de Covid-19 qui contient 200 nucléotides du VIH/SIV (Simian ImmunoVirus). Et rappelez-vous qu’il y a 61 codons spécifiant 20 acides aminés. On peut donc dire la même chose en moyenne de 3 manières différentes avec des codons.

Vous pouvez télécharger un pdf de son étude ici et les documents supplémentaires ici . C’est très technique. Mais il a remporté le prix Nobel pour avoir découvert le virus VIH. Donc, si quelqu’un savait si Covid avait été boosté par le VIH, ce serait lui. Il a souligné que Covid-19 avait été créé par l’homme au début de la pandémie et qu’il avait lui-même été stipendié par la presse et les « vérificateurs des faits » pour avoir dit la vérité scientifique. Tous les « vérificateurs de faits » qui l’ont attaqué avaient tort.

Aucune de leurs vérifications des faits n’avait de fondement scientifique. Ces gens ne sont pas du tout des vérificateurs de faits bien sûr. Ce sont des agences de désinformation mondialistes, des fils de Goebbels, des fact chuckers et des négateurs de la science. Ils sont à peu près aussi dignes de confiance qu’une élection américaine. Je peux vérifier un fait par moi-même merci beaucoup. Je n’ai pas besoin qu’un taliban soumis au lavage de cerveau me dise son opinion sur un sujet qu’il n’a jamais étudié à l’université.

Puisque nous avons prouvé au-delà de tout doute raisonnable (au-delà d’un doute sur 1 sur 72 millions de manière statistique et avec 100% de certitude biochimique à partir du site de clivage de la furine spécifique de Moderna) que Moderna a fabriqué Covid-19. Et puisque Moderna et Fauci n’ont pas admis l’avoir fait et ont en fait dissimulé des preuves à cet effet, il se peut qu’ils cachent également autre chose.

Maintenant, les deux seules théories qui restent sont la théorie des fuites accidentelles de laboratoire et la théorie des fuites délibérées de laboratoire. Nous savons que la grande majorité des fuites politiques ne sont pas des accidents. Ce sont des stratégies délibérées pour procurer un avantage au bailleur ou au payeur. Il est bien connu dans l’industrie informatique que les virus apparaissent lorsque des ventes d’antivirus sont nécessaires. Pourquoi les choses seraient-elles différentes avec les virus humains, maintenant qu’ils peuvent aussi être créés par l’homme ? Surtout si l’on considère le rôle massif de Bill Gates et de sa fondation et de GAVI et GVAP dans le secteur mondial de la vaccination.

La seule raison pour laquelle Moderna créerait Covid-19 est de le lancer sur le marché. Sinon, tout l’exercice serait financièrement futile, commercialement inutile.

La raison invoquée par Fauci pour faire de la recherche sur le gain de fonction est que l’homme doit être en avance sur la nature ou les mauvais acteurs afin d’avoir un vaccin en temps utile si une maladie mute ou est génétiquement modifiée par « les Chinois ou les Russes » pour être mortelle !!

Mais pour croire cela, il faut croire que Moderna s’intéresse à sauver la vie des gens. Je m’excuse. Toutes leurs actions me montrent qu’ils sont intéressés à vacciner les gens sachant à quel point cela risque de leur coûter la vie.

Ils sont intéressés par le profit, le profit qui découle d’une pandémie. Ils ne sont pas des sauveurs de l’humanité comme ils le représentent. Ce sont nos exploiteurs et nos agresseurs.

Ils ont produit le virus pour le faire fuiter, pour se faire passer pour nos sauveurs de leur propre fuite. Ce ne sont pas les activités d’une figure de sauveur. Luc Montagnier essayait d’être notre sauveur d’eux et il a été assassiné (professionnellement) par leurs groupies. [La fiotte Macron a snobé le décès du Savant]
Moderna effectuait des recherches sur le gain de fonction afin de libérer le virus et de forcer un vaccin contre celui-ci d’une manière qui maximiserait ses profits. Ce n’est pas une théorie du complot. C’est ce qui s’est passé précisément. Le cours de leur action a été multiplié par 20. 

Ils l’ont sorti pour vendre leurs vaccins et détruire le système immunitaire de leurs clients car notre système immunitaire réduit leurs profits. C’est le business de Big Pharma. 

La raison pour laquelle l’écrivain est si confiant que Moderna ou leurs agents ont fabriqué et divulgué Covid-19 et la raison pour laquelle je l’ai appelé ainsi au début de la pandémie pour presque autant de ridicule que le professeur Montagnier a reçu (que Dieu le bénisse) est que le les Écritures disent dans Matthieu27, Marc15 et Jean19 : 

29 Et ils (les soldats du gouverneur du verset 27) placèrent une couronne d’épines et la mirent sur sa tête, et un roseau dans sa main droite ; et ils s’agenouillèrent devant lui, et se moquèrent de lui, disant : Salut, roi des Juifs !
30 Et ils crachèrent contre lui, prirent le roseau et le frappèrent sur la tête. (Matthieu 27 ASV)

Puis-je donc demander votre indulgence pendant que j’interprète ces mots : 

Le département américain de la défense a financé l’épissage génétique du coronavirus des protéines de pointe (Covid-19) par l’intermédiaire du NIH, du NIAID et de la DARPA, qui a d’abord infecté Jésus, par l’intermédiaire de son fiancé, les saints de la Nouvelle Alliance, juste après qu’il soit devenu le roi séculier, César à ces saints, les Juifs antitypiques, ceux qui se sont engagés à être des fils angéliques de Jacob, les nés de nouveau angéliquement.

Nous avons calculé que la malédiction qui a empêché Jésus de devenir César des saints s’est terminée en 2019Tishri15 (17/18 octobre). Glenn Beck a réalisé un documentaire montrant que 10 hôpitaux de Wuhan ont pris en charge des cas présentant des symptômes de Covid19 en octobre 2019. Oui les gens. Le Covid-19 est une preuve que Jésus est désormais le Roi séculier sur les saints, les Juifs antitypiques, les Juifs par l’alliance angélique du salut, au moins.

Mais ensuite, les soldats ont craché sur lui. Car c’est ainsi que Covid19 est transféré, à travers de petites gouttelettes d’aérosol expirées par la bouche. Les soldats lui ont délibérément craché dessus. Ce n’était pas une FUITE DE SALIVE ! Ils ont frappé Jésus sur la tête parce que les saints sont à la tête de l’église et ils ont attrapé Covid19 non pas par une infection fortuite au hasard mais par un coup délibéré avec une lecture, une arme biologique, une attaque armée délibérée. Pour en savoir plus, voir ici .

Alors ce que le Pr Montagnier a vu avec son expertise en virologie, je l’ai vu avec mon expertise théologique. Montrer que si les vérificateurs de faits et la science s’excluent mutuellement, la science et la théologie sont en fait d’accord, lorsqu’elles sont bien comprises (et c’est une grande mise en garde). Le Pr M nous a appris que les vaccins provoquent les variants. En effet, la virologie de base interdit la vaccination de masse pendant une pandémie pour cette raison même. Il a dit que la courbe des décès suit la courbe des vaccinations. Remarquez, paradoxalement, si les vaccins ont causé Omicron, alors ils nous ont sauvés d’eux-mêmes !

Le temps est venu de demander des comptes aux personnes et aux organisations

Les fabricants de Covid19, les fabricants de vaccins génétiques. leurs bailleurs de fonds et leurs promoteurs, qui comprennent presque tous les gouvernements, secteurs publics et services de santé dans le monde, sont donc coupables de génocide et de crimes contre l’humanité. Ils ont poussé le viol génétique, la maladie et la mort sur la moitié de la population mondiale afin d’enrichir les poches des sociétés pharmaceutiques. Les gouvernements et les secteurs publics du monde entier ont abandonné leur réglementation des services de santé aux milliardaires et aux entreprises sans cœur

Au Royaume-Uni, tout l’impôt sur le revenu que nous payons va au service de santé et tous ses protocoles sont déterminés par ses régulateurs et tous ses régulateurs sont contrôlés et financés par Big Pharma qui cherchent à nuire puis à gérer notre santé à leur profit.

Ainsi, chaque cent que nous dépensons en impôt sur le revenu nous rapproche un peu plus de la maladie, de la mort et de la toxicomanie.

Le professeur Luc Montagnier,en 2008.

Alors pourquoi le professeur Montagnier a-t-il choisi de passer les dernières années de sa vie à prouver que le Covid-19 était une création humaine et que les protéines de pointe, et donc les vaccins, étaient une menace existentielle pour l’espèce ? Que lui restait-il à prouver à lui-même ou à qui que ce soit d’autre à 87-89 ? Il ne l’a certainement pas fait pour accroître sa réputation dans la profession.

Non, il était animé par la même passion qui l’a poussé à découvrir le VIH. Une passion pour SAUVER l’humanité des virus et de ceux qui voudraient les concevoir pour nous nuire. Et pourquoi a-t-il rendu l’âme en février 2022 ? Parce qu’il savait qu’Omicron avait battu les vaccins. Son travail a été fait par un plus grand virologue que lui. Il a donc pu reposer en paix et aller voir des gens qui ont compris l’ampleur de sa contribution.

Covid-19 n’a pas été fabriqué en 2019. Il a été fabriqué à partir du site de clivage de la furine chimérique spécifique de Moderna (CGG pour AGA) à 19 nucléotides qui n’existe nulle part dans la nature.
Et chaque décès de Covid et chaque décès par vaccin Covid est carrément garé à la porte de ModeRNA en attente de justice.

Mais nous n’exécuterons pas cette justice assez vite. Et donc le fléau final sur l’humanité d’Apocalypse 6: 8, livré par le 4e cavalier de l’apocalypse, que Bill Gates lui-même a prophétisé, arrivera plus tard cette année (après la guerre et après la famine, les 2e et 3e cavaliers).

Source: BREAKING: Official Biochemical and Statistical Evidence 100% confirms Moderna created Covid-19

 


N’hésitez pas à visiter notre boutique en ligne:vous trouverez plein de cadeaux pour vos proches

Sur ce lien:Vintage par Michel

 

Rien ne va plus chez Facebook, « Meta » perd près de 200 milliards de dollars en Bourse

Les actions de Meta, la société mère de Facebook, ont chuté de plus de 25% jeudi,le 3 février 2022, anéantissant plus de 230 milliards de dollars de valeur marchande. Il y a quelques jours, la firme de Mark Zuckerberg jetait aussi l’éponge sur son projet de monnaie numérique, après des années de recherche et développement.

Meta perd près de 200 milliards de dollars en Bourse

A Wall Street, la réaction est forte, très forte. Dans les premières cotations, l’action de l’ex-Facebook plonge de plus de 25%. C’est plus de 230 milliards de dollars de capitalisation boursière qui s’envolent et la plus lourde sanction jamais accusée par le groupe de Mark Zuckerberg ou, plus largement par une société cotée à New York, souligne Bloomberg,

Le 03 février, à 15h15 GMT (16h15 en Suisse), le titre de Meta Platforms, maison mère de Facebook, dégringolait de 24% à 245 dollars, entraînant l’indice Nasdaq (-2,14%) dans sa chute.

La fortune du patron de Facebook, Mark Zuckerberg, estimée à 113 milliards de dollars à la clôture hier selon des documents de la SEC, subissait aussi une coupe sévère. Le co-fondateur du réseau social perdait virtuellement presque 28 milliards de dollars.

Les actions de Meta ont plongé à la suite d’un rapport sur les résultats trimestriels lamentable dans lequel la société a publié des prévisions de revenus plus faibles que prévu et a mis en garde contre plusieurs défis pour son activité cette année.

Les investisseurs ont abandonné les actions du géant de la technologie après avoir été alarmés à la fois par la baisse de la croissance des utilisateurs et la hausse des dépenses liées au projet de « métaverse » de la société. Facebook a dépensé plus de 10 milliards de dollars dans ce sens l’année dernière et s’attend à une “augmentation significative” des dépenses similaires pour 2022.

Le nombre d’utilisateurs, surtout, a déçu. Le revenu moyen par utilisateur (Arpu) est, certes, un peu plus élevé qu’attendu, à 11,57 dollars, contre 11,38 dollars visés par les analystes, mais ils sont moins nombreux : 1,93 milliard d’utilisateurs actifs quotidiens en décembre, contre 1,95 milliard anticipé, et 2,91 milliards d’actifs mensuels (2,95 milliards). C’est la première fois, dans l’histoire de l’entreprise, que le nombre d’utilisateurs actifs quotidiens s’inscrit en baisse par rapport au précédent.

 

Meta cède aussi sur la cryptomonnaie et abandonne le Diem

Février est décidément un mois compliqué pour Facebook, rebaptisé Meta. Après le projet avorté en 2019 du Libra, cette cryptomonnaie qui réunissait d’autres acteurs d’Internet et des paiements (PayPal, Visa, Mastercard) autour du réseau social, c’est au tour de son successeur, le Diem, d’être enterré.

Le diem n’aura pas réussi à faire oublier le « libra », nom du projet initial, qui avait, déjà, créé un véritable séisme dans la sphère bancaire mondiale il y a un peu plus de deux ans. Cette monnaie virtuelle décentralisée devait être lancée mi-2020, mais elle avait immédiatement déclenché une fronde internationale à son égard.

Le projet de monnaie numérique de Meta (Facebook), ne verra, donc, pas le jour. Elle a annoncé son démantèlement, ainsi que la vente des droits de propriété intellectuelle et d’autres actifs à la banque Silvergate Capital pour 182 millions de dollars.

Selon Bloomberg, le coup d’épée fatal a été porté par la Réserve fédérale des États-Unis qui aurait exercé sa pression sur le partenaire banquier du diem, Silvergate.

Le recul de Meta s’expliquerait par la dissuasion des autorités centrales qui n’entendent pas perdre aussi facilement le contrôle de la monnaie. Le pari était aussi prometteur puisqu’il surfait – comme les autres GAFA – sur l’explosion des cryptomonnaies, au nombre de 12.000 selon CoinGecko, et qui se sont bâties une véritable notoriété en pleine pandémie de Covid et face aux incertitudes liées à l’inflation sur les Bourses traditionnelles.

Amazon, Google, Apple, PayPal, mais aussi Tesla du côté des Américains… les géants de la Tech se penchent sur ces nouveaux moyens d’échanges, en dehors des circuits bancaires traditionnels, sur tous les continents. Mais dans les pays où un pouvoir central contrôle l’économie, comme en Chine ou en Inde, l’activité des cryptomonnaies est pratiquement bannie.

Le projet était d’autant plus stratégique qu’il promettait potentiellement d’échanger des biens et d’acheter des services dans le futur « métaverse » de la firme de Mark Zuckerberg

Avec ce projet de « monde virtuel » Zuckerberg révèle ainsi son objectif final, qui n’est pas seulement de dominer l’internet d’aujourd’hui, mais de contrôler et de définir l’internet que nous laisserons à nos enfants et aux enfants de nos enfants. Un internet de surveillance toujours plus invasif où la parole dissidente est bannie.

Source

Fb spie
Un document interne à Facebook révèle que le géant des médias sociaux surveille le comportement hors ligne de ses utilisateurs afin de déterminer si une personne doit être classée dans la catégorie «agent de la haine», comme l’a signalé le Washington Pundit .

 

 

 

 

 

 

 

 

 


N’OUBLIEZ PAS DE VISITEZ LA BOUTIQUE EN LIGNE DE VOTRE SITE WEB FAVORI ET DE PARTAGER SON LIEN:

Sur ce lien:Vintage par Michel