La Criminelle Arnaque du COVID 19:Suite à la découverte d’un insecte dans un flacon, Moderna retire près de 800 000 doses de vaccin

Un moustique a été découvert à l’intérieur d’un flacon dans un centre de vaccination de Malaga, en Espagne. Invoquant la « présence d’un corps étranger », l’Agence espagnole des médicaments et des produits de santé (AEMPS) a annoncé le retrait, le 8 avril, de lots du vaccin Moderna, rapporte le quotidien El Pais. Le laboratoire Moderna a dû procéder au rappel de 764 900 doses de vaccin.

Le lot dont était issu le flacon avait été produit dans une usine située à San Sebastian de los Reyes, près de Madrid, où sont réalisés le remplissage des flacons et leur conditionnement. Le contenant est, lui, produit en Suisse.

Moderna fait face à un autre problème : depuis la mi-janvier 2022, les fioles ont été distribuées dans plusieurs pays en dehors de l’Espagne : la Norvège, la Suède, la Pologne et le Portugal. Tous sont concernés par le rappel annoncé par le laboratoire. Les autorités norvégiennes sont d’ailleurs à l’origine du dévoilement de la raison de ce retrait.

Pour autant, le laboratoire a voulu se montrer rassurant en publiant un communiqué commun avec l’entreprise responsable de la fabrication (Rovi) : « Le flacon impacté […] n’a pas été administré », assurent-ils, ajoutant qu’une enquête est en cours. Moderna soutient par ailleurs qu’« aucun problème de sécurité n’a été signalé chez les personnes ayant reçu un vaccin […] de ce lot », faisant valoir les 900 millions de doses de leur vaccin injectées à travers le monde.


EN COMPLÉMENTAIRE

Au Japon,en 2021, Moderna était contraint de retirer 1,63 million de doses de vaccins

Août 2021-Le Japon a retiré du marché 1,63 million de doses du vaccin Moderna après qu’une alerte venue de plusieurs centres de vaccination a signalé des lots contenant des impuretés. Après consultation avec le ministère de la Santé japonais, le groupe pharmaceutique nippon Takeda qui distribue le vaccin au Japon a décidé de suspendre l’utilisation des doses et demandé à Moderna de mener l’enquête.

La production du vaccin Moderna s’inscrit dans une longue chaîne de fabrication, une chose qui ne lui est pas propre puisque tous les fabricants de vaccins ont fait appel à des sous-traitants pour produire en quantité et répondre le plus rapidement possible à une demande mondiale très élevée.

Concernant le vaccin Moderna et les lots défectueux japonais, le principe actif composé d’ARN messager est fabriqué en Suisse tandis que son conditionnement est sous-traité en Espagne, près de Madrid par la société Rovi. Le problème viendrait du conditionnement et la société Rovi aurait, selon le quotidien El Pais « reconnu dans une lettre que le problème a pu survenir dans une de ses lignes de production et qu’il ne concerne qu’un lot, bien que les autres lots soient analysés à titre préventif ».

Ce problème sanitaire vient s’ajouter à une situation sanitaire déjà critique dans un pays, qui malgré le programme de vaccination de masse mis en place depuis mai, connaît un taux d’infections record depuis l’arrivée du variant Delta, plus contagieux.


une plainte pour crime d’empoisonnement déposée au Tribunal judiciaire de Paris

 

Une plainte criminelle contre X pour crime contre l’humanité, empoisonnement et tentative d’empoisonnement, rédigée par un collectif de juristes et d’avocats, est envoyée cette semaine au Tribunal judiciaire de Paris par l’association BonSens.org, l’Association internationale pour une médecine scientifique indépendante et bienveillante (AIMSIB) et des citoyens victimes d’effets secondaires des vaccins contre le Covid-19.

Au cours des dernières semaines, la campagne présidentielle et la guerre en Ukraine ont subitement puis totalement pris le pas sur la politique sanitaire du gouvernement, qui avait envahi nuit et jour l’espace médiatique au cours des deux dernières années. Marquée par l’obligation indirecte de prendre un vaccin à l’efficacité contestée et aux effets secondaires de plus en plus avérés (Voir : Le Sénat à l’écoute des victimes présumées d’effets secondaires graves du vaccin et « Il y a une volonté de ne pas savoir » : le collectif « Où est mon cycle » au Parlement européen), la crise du Covid-19 a jeté le doute sinon franchement mis en cause dans les esprits des Français, la probité de l’action du gouvernement et de son chef. Dernièrement, les affaires McKinsey et du Rothschild Gate sont venus renforcer au sein de la population ce sentiment de dichotomie entre l’intérêt général et les intérêts privés de la caste dirigeante. C’est pourquoi des associations poursuivent, malgré les embûches, la bataille judiciaire en vue d’obtenir au pénal réparation pour les victimes des conséquences de la politique vaccinale. C’est dans ce cadre que nous avons interviewé Maître Jean-Pierre Joseph, avocat au barreau de Grenoble, qui représente les plaignants.

Pourraient être impliqués, et par la suite, mis en examen : Jean Castex, Premier ministre ; Edouard Philippe, ancien Premier ministre ; Olivier Véran, ministre des Solidarités et de la Santé ; Frédérique Vidal, ministre déléguée à l’Enseignement supérieur et à la Recherche et membre de la « task force » vaccin ; Agnès Pannier-Runacher, ministre déléguée à l’Industrie, responsable de la « task force » vaccin ; Jérôme Salomon, directeur général de la santé ; Alain Fischer, coordonnateur de la stratégie vaccinale de l’État ; Louis-Charles Viossat, ancien responsable de la « task force » interministérielle vaccination Covid-19  ; Laetitia Buffet, responsable de la « task force » interministérielle vaccination covid-19  ; Bernard Celli, responsable de la « task force » interministérielle vaccination Covid-19  ; Patrick Bouet, président du Conseil national de l’Ordre des médecins.

close
volume_off

Les membres du conseil scientifique constitué à titre de l’urgence sanitaire en application de la loi n°2020-290 du 23 mars 2020 d’urgence pour faire face à l’épidémie de Covid-19 (ci-après conseil scientifique, créé par le décret du 3 avril 2020) : Jean-François Delfraissy, président du Conseil scientifique Covid-19 ; Laetitia Atlani-Duault, anthropologue ; Daniel Benamouzig, sociologue ; Lila Bouadma, réanimatrice ; Simon Cauchemez, modélisateur ; Catherine Chirouze, infectiologue ; Angèle Consoli, pédopsychiatre ; Pierre Louis Druais, médecine de ville ; Arnaud Fontanet, épidémiologiste ; Marie-Aleth Grard, milieu associatif ; Olivier Guérin, gériatre ; Aymeril Hoang, spécialiste des nouvelles technologies ; Bruno Lina, virologue ; Denis Malvy, infectiologue ; Yazdan Yazdanpanah, infectiologue ; la Haute Autorité de santé (HAS) ; Dominique Le Guludec, directrice générale de la HAS ; l’Agence nationale de sécurité du médicament (ANSM) ; Christelle Ratignier-Carbonneil, directrice générale de l’ANSM ; l’Agence européenne du médicament ; Emer Cooke, directrice de l’Agence européenne du médicament ; la Commission européenne ; Ursula van der Leyen, présidente de la Commission européenne ; la société Pfizer SAS ; Henriette Rosenquist, présidente de la société Pfizer SAS ; Franck Le Breguero, pharmacien responsable et directeur général de la société Pfizer SAS ; la société Pfizer Holding ; Florence Petelet, gérante de la société Pfizer Holding ; Marie-Gabrielle Laborde-Rayna, pharmacien responsable et gérante non-associée de la société Pfizer Holding ; la société Pfizer inc. ; Albert Bourla, PDG de la société Pfizer inc. ; la société BioNtech AG ; Helmut Jeggle, président de la société BioNtech AG.

Et toutes autres personnes à déterminer.

FranceSoir : Me Joseph, quel est l’intérêt de cette plainte pour les victimes des conséquences des injections ?

Me Joseph : Pour les victimes et les proches de victimes, l’intérêt est double. D’une part, il est de se voir reconnues comme victimes d’un acte que le juge qualifiera, mais qui, selon les plaignants, réunit les conditions du crime d’empoisonnement.

Ainsi, les fabricants doivent répondre des substances qu’ils ont conçues et mises sur le marché, nous y reviendrons. Les ministres en charge et les différentes agences et commissions qui sont intervenues pour administrer ces substances aux Français (HAS, ANSM, Conseil scientifique) engagent également leur responsabilité. Tout comme la Commission européenne, sa présidente et l’Agence européenne du médicament, ils ne pouvaient ignorer que tout indiquait, avant leur mise sur le marché, qu’elles étaient mal évaluées, donc potentiellement dangereuses. Ceci, d’autant plus que depuis près d’un an, de nombreux scientifiques les en informent et que de nombreux citoyens ont attiré leur attention sur une des dispositions du contrat signé entre la Commission européenne et Pfizer, précisant (p. 48 et 49) que les parties au contrat reconnaissent ignorer l’efficacité et les effets indésirables du « vaccin » et trouvent étranges que ces « vaccins » ne protègent soi-disant que pendant 4 mois, n’empêchent pas de contracter la maladie et rendent les « vaccinés » potentiellement contagieux, ce qui a justifié que l’on oblige pendant plusieurs mois, les « vaccinés » à porter le masque, qui reste obligatoire, même pour eux, dans les transports.

J’ajouterai qu’à un tel niveau de responsabilité, il est impossible de se prévaloir de son ignorance, surtout si, au lieu de vérifier ce que leur expliquaient de nombreux médecins, biologistes, virologues, statisticiens de renommée internationale, ils ont dénigré ces derniers, se campant dans une certitude méprisante et suffisante, les qualifiant de « complotistes », plutôt que de « lanceurs d’alerte ». Dans ce cas, les responsables publics sont tenus de s’informer de la façon la plus précise, surtout s’agissant de la santé de la population. Si, malgré tout, on ne sait pas, le simple bon sens ou même l’application du principe de précaution doivent conduire à ne pas faire prendre un risque aussi inconsidéré aux Français, femmes enceintes et enfants compris, pour une maladie dont on sait qu’elle tue peu, qu’elle tue essentiellement les personnes les plus âgées et, surtout, que de nombreux traitements existent pour la combattre. Malheureusement, tous les traitements prescrits par des médecins, faisaient l’objet de poursuites de la part du Conseil de l’Ordre pour qui « Il n’y avait pas de traitement… »

D’autre part, les victimes, fortes de la faute pénale ainsi reconnue pourront se tourner vers les responsables et, singulièrement les fabricants, pour voir les préjudices qu’ils ont subis indemnisés. Ces derniers espéraient probablement, de ce que l’on sait des contrats d’achat avec la Commission européenne, échapper à leur responsabilité civile en incluant dans ces contrats des clauses exonératoires. En d’autres termes, les fabricants et la Commission européenne, représentée par sa présidente, Ursula von der Leyen, auraient convenu que ni la Commission ni les États membres ne pourraient se retourner contre les fabricants.

La loi du 25 juillet 2021 sur la gestion de la crise sanitaire a d’ailleurs choisi d’intégrer la vaccination contre le Covid-19 au dispositif de l’Office national d’indemnisation des accidents médicaux, des affections iatrogènes et des infections nosocomiales (ONIAM), qui propose une indemnisation amiable des victimes d’accidents médicaux et se charge, le cas échéant, de poursuivre le responsable en remboursement. Mais cela signifie aussi que, s’agissant d’une procédure amiable, l’intégralité des préjudices ne sera pas réparée. Et, surtout, l’indemnisation des victimes relèvera de la Solidarité nationale. Si ce financement est, en soi, défendable, il l’est moins dans le contexte actuel.

En effet, le contribuable qui aura financé la recherche, avec les fonds d’urgences attribués par la Commission européenne aux fabricants, puis l’achat de ces substances doit maintenant assumer l’indemnisation des conséquences des injections… Pendant le même temps, le groupe Pfizer, par exemple, annonce un chiffre d’affaires, pour 2021, de 81,3 milliards de dollars, en augmentation de 95% par rapport à l’année précédente et un bénéfice record de 22 milliards de dollars.

Toutefois, on peut penser que la reconnaissance par la justice de la faute pénale des fabricants permettra, ensuite, aux victimes de se retourner directement contre eux pour obtenir l’indemnisation de leur préjudice, puisque la voie de l’ONIAM n’est qu’optionnelle et ne ferme pas la voie juridictionnelle aux victimes.

Cette plainte peut être téléchargée en fin d’article afin d’être communiquée par les victimes à leurs avocats.

FS : En quoi consiste l’empoisonnement qui fait l’objet de cette plainte ?

JPJ : Dans cette affaire, l’empoisonnement, qui est un crime consistant à donner la mort par administration d’une substance mortelle, prend plusieurs formes.

D’abord, le professeur Jean-Michel Claverie, professeur émérite de médecine, PU-PH de l’université d’Aix-Marseille, a récemment évalué la quantité d’ARNm de la protéine Spike qui pénètre le corps humain à chaque injection de l’une des substances géniques expérimentales, abusivement nommées « vaccin ». Il est parvenu à la conclusion suivante :

– Une dose du produit Pfizer délivre autant d’ARNm de la protéine Spike que ce qui est contenu dans 6,75 m³ de fluide nasal infecté par le virus.
– Le même constat peut être fait à propos du produit Moderna, qui délivre autant d’ARNm de la protéine Spike que ce qui est contenu dans 23 m³ de fluide nasal infecté par le virus.

Le professeur Claverie évoque une quantité « véritablement astronomique » d’ARNm de la protéine Spike ainsi injectée dans le corps humain.

Une de ses conclusions est que « l’injection de ces vaccins ne mime absolument pas le processus d’infection naturel par le SARS-CoV2, mais constitue une modification locale de la concentration en ARNm totalement non-physiologique pour les cellules qui l’incorporent. Même au cours d’une infection virale très virulente, on estime que le nombre de molécules d’ARN messager ne dépasse pas une centaine d’exemplaires par cellule infectée, pour les gènes viraux les plus fortement exprimés ».

L’inquiétude augmente encore lorsqu’on lit, toujours d’après le professeur Claverie, que ces produits contiennent des « impuretés totalement inattendues ».

Ainsi, « une publication récente, par le laboratoire Moderna lui-même, décrit la présence d’impuretés totalement inattendues dans le principe actif même du vaccin, dans lequel une partie de l’ARNm injecté est modifiée par une réaction chimique avec l’enveloppe lipidique des nanoparticules chargées de le véhiculer à l’intérieur des cellules. S’agissant d’une modification chimique inconnue à ce jour, dont la toxicité éventuelle n’a pas été évaluée, cette découverte aurait dû poser la question de la suspension éventuelle de l’autorisation conditionnelle de mise sur le marché, ce qui n’a pas été fait. La même modification chimique a probablement lieu également dans le vaccin BNT-162b2 de BioNTech/Pfizer (dont la composition est proche de celle de la préparation de Moderna), mais à ma connaissance, aucune vérification n’a été publiée ».

Le rapport du professeur Claverie est en téléchargement avec la plainte, au pied de l’article.

Ensuite, et c’est une information particulièrement inquiétante révélée par des travaux de recherche de mai 2021, confirmés en février 2022 : les cellules humaines auraient la capacité de transformer l’ARNm des substances géniques expérimentales en ADN et, donc, de l’intégrer à leur propre génome, entraînant des modifications du génome humain. Bien entendu, les conséquences de telles modifications, qui auront nécessairement des effets sur la descendance des personnes concernées, sont à ce jour totalement imprévisibles.

Cette découverte est d’autant plus choquante que le mécanisme de la transcriptase inverse (qui permet la transformation d’un ARNm en ADN) au sein des cellules humaines est connu depuis 1970. Les derniers travaux de 2021 et de 2022 ne font que confirmer la possibilité d’intégration de l’information délivrée par l’ARNm vaccinal injecté, dans le génome humain. Il n’y a donc plus de doute possible : les substances géniques expérimentales peuvent modifier, voire endommager le génome humain.

Que doit-on penser, lorsque le professeur Claverie ajoute que « la possibilité d’une intégration génomique, longtemps considérée comme improbable vient d’être démontrée (…) avec des quantités expérimentales d’ARNm largement inférieures à celles (…) découvertes dans les injections ARNm » ? On ne peut qu’en déduire que le risque de modification du génome est d’autant plus considérable, vu les quantités injectées aux Français.

Enfin, les travaux de Christine Cotton, biostatisticienne pour l’industrie pharmaceutique pendant 23 ans, ont révélé un autre fait scandaleux. Les essais cliniques préalables comportent d’importants biais méthodologiques, rendant peu fiables les conclusions d’efficacité. Il apparaît également que la baisse de l’immunité et les effets secondaires potentiellement dangereux pouvaient être anticipés. Ces faits étaient connus des fabricants, tout comme les autorités européennes et françaises au moment de l’autorisation en vie réelle.

Malheureusement, les chiffres vertigineux des décès et des blessures consécutifs à l’injection provenant des organismes de pharmacovigilance des pays concernés sont la preuve de cette désinvolture criminelle.

Par ailleurs, avec maintenant une année de recul, les chercheurs observent, dans tous les pays qui ont eu recours aux injections, une surmortalité inexpliquée, spécialement marquée chez les personnes de 15 à 44 ans. Or, la courbe de la surmortalité épouse parfaitement celle des campagnes vaccinales. La corrélation est telle que l’hypothèse d’une surmortalité de la population due à la vaccination est désormais avancée.

Ces éléments sont d’une extrême gravité, puisqu’ils touchent à la santé des Français, mais aussi à celle des enfants à naître, pour les femmes enceintes qui auraient reçu l’injection, et à l’espèce humaine, elle-même, dont le génome pourrait être modifié de façon aléatoire, inconnue et incontrôlée. Or, les autorités françaises ne peuvent ignorer les informations que je viens d’exposer et qui sont consignées dans la plainte.

Pourtant, les campagnes de vaccination se poursuivent aveuglément. Le chantage à l’emploi continue, la ségrégation et la discrimination sont toujours d’actualité (on rappellera qu’un passe sanitaire est toujours exigé pour entrer à l’hôpital), les menaces et les insultes ne sont qu’en sourdine. Doit-on rappeler que de nombreux responsables publics et personnalités médiatiques n’ont pas été en reste pour proférer insultes et menaces publiques contre les personnes non-injectées. Ainsi, Laurent Alexandre ou Gilbert Deray voient en elles « des criminels », à qui, renchérissent Christian Estrosi ou François Sauvadet, il faut supprimer chômage et aides sociales. Olivier Véran impute lui, sans autre procès, la responsabilité du Covid dans un Ehpad à une soignante non-injectée. Emmanuel Lechypre déclare vouloir les faire « emmener de force par des policiers », tandis que Gabriel Attal n’y voit qu’une « frange capricieuse », à qui le gouvernement promet une « vie de merde ». Dans cette ambiance délétère, CNews a dû trouver vendeur de titrer « Antivax : comment s’en débarrasser ? »

C’est pourquoi, face à des constats aussi alarmants, BonSens.org, l’AIMSIB et les autres plaignants ont décidé de déposer une plainte criminelle pour les chefs d’accusation d’empoisonnement, de complicité d’empoisonnement et de crime contre l’humanité contre tous ceux qui ont incité ou forcé, selon les cas, les Français à se faire injecter une substance, toujours au stade de l’essai clinique, mal évaluée, dont la dangerosité pouvait être anticipée et qui continue à tuer et à blesser chaque jour. Il s’agit donc d’actes criminels.

FS : Pensez-vous que les faits soient suffisamment graves pour que l’on puisse parler de crime contre l’humanité ?

JPJ : Oui. Le crime contre l’humanité est rarement invoqué devant les juridictions françaises. Il l’a été pour des crimes commis sous l’occupation nazie (Touvier, Barbie) ou pour des crimes commis à l’étranger pour lesquels la juridiction française est compétente (par exemple, le juge pénal peut poursuivre les crimes commis au Rwanda et en ex-Yougoslavie, si les responsables vivent en France).

Cependant, les faits sont là et les qualifications pénales également. Or, il ne fait pas de doute que la campagne de vaccination que nous subissons, relève de la définition du crime contre l’humanité, spécialement maintenant qu’on en mesure mieux les conséquences psychologiques, sociales, économiques et en termes de santé.

Ce qu’il importe de comprendre, c’est que le crime contre l’humanité, ce ne sont pas seulement des actes criminels isolés (forcer les Français à se faire injecter une substance potentiellement mortelle). Ce sont des actes criminels, commis de façon coordonnée par un groupe criminel, contre une population ou un groupe de population, inscrits dans un plan exécuté au nom d’un « État pratiquant une politique d’hégémonie idéologique », pour reprendre les termes de la Cour de cassation.

Ces actes, et c’est ce qui caractérise un crime aussi terrible que le crime contre l’humanité, dépassent la simple intention de tuer. Ils visent à déshumaniser les victimes, à nier leur nature humaine, à les rejeter en dehors de la communauté des Hommes, ceci, pour des motifs purement idéologiques.

Or, nous sommes bien, avec « l’idéologie vaccinale » actuelle, dans le cadre d’une politique d’hégémonie idéologique. En effet, la finalité des politiques discriminatoires, de ségrégation, de persécution et, finalement, d’empoisonnement, pratiquées depuis plus de deux ans est bien de dénier leur humanité aux personnes réfractaires. Elle a, d’ailleurs, trouvé sa synthèse dans les propos du président de la République, selon lequel, un « irresponsable », ce terme désignant une personne non-injectée, « n’est plus un citoyen ».

Comment mieux dire qu’il s’agit de retirer à cette partie de la population ce qui est le plus intimement attaché à sa personne, au sens juridique comme au sens politique : sa citoyenneté, son appartenance à la nation française, laquelle constitue son identité et, non, un artefact dont on pourrait se débarrasser. Porter atteinte à la qualité de citoyen revient ainsi à porter atteinte à la personne même, dans son identité et dans sa dignité. On rappellera, à cet égard, dans un domaine très proche, que la perte de nationalité est une sanction infamante, réservée à certaines infractions particulièrement graves.

Il y a pire encore. Nous savons désormais que les substances géniques expérimentales pourront avoir des effets sur la descendance des personnes injectées dont l’ADN aura été endommagé. En d’autres termes, les faits que dénoncent les plaignants sont, non seulement une attaque généralisée et systématique contre une population, pour reprendre les termes du code pénal, mais ils constituent également une attaque contre l’espèce humaine, elle-même, dès lors qu’existe la possibilité de modification du génome humain.

FS : Cette plainte intervient dans un contexte particulier ?

JPJ : En effet. La question des effets indésirables de ces substances a, enfin, été saisie par le Parlement, dont l’Office parlementaire d’évaluation des choix scientifiques et technologiques (Opecst) a été chargé, selon son vice-président, Gérard Longuet, de « rassembl(er) les éléments techniques et scientifiques sur les effets du vaccin ».

On remarquera d’emblée que la création de cette commission d’enquête est due à l’initiative des citoyens et non à celle des parlementaires ou d’autres responsables publics. C’est ainsi une pétition citoyenne, déposée par le docteur Devilleger, cardiologue, sur le site du Sénat qui, ayant recueilli plus de 33 600 signatures en quelques semaines, a incité les sénateurs à saisir l’Opecst. Ainsi, « constatant la forte dynamique des signatures », le Sénat « a décidé d’y donner suite sans attendre » pour « répondre aux inquiétudes qui s’expriment ». Le cycle d’auditions, qui a débuté le 28 mars, est prévu pour durer trois mois. Souhaitons que, comme l’annonce Gérard Longuet, les parlementaires « prendront (leurs) responsabilités » sur une question aussi importante pour les Français.

Par ailleurs, un colloque scientifique international s’est tenu à l’Institut hospitalo-universitaire Méditerranée, dirigé par le Pr Didier Raoult, les 30 et le 31 mars dernier et à Massy, les 1er et 2 avril, l’International Covid Summit (ICS), intitulé « Covid-19, premier bilan des connaissances et controverses scientifiques », qui a réuni de nombreux experts du monde entier. La science progresse donc, envers et contre tout a-t-on envie de dire, sur la maladie, son traitement et sur les effets des « vaccins ».

Dans ce sens, on ne peut qu’espérer que l’épisode dramatique que nous vivons nous ramènera à ce qu’est la science : le doute, la controverse, la remise en question. Lorsqu’on entre dans le monde des certitudes, comme nous l’observons avec le tout vaccinal que l’on tente d’imposer aux Français, on est dans l’idéologie, plus dans la science. Malmener la science, l’instrumentaliser ne peut, l’histoire nous l’avait pourtant déjà enseigné, que mener à des catastrophes, telle celle que nous expérimentons. Et, face à l’incurie, pour le moins, de nos responsables politiques, sourds aux souffrances que leurs politiques ont créées, la seule arme qui reste au citoyen pour mettre un terme à cette situation et pour rendre justice aux victimes, est la juridiction pénale. Nous ne doutons pas de la diligence du juge pénal, car, dans le droit humaniste qui était le nôtre avant la crise sanitaire, de tels actes sont des crimes.

La plainte avec ses pièces peut être téléchargée sur ce lien :
Télécharger la plainte

Télécharger les annexes


VISITEZ NOS BOUTIQUES EN LIGNE POUR DE MAGNIFIQUES CADEAUX:

Sur ces liens: Vintage par Michel sur Etsy

                          Vintage par Michel sur E Bay

 

La Criminelle Arnaque du COVID-19:Le département de la Défense des États-Unis a attribué un contrat pour la «recherche sur la COVID-19» en Ukraine 3 mois avant même que l’existence la Covid ne soit connue

Le monde a commencé à entendre parler d’un nouveau coronavirus au début de janvier 2020, avec des rapports faisant état d’une nouvelle pneumonie présumée comme une maladie se propageant à Wuhan, en Chine. Cependant, le monde n’a réellement connu la Covid-19 qu’en février 2020, car ce n’est que le 11 de ce mois que l’Organisation mondiale de la santé a officiellement nommé la nouvelle maladie à coronavirus, la Covid-19.

Donc, ceci étant la vérité officielle, pourquoi les données du gouvernement des États-Unis montrent-elles que le département américain de la Défense (DOD) a attribué un contrat le 12 novembre 2019 à Labyrinth Global Health INC. pour la «recherche COVID-19», au moins un mois avant l’émergence présumée du nouveau coronavirus, et trois mois avant qu’il ne soit officiellement surnommé [virus de la] Covid-19 (Coronavirus Desease 2019 ] ?

 

Cependant, les résultats choquants ne s’arrêtent pas là. Le contrat attribué en novembre 2019 pour la «recherche COVID-19» n’était pas seulement chargé de se dérouler en Ukraine, il faisait en fait partie d’un contrat beaucoup plus vaste pour un «programme de réduction des menaces biologiques en Ukraine».

Cela explique peut-être pourquoi Labyrinth Global Health collabore avec l’EcoHealth Alliance de Peter Daszak et Metabiota d’Ernest Wolfe depuis sa création en 2017.

Le gouvernement des États-Unis a un site Web appelé  » USA Spending » , une source officielle de données ouvertes sur les dépenses fédérales. Selon le site, au 12 avril 2021, le gouvernement américain a dépensé un montant époustouflant de 3630 milliards de dollars « en réponse à la COVID-19 ». Mais ce ne sont pas les seules informations sur Covid qui peuvent être trouvées sur le site.

Cachés dans la « recherche d’attribution », se trouvent des détails sur un contrat attribué par le ministère de la Défense à une société nommée  » Black & Veatch Special Projects Corp » , qui serait « une société mondiale d’ingénierie, d’approvisionnement, de conseil et de construction spécialisée dans le développement d’infrastructures ».

Le contrat a été attribué le 20 septembre 2012 et est décrit comme « Services professionnels, scientifiques et techniques ». Évidemment, c’est très vague et très probablement de peu d’intérêt pour quiconque tombe dessus. Mais il y a quelque chose de profond dans les détails qui devrait intéresser tout le monde.

L’« Historique des attributions » du contrat contient un onglet pour les « Sous-attributions » détaillant les bénéficiaires, la date d’action, le montant et une très brève description pour 115 transactions de sous-attribution. La plupart des sous-prix sont extrêmement banals pour des choses telles que « l’équipement de laboratoire pour Kiev » ou « le mobilier de bureau pour Kiev ».

Mais il y a un sous-prix qui se démarque parmi les autres, et il a été décerné à Labyrinth Global Health INC pour « SME Manuscript Documentation and COVID-19 Research ».

Un prix pour la recherche sur la Covid-19 n’est pas vraiment choquant alors que le monde est prétendument en proie à une pandémie de Covid-19, mais compte tenu du fait que le contrat de sous-traitance a été attribué le 12 novembre 2019, au moins un mois avant l’émergence présumée de le nouveau coronavirus, et trois mois avant qu’il ne soit officiellement surnommé Covid-19 [Coronavirus Desease 2019 ], le prix de la recherche sur la Covid-19 devrait être un choc pour tout le monde.

Mais le choc ne s’arrête pas là, car le lieu où le contact pour la recherche sur Covid-19 a été chargé d’avoir lieu était l’Ukraine, tout comme l’ensemble du contrat attribué par le DOD à Black & Veatch Special Projects Corp.

Les détails du contrat trouvés sur le site « USA Spending » révèlent en fait que le département spécifique du DOD qui a attribué le contact était la Defense Threat Reduction Agency (DTRA). Le contrat a été attribué le 20 septembre 2012 et conclu le 13 octobre 2020.

Bien que les détails soient vagues, le site du gouvernement américain révèle également que 21,7 millions de dollars sur les 116,6 millions de dollars de contact ont été dépensés pour un « programme de réduction des menaces biologiques en Ukraine ».

Pourquoi le ministère de la Défense a-t-il payé une entreprise qui est prétendument « une société mondiale d’ingénierie, d’approvisionnement, de conseil et de construction spécialisée dans le développement d’infrastructures », pour l’aider à mettre en œuvre un « programme de réduction des menaces biologiques en Ukraine » ?

Et pourquoi le DOD et ladite société ont-ils ensuite payé Labyrinth Global Health INC pour mener des recherches sur la COVID-19 en Ukraine au moins un mois avant l’émergence présumée du nouveau coronavirus, et trois mois avant qu’il ne soit officiellement surnommé Covid-19 ?

Fondée en 2017, Labyrinth Global Health serait une « petite entreprise détenue par des femmes avec une expertise approfondie et une expérience éprouvée dans le soutien d’initiatives pour le progrès scientifique et médical ».

Elle se décrit comme  » une organisation multiculturelle et internationale avec des bureaux dans quatre pays et une équipe d’experts aux parcours et compétences divers, notamment en microbiologie, virologie, santé mondiale, soins infirmiers en maladies infectieuses émergentes, anthropologie médicale, épidémiologie de terrain, recherche clinique, et les systèmes d’information sur la santé. »

Il se trouve que l’un de ces bureaux se trouve à Kiev, en Ukraine, que la société qualifie de «porte d’entrée vers l’Europe de l’Est».

L’équipe de direction de Labyrinth Global se compose de Karen Saylors, PHD, qui est la directrice générale ; Mary Guttieri, PHS, qui est la directrice scientifique ; et Murat Tartan qui est le directeur financier.

Karen Saylors, PhD, qui a cofondé Labyrinth Global Health, aurait travaillé dans le domaine de la santé publique internationale pendant plus d’une décennie et a passé de nombreuses années à vivre en Afrique pour établir des réseaux de surveillance mondiaux, « travailler avec des partenaires pour améliorer la politique de santé mondiale sur la détection, la réponse et le contrôle des maladies infectieuses ».

Au Labyrinthe, le Dr Saylors se spécialise dans les études qui visent à comprendre et à atténuer le risque biologique et comportemental de transmission de maladies. Le Dr Saylors a travaillé avec le réseau d’essais cliniques de l’Université d’Oxford au Vietnam sur la recherche sur la surveillance des maladies zoonotiques et continue de coordonner avec des partenaires régionaux les épidémies émergentes dans les populations animales et humaines.

Mais avec qui le Dr Karen Saylors et Labyrinth Global Health choisissent-ils de travailler ? Ce ne sont autres que « Eco Health Alliance » et « Metabiota ».

Le Dr Karen Saylors, Eco Health Alliance et Metabiota ont travaillé ensemble sur le programme « PREDICT » de l’Agence des États-Unis pour le développement international (USAID) à partir de 2009, tandis que Labyrinth Global Health a travaillé aux côtés de l’EHA et de Metabiota sur le programme PREDICT à partir de 2017.

Lancé en 2009 et financé par l’USAID, PREDICT était un système d’alerte précoce pour les maladies nouvelles et émergentes dans 21 pays. Il a été dirigé par le Davis One Health Institute de l’Université de Californie («UC») et les principaux partenaires comprenaient EcoHealth Alliance («EHA»), Metabiota, Wildlife Conservation Society et Smithsonian Institution, et comme nous venons de le révéler; Santé globale du labyrinthe. PREDICT a été un précurseur du projet plus ambitieux Global Virome.

L’USAID décrit PREDICT comme ayant apporté  » des contributions significatives au renforcement des capacités mondiales de surveillance et de diagnostic en laboratoire pour les virus connus et nouvellement découverts au sein de plusieurs groupes de virus importants, tels que les filovirus (y compris les virus Ebola), les virus de la grippe, les paramyxovirus et les coronavirus  » .

Voici l’une des nombreuses études publiées par Eco Health Alliance, Metabiota et Labyrinth Global Health prouvant le lien –

PREDICT s’est associé à l’Eco Health Alliance (EHA) à but non lucratif pour mener à bien ses efforts de 9 ans pour cataloguer des centaines de milliers d’échantillons biologiques,  » dont plus de 10 000 chauves-souris  » . Une étude financée par PREDICT en 2015 sur la « diversité des coronavirus chez les chauves-souris » comprenait également Peter Daszak, président de l’EHA, parmi ses participants.

Eco Health Alliance est répertorié comme partenaire de l’Institut de virologie de Wuhan (« WIV ») sur les pages archivées de son site Web et a été mentionné comme l’un des « partenaires stratégiques » de l’institut par le directeur général adjoint du WIV en 2018.

Notamment, la relation entre le WIV et l’établissement américain de biodéfense a été avancée par le conseiller politique de l’EHA, David R. Franz, ancien commandant du laboratoire américain d’armes biologiques à Fort Detrick.

Le Dr Shi Zhengli de WIV, alias « Batwoman », avait également travaillé avec Daszak de l’EHA sur des études liées aux chauves-souris. Dès 2005, Daszak et Zhengli menaient des recherches sur les coronavirus de type SRAS chez les chauves-souris. Plusieurs études financées par PREDICT sur les coronavirus de type SRAS et la grippe porcine comptent à la fois sur les contributions de Zhengli et de Daszak. La plus remarquable d’entre elles est peut-être une étude financée par PREDICT et NIH en 2015, qu’elle a co-écrite et intitulée : « Un groupe de coronavirus circulants de chauve-souris de type SRAS montre un potentiel d’émergence humaine ».

Pendant ce temps, Nathan Wolfe est le fondateur de Metabiota et de l’organisation à but non lucratif Global Viral. Il a passé plus de huit ans à mener des recherches biomédicales en Afrique subsaharienne et en Asie du Sud-Est. Sans surprise, le juif Wolfe est un  leader mondial du Forum économique mondial. Plus particulièrement, depuis 2008, il était membre du DSRC (Defense Science Research Council) de la DARPAjusqu’à sa dissolution.

Toutes ces personnes et organisations travaillent depuis au moins la dernière décennie à étudier les coronavirus et à aider à mettre en place des Biolabs en Ukraine. Tous utilisent des fonds du département américain de la Défense pour le faire. Vous pouvez en savoir plus à ce sujet iciici et ici.

Laissant de côté pour l’instant les biolabs en Ukraine, revenons au sujet de la Covid-19. Si le gouvernement américain finançait la recherche sur la Covid-19 avant que l’existence de la Covid-19 ne soit connue du public, cela suggère qu’ils savaient soit que la Covid-19 existait naturellement, soit qu’ils étaient impliqués dans la construction de ce virus dans un laboratoire.

Mais si les preuves contractuelles ne suffisent pas pour que vous parveniez à cette conclusion (ce devrait être le cas), alors associez-les peut-être à des preuves que l’Institut national américain des allergies et des maladies infectieuses (NIAID) et Moderna avaient un candidat coronavirus dans Décembre 2019 le sera.

Un accord confidentiel qui peut être consulté ici, stipule que les fournisseurs « Moderna » aux côtés de « l’Institut national des allergies et des maladies infectieuses » (NIAID) ont accepté de transférer les « candidats vaccins contre le coronavirus à ARNm » développés et détenus conjointement par le NIAID et Moderna aux destinataires. L’Université de Caroline du Nord à Chapel Hill’ le 12 décembre 2019.

L’accord a également été signé par deux représentants du NIAID, dont Amy F. Petrik PhD, spécialiste du transfert de technologie qui a signé l’accord le 12 décembre 2019 à 8h05. L’autre signataire était Barney Graham MD PhD, chercheur pour le NIAID, mais cette signature n’était pas datée.

Les derniers signataires de l’accord étaient Sunny Himansu, enquêteur de Moderna, et Shaun Ryan, conseiller général adjoint de Moderna. Les deux signatures ont été faites le 17 décembre 2019.

Toutes ces signatures ont été faites avant toute connaissance de l’émergence présumée du nouveau coronavirus. Ce n’est que le 31 décembre 2019 que l’Organisation mondiale de la santé (OMS) a pris connaissance d’un groupe présumé de cas de pneumonie virale à Wuhan, en Chine. Mais même à ce stade, ils n’avaient pas déterminé qu’un nouveau coronavirus présumé était à blâmer, déclarant plutôt que la pneumonie était de « cause inconnue ».

Tout cela nécessite des recherches beaucoup plus poussées pour assembler toutes les pièces du puzzle, mais voici ce que nous savons définitivement jusqu’à présent :

    Un nouveau coronavirus est apparu à Wuhan en décembre 2019.

    Le monde n’a entendu parler de ce nouveau coronavirus que début janvier 2020.

    Le monde ne savait pas que ce nouveau coronavirus s’appelait  Covid-19 jusqu’en février 2020, lorsque l’Organisation mondiale de la santé l’a officiellement nommé ainsi.

    Le département américain de la Défense a attribué un contrat de services professionnels, scientifiques et techniques à Black & Veatch Special Projects Corp‘, qui serait « une société mondiale d’ingénierie, d’approvisionnement, de conseil et de construction spécialisée dans le développement d’infrastructures ».

    Ce contrat concernait un programme de réduction des menaces biologiques en Ukraine.

    Dans le cadre de ce contrat plus important, un autre contrat a été attribué à Labyrinth Global Health pour la «recherche COVID-19» le 12 novembre 2019.

    Ce prix a été décerné au moins un mois avant l’émergence présumée du nouveau coronavirus et trois mois avant qu’il ne soit officiellement surnommé [virus de la maladie – MIRASTNEWS] Covid-19.

    Labyrinth Global Health travaille aux côtés de « Eco Health Alliance » et de « Metabiota », et a participé au programme USAID PREDICT. Toutes ces personnes et organisations travaillent depuis au moins la dernière décennie à étudier les coronavirus et à aider à mettre en place des Biolabs en Ukraine. Tous utilisent des fonds du département américain de la Défense pour le faire.

    Les informations trouvées ici indiquent qu’Eco Health Alliance a participé à la création du virus de la Covid-19.

    Les informations trouvées ici indiquent que Moderna a participé à la création du virus de la Covid-19.

    « Moderna », aux côtés du « National Institute of Allergy and Infectious Diseases » (NIAID), a accepté de transférer des « candidats de vaccins contre le coronavirus à ARNm » développés et détenus conjointement par le NIAID et Moderna, aux destinataires « l’Université de Caroline du Nord à Chapel Hill » le le 12 décembre 2019.

A quoi tout cela renvoie-t-il ? C’est à vous de réfléchir et de décider. Mais nous vous promettons qu’il y a beaucoup plus à venir sur ce qui précède…

Traduction : MIRASTNEWS


Je vous invite à visiter nos  boutiques en ligne conçues pour financer notre site web:

Sur ce lien: Vintage par Michel sur Etsy

Sur cet autre lien:Vintage par Michel sur E Bay

Le film du mois pour souligner la fête de Paques:Risen de 2016

 

L’HISTOIRE DU FILM

À Jérusalem lors des quarante jours qui succèdent à la résurrection du Christ, puis en Galilée. Clavius, un tribun militaire romain, et son aide de camp Lucius sont mandatés par Ponce Pilate pour superviser la crucifixion d’un juif nommé Jésus de Nazareth. Après la mort du condamné et sous la pression du Sanhédrin, Pilate ordonne de faire sceller et garder le tombeau mais le lendemain, les deux sentinelles ont disparu et le tombeau est vide. Pilate charge Clavius d’enquêter sur la disparition du corps du Nazaréen. Pourchassant les disciples du Christ soupçonnés d’avoir enlevé le corps, Clavius se convertit progressivement lorsqu’il les retrouve dans une petite maison de Jérusalem autour de Jésus ressuscité. Il finit par les rejoindre en Galilée. Pilate, se sentant trahi, envoie Lucius le tuer, mais Clavius s’en va se perdre au désert, incertain de ce qu’il a vu.

 

 

 

 

 

 

 

 

 

 

Mon évaluation

Il s’agit de mon film biblique favori car il fait un lien avec d’autres univers,entre la vision antique des dieux et la notre qui y voit une intervention extraterrestre.

 

 

 

la nouvelle monnaie de réserve mondiale basée sur les ressources annonce que les USA entreront rapidement en guerre contre la Russie

L’inévitable va se produire? aujourd’hui les intentions de la Russie sont de plus en plus claires et l’opinion américaine commence à trembler :
En effet, la guerre en Ukraine est pire que ce qu’on pensait : c’est bien évidement la troisième guerre mondiale et chaque pays devrait en tenir compte .
La Russie pendant l’invasion de l’Ukraine a balayé d’un revers de la main toutes les sanctions de l’OTAN , Parce qu’elle est capable de garantir sur un minimum de deux ans son auto suffisance alimentaire et son pouvoir d’achat interne :
c’est dire qu’il est impossible en moins de deux ans de voir surgir en Russie un soulèvement populaire de grande envergure contre le pouvoir et ce quel que soit l’issue de la guerre en Ukraine et ça , le président Poutine l’a bien compris depuis longtemps .
Les réserves des banques russes en dollars s’élevaient avant la guerre à plus de 350 milliards de dollars USA :
cette somme a bien évidement été gelée par l’OTAN avec Pour conséquence la chute drastique du rouble Russe ! Mais à la grande surprise de tous , Mr Poutine a déclaré que désormais l’achat de son pétrole et son gaz à destination des pays hostiles se feront en roubles russes et plus en dollars! et en moins de 48heures, le rouble Russe a repris une remontée en flèche sur les marchés internationaux et pire les chinois depuis quelque temps commencent à diminuer leurs réserves en dollars car ils disposent d’un peu plus de 900 milliards de dollars de réserve dans les banques américaines .
L’Inde, le Pakistan et de nombreux pays effectuent déjà des transactions avec la Chine et la Russie en contournant le dollar et récemment , l’Inde a acheté du pétrole et du gaz en Russie en transitant par un échange direct entre le rouble et le roupie .
La Chine depuis un an essaye de positionner le yuang chinois comme la monnaie de référence après le dollar et la guerre en Ukraine est une bonne option pour elle.
Xi Jinping (à gauche) a nommé Zhao Lijian (photo de droite) à la tête de l’un de ses plus importants ministères politique,l’an passé.
Le président Biden vient en fait de se rendre compte du vrai problème: la guerre est monétaire ! La troisième guerre mondiale de la Russie a pour but de détruire l’Amérique par l’anéantissement du pouvoir de monnaie de référence du dollar.
La Russie veut descendre le dollar et par là la toute puissance américaine et ce quelque soit le prix à payer .
Les États Unis vivent grâce au dollars et Biden le sait très bien , bien qu’étant le pays le plus endetté du monde , ils restent économiquement tous puissants grâce à la plate forme incontournable (?) qui est le dollar et son système swift .
Aujourd’hui, Poutine et ses allliés veulent découdre le dollar et inciter tous les pays qui auraient une devise à valoriser leur monnaie locale pour ne plus dépendre du dollar qui recevra une chute drastique si cette guerre ne prend pas fin rapidement .
La récente visite de Biden en Pologne en dit long : la situation est très grave ! Si l’Europe se sent obligée elle aussi de tout acheter à la Russie en rouble , le monde aura deux monnaies de référence très fortes : il s’agira du rouble pour l’Europe et le yuan chinois Pour le reste du monde , le dollar américain s’effondrera complètement et ce sera la fin des USA comme puissance économique.
Les protestations violentes contre la mort de George Floyd, l’Afro-américain tué à Minneapolis par un policier, durent maintenant depuis trop longtemps.
Les USA n’admettront jamais cette situation .
Biden en Pologne prépare donc la guerre : il veut utiliser la Pologne et ce qui restera de l’Ukraine après la séparation évidente qu’il y’aurait après le référendum annoncé dans les milieux de séparatistes pro russes , comme bases arrières de repli pour l’armée de terre qui fera son assaut sur la Russie .
La Russie en profitera pour détruire totalement la Pologne et ce qui restera de l’OTAN disloqué en Europe .
La guerre nucléaire aura bien lieu .
Cette guerre se précise de plus en plus et son ampleur est presque inévitable.
Ces jours-ci , le congrès américain voterait pour une entrée effective des USA en guerre car il est inadmissible que le dollar perde sa place de référence mondiale .
La confrontation tant évitée entre les deux super-puissances mondiales aura bien lieu et le monde en pâtira en dehors du continent asiatique qui fera très vite allégeance à la super puissance chinoise qui la protégera.
L’Afrique qui importe presque tout de l’Occident subira de plein fouet cette guerre et multipliera les coups d’état militaires qui augmenteront la pauvreté et sa ruine .
Le ton commence à baisser en Europe avec de plus en plus des voix qui s’élèvent contre les USA à l’instar des candidats Melanchon et Zemour qui trouvent que la France devrait cesser de suivre les USA comme un chien au détriment des français qui souffrent déjà beaucoup .
Les USA mèneront seuls leur guerre pour leur monnaie, puisque nous assisterons bientôt à la dislocation de l’OTAN avec de nombreux pays qui quitteront le bateau avec la France en premier , suivie de l’Allemagne et ensuite de l’Italie et de l’Espagne .
Nous pouvons déjà affirmer sans risque de nous tromper que les USA se sont faits piégés par la Russie qui n’a jamais avalé la pilule amère de la dislocation de l’URSS et de la chute du mur de Berlin et surtout , du non respect des accords qui s’en sont suivis .
Aujourd’hui est il tard ? Eh bah oui ! Il est tard .
La Russie ne quitera pas l’Ukraine sans la diviser .
L’Europe ne se passera pas du gaz et du pétrole russe sauf si les USA ruinent leurs économies en voulant vendre au continent européen un gaz plus cher parce qu’il sera liquéfié .
Le yuang chinois prendra le dessus des échanges parmi les pays du BRICS et se positionnera devant un dollar plus affaibli que jamais .
La guerre entre les USA et la Russie détruira totalement l’Ukraine et la Pologne; Une Russie affaiblie ainsi que les USA totalement ruinés avec tout le continent européen et même l’Afrique verront le jour d’après .
La première puissance économique mondiale sera la Chine suivie de l’Inde , etc .
La puissance des USA tient au Dollar : s’ils entrent en guerre contre la Russie avec d’un côté le yuang chinois qui veut devenir la monnaie de référence, ils n’auront jamais le temps de concilier les deux : la guerre fera rapidement chuter le dollar , et le yuang montera en flèche rendant caduque l’économie américaine.
Que faire : le président Biden n’est peut être pas le bon interlocuteur qu’il faut face à Poutine: l’Amérique devrait trouver le
meilleur moyen de rétablir un dialogue franc entre les USA et la Russie .
L’Amérique n’a pas besoin d’entrer directement ou indirectement en guerre .
L’Europe devrait sacrifier absolument l’Ukraine et se désolidariser de l’alliance atlantique pour sauver le continent si c’est encore possible .
La dislocation de l’OTAN devrait s’accélérer après les prochaines élections en France et très vite si Macron vient à perdre le pouvoir .
Les américains doivent tout faire pour garder les bonnes relations avec le continent européen y compris la Russie et tous ceux qui sortiront de l’OTAN , pour garantir leur stabilité , plus comme première puissance économique du monde , mais comme deuxième derrière la Chine sinon ce sera la fin de leurs unions avec une possible division des USA .
La troisième guerre mondiale se précise de plus en plus devant nous et elle se fait contre le dollar .
S‘il y‘a une guerre entre la russie Et les usa ça sera problablement une guerre nucléaire Et problablement la fin de l‘humanité pour les personnes resident dans ces régions.

Une nouvelle réalité est en train de se former 
Une nouvelle réalité est en train de se former : le monde unipolaire est en train de devenir irrévocablement une chose du passé, un monde multipolaire est en train de prendre forme.
Il fallait voir ça. Dmitri Medvedev, ancien président russe, atlantiste impénitent, actuel vice-président du Conseil de sécurité russe, a décidé de se lâcher totalement dans un déchaînement à la hauteur de la prestation de sieur Khinzal [Khinzal=une des nouvelles armes russes – NdT], qui a provoqué « choc et effroi » palpable à travers tout l’OTAN.
Medvedev a déclaré que les sanctions occidentales « infernales » non seulement n’ont pas réussi à paralyser la Russie, mais qu’au contraire, elles  » retournent à l’Ouest comme un boomerang « . La confiance dans les monnaies de réserve « s’estompe comme la brume du matin », et abandonner le dollar américain et l’euro n’est plus irréaliste : « L’ère des monnaies régionales arrive ».

Après tout, a-t-il ajouté, « qu’ils le veuillent ou non, ils devront négocier un nouvel ordre financier (…) Et la voix décisive sera alors celle des pays qui ont une économie forte et avancée, des finances publiques saines et un système monétaire fiable. »

Medvedev a relayé son analyse succincte avant même le jour J ; la date limite fixée par le président Poutine après laquelle les paiements du gaz russe par les « nations inamicales » ne seront acceptés qu’en roubles.

Le G7, comme on pouvait s’y attendre, avait pris une position (collective) : nous ne paierons pas. « Nous » signifie les 4 qui ne sont pas de grands importateurs de gaz russe. « Nous », en outre, c’est l’Empire du Mensonge qui dicte les règles. Quant aux 3 qui seront en grande difficulté, non seulement ils sont de grands importateurs mais ils se trouvent être des vaincus de la Seconde Guerre mondiale – l’Allemagne, l’Italie et le Japon, toujours territoires occupés de facto. L’histoire a l’habitude de jouer des tours pervers.

Le déni n’a pas duré longtemps. L’Allemagne a été la première à rompre, avant même que les industriels de la Ruhr à la Bavière ne se révoltent en masse. Scholz, le chétif chancelier, a appelé Poutine, qui a dû expliquer l’évidence : les paiements sont convertis en roubles parce que l’UE a gelé les réserves de change de la Russie, en violation flagrante du droit international.

Avec une patience taoïste, Poutine a également exprimé l’espoir que cela ne représente pas une détérioration des conditions contractuelles pour les importateurs européens. Les experts russes et allemands devraient s’asseoir ensemble et discuter des nouvelles conditions.

Moscou travaille sur une série de documents définissant le nouvel accord. Essentiellement, cela signifie : pas de roubles, pas de gaz. Les contrats deviennent nuls et non avenus dès lors que vous violez la confiance. Les États-Unis et l’Union européenne ont rompu des accords légaux en imposant des sanctions unilatérales et, de surcroît, ont confisqué les réserves de change d’un pays – nucléaire – du G20.

Les sanctions unilatérales ont rendu les dollars et les euros sans valeur pour la Russie. L’hystérie ne suffit pas : le problème sera résolu, mais aux conditions de la Russie. Un point c’est tout. Le ministère des affaires étrangères avait déjà prévenu que le refus de payer le gaz en roubles entraînerait une grave crise mondiale de non-paiements et de faillites en série au niveau mondial, une réaction en chaîne infernale de transactions bloquées, de gel des actifs collatéraux et de fermetures de lignes de crédit.

La suite des événements est partiellement prévisible. Les entreprises de l’UE recevront le nouvel ensemble de règles. Elles auront le temps d’examiner les documents et de prendre une décision. Celles qui diront « non » seront automatiquement exclues des livraisons directes de gaz russe, avec toutes les conséquences politico-économiques que cela implique.

Il y aura bien sûr des compromis. Par exemple, un certain nombre de nations de l’UE accepteront d’utiliser des roubles et d’augmenter leurs acquisitions de gaz afin de pouvoir revendre le surplus à leurs voisins et réaliser un bénéfice. Et certains pourraient également décider d’acheter du gaz sur le tas sur les bourses de l’énergie.

La Russie n’impose donc un ultimatum à personne. Tout cela prendra du temps – un processus graduel. Avec quelques actions latérales également. La Douma envisage d’étendre le paiement en roubles à d’autres produits essentiels – comme le pétrole, les métaux, le bois, le blé. Cela dépendra de la voracité collective des chihuahuas de l’UE. Tout le monde sait que leur hystérie non-stop peut se traduire par une rupture colossale des chaînes d’approvisionnement à travers l’Occident.

Bye bye les oligarques

Alors que les classes dirigeantes atlantistes sont devenues complètement folles mais restent concentrées sur la lutte jusqu’au dernier Européen pour extraire toute richesse palpable qui subsiste de l’UE, la Russie joue la carte du sang froid. Moscou a été plutôt indulgente en fait, brandissant le spectre d’une absence de gaz au printemps plutôt qu’en hiver.

La Banque centrale russe a nationalisé les recettes en devises de tous les grands exportateurs. Il n’y a pas eu de défaut de paiement. Le rouble continue de monter – et il est maintenant revenu à peu près au même niveau qu’avant l’Opération Z. La Russie reste autosuffisante sur le plan alimentaire. L’hystérie américaine concernant la Russie « isolée » est risible. Tous les acteurs qui comptent en Eurasie – sans parler des quatre autres BRICS et de la quasi-totalité des pays du Sud – n’ont pas diabolisé et/ou sanctionné la Russie.

En prime, le dernier oligarque capable d’exercer une influence à Moscou, Anatoly Chubais, a disparu. Une autre superbe ruse historique : L’hystérie des sanctions occidentales a démembré de facto l’oligarchie russe – le projet favori de Poutine depuis 2000 [1]. Ce que cela implique, c’est le renforcement de l’État russe et la consolidation de la société russe.

Nous ne disposons pas encore de tous les faits, mais on peut affirmer qu’après des années d’évaluation minutieuse, Poutine a choisi d’aller jusqu’au bout et de briser le dos de l’Occident, en utilisant comme casus belli ce tiercé : attaque éclair imminente du Donbass, laboratoires américains de fabrication d’armes biologiques, Ukraine travaillant sur des armes nucléaires.

Le gel des réserves de change devait être prévu, d’autant plus que la Banque centrale russe avait augmenté ses réserves de bons du Trésor américain depuis novembre dernier. Il y a ensuite la possibilité sérieuse que Moscou puisse accéder à des réserves étrangères offshore « secrètes » – une matrice complexe construite avec l’aide d’initiés chinois.

Le passage soudain du dollar et de l’euro au rouble est un acte de judo géoéconomique pur et dur, de niveau olympique. Poutine a incité l’Occident collectif à libérer son hystérie démente pour sanctionner l’attaque – et l’a retournée contre l’adversaire en un seul geste rapide.

Et nous voilà tous en train d’essayer d’absorber tant de développements simultanés qui changent la donne suite à l’armement des actifs en dollars : le roupie-rouble avec l’Inde, le petroyuan saoudien, les cartes Mir-UnionPay co-badgées émises par les banques russes, l’alternative SWIFT Russie-Iran, le projet EAEU-Chine d’un système monétaire/financier indépendant.

Sans parler du coup de maître de la Banque centrale russe, qui a fixé le prix d’un gramme d’or à 5000 roubles – qui avoisinent déjà 60 dollars et ne cessent de grimper.

Si l’on ajoute à cela le programme « Pas de roubles, pas de gaz », nous avons là une énergie de facto liée à l’or. Les chihuahuas de l’UE et la colonie japonaise devront acheter beaucoup de roubles en or ou acheter beaucoup d’or pour avoir leur gaz. Et il y a mieux. La Russie pourrait ré-arrimer le rouble à l’or dans un futur proche. On pourrait passer à 2 000 roubles, 1 000 roubles, voire 500 roubles pour un gramme d’or.

Le temps de la souveraineté

Depuis les sommets des BRICS dans les années 2000, auxquels ont participé Poutine, Hu Jintao et Lula, le Saint Graal des discussions sur un monde multipolaire a toujours été de savoir comment contourner l’hégémonie du dollar. Cette solution se trouve maintenant sous les yeux de l’ensemble du Sud, sous la forme d’une apparition bénigne arborant un sourire de chat du Cheshire : le Rouble-or, ou Rouble adossé au pétrole, au gaz, aux minéraux, aux exportations de matières premières.[2]

La Banque centrale russe, contrairement à la Fed, ne pratique pas l’assouplissement quantitatif (1) et n’exporte pas d’inflation toxique vers le reste de la planète. Non seulement la marine russe sécurise toutes les lignes maritimes russes, mais les sous-marins russes à propulsion nucléaire sont capables de surgir partout sur la planète à l’improviste.

La Russie est loin, très loin en avance, mettant déjà en œuvre le concept de « puissance navale continentale ». Décembre 2015, sur le théâtre syrien, a changé la donne stratégique. La 4e division de sous-marins basée en mer Noire est la vedette du spectacle.

Les flottes navales russes peuvent désormais employer des missiles Kalibr dans un espace comprenant l’Europe de l’Est, l’Asie occidentale et l’Asie centrale. La mer Caspienne et la mer Noire, reliées par le canal Don-Volga, offrent un espace de manœuvre comparable à celui de la Méditerranée orientale et du golfe Persique réunis. 6000 km de long. Et il n’est même pas nécessaire d’accéder aux eaux chaudes.

Cela couvre environ 30 nations : la sphère d’influence traditionnelle de la Russie, les frontières historiques de l’empire russe et les sphères de rivalité politique/énergétique actuelles.

Pas étonnant que Washington soit furieux.

La Russie garantit le transport maritime à travers l’Asie, l’Arctique et l’Europe, en tandem avec le réseau ferroviaire « Belt and Road Initiative » à l’échelle de l’Eurasie.

Et enfin, mais pas des moindres, on ne badine pas avec un ours nucléaire.

Voilà en substance ce qu’est la politique de puissance pure et dure. Medvedev ne s’est pas vanté lorsqu’il a déclaré que l’ère d’une monnaie de réserve unique était révolue. L’avènement d’une monnaie de réserve mondiale basée sur les ressources signifie, en résumé, que 13 % de la planète ne domineront plus les 87 % restants.

C’est le NATOstan contre l’Eurasia à nouveau. Guerre froide 2.0, 3.0, 4.0 et même 5.0. Cela n’a pas d’importance. Toutes les anciennes nations du Mouvement des non-alignés (MNA) savent de quel côté soufflent les vents géopolitiques et géoéconomiques : le moment est venu d’affirmer leur véritable souveraineté alors que l’ »ordre international fondé sur des règles » mord la poussière.

Bienvenue à la naissance du nouveau système mondial. Le ministre des affaires étrangères Sergei Lavrov, en Chine, après avoir rencontré plusieurs homologues de toute l’Eurasie, n’aurait pas pu mieux le décrire :

« Une nouvelle réalité est en train de se former : le monde unipolaire est en train de devenir irrévocablement une chose du passé, un monde multipolaire est en train de prendre forme. C’est un processus objectif. Il est irréversible. Dans cette réalité, plus d’une puissance « gouvernera » – il sera nécessaire de négocier entre tous les États clés qui ont aujourd’hui une influence décisive sur l’économie et la politique mondiales. En même temps, conscients de leur situation particulière, ces pays veilleront à respecter les principes de base de la Charte des Nations unies, y compris le principe fondamental – l’égalité souveraine des États. Personne sur cette Terre ne doit être considéré comme un acteur mineur. Tout le monde doit être égal et souverain. »

Pepe Escobar

————————————————————

COMMENTAIRES

1- Déjà dépassés par la force de frappe au niveau militaire, les Européens vont devoir redescendre au plus vite sur terre, car la force de frappe alimentaire russe est bien plus puissante. Medvedev le rappelle  : « Il se trouve que la sécurité alimentaire de nombreux pays dépend de nos approvisionnements. Il s’avère que notre nourriture est notre arme silencieuse. Et si quelqu’un ne sait pas ou a oublié, alors l’exportation de nos produits agricoles dépasse l’exportation d’armes réelles — elle s’élevait à plus de 37 milliards de dollars l’année dernière. »

2-L’inflation dans la zone euro atteint un niveau historique

La flambée des prix de l’énergie en est le principal moteur, selon les données.

Les prix à la consommation dans les 19 pays utilisant l’euro ont augmenté de 7,5 % en rythme annuel en mars, selon les données publiées vendredi par l’agence statistique de l’Union européenne. La flambée des coûts de l’énergie est le principal facteur d’augmentation de l’inflation, selon Eurostat.

C’est le cinquième mois consécutif que l’inflation dans la zone euro établit un record, ce qui la porte au niveau le plus élevé depuis le début de la comptabilisation de l’euro en 1997. Le dernier relevé a pulvérisé le sommet de 5,9 % atteint en février.

3- Le géant allemand de la chimie BASF a mis en garde contre les conséquences dramatiques d’une interruption de l’approvisionnement en gaz en provenance de Russie, a rapporté mercredi le journal allemand Frankfurter Allgemeine.

Si l’approvisionnement en gaz était réduit de moitié, l’usine de Ludwigshafen – le plus grand site chimique du monde, qui emploie près de 40.000 personnes – devrait fermer ses portes, a déclaré Michael Vassiliadis, président d’un syndicat de la chimie et membre du conseil d’administration de BASF, cité par le journal.

Si l’approvisionnement en gaz était inférieur à 50%, le site ne pourrait plus fonctionner de manière stable et devrait être complètement fermé, a expliqué M. Vassiliadis. Si la perte du gaz russe n’était pas compensée, les effets sur l’industrie chimique seraient dramatiques, la panne coûtant « des centaines de milliers d’emplois sur une période relativement courte » et affectant l’approvisionnement, a-t-il ajouté.

Le PDG de BASF, Martin Brudermüller, a déclaré précédemment qu’il n’y avait aucun moyen de remplacer le gaz russe à court terme, mais que le groupe travaillait intensivement à la réduction de sa dépendance au gaz.

Le rapport du Frankfurter Allgemeine souligne que l’industrie chimique ne peut fonctionner sans pétrole ni gaz, et que sans ce secteur, l’économie s’arrête, car les gens en dépendent fortement dans leur vie quotidienne.

Les produits pétrochimiques représentent 20% des vêtements, 40 % des produits cosmétiques et même 35% de l’aspirine, un produit essentiel dans la pharmacie de la plupart des familles.


NOTES 

[1] Voir  mon article sur :La face cachée des oligarques juifs

–  Ukraine / Russie. Le rôle sous-jacent des oligarques juifs

[2] Poutine réalise aujourd’hui ce que Kadhafi voulait réaliser :

Emails Clintoniens. Ben Ali, Kadhafi et Moubarak ont été « dégagés » par Washington parce qu’ils voulaient remplacer le dollar par le Dinar-or !:
Dans un e-mail récemment déclassifié adressé à la  secrétaire d’État Hillary Clinton en date du 2 avril 2011, Sid Blumenthal révélait  la raison pour laquelle Kadhafi doit être éliminé. Citant une  « source haut placée » non identifiée, Blumenthal écrit à Clinton : « Selon les informations sensibles disponibles auprès de cette source, le gouvernement de Kadhafi détient 143 tonnes d’or, et une quantité similaire en argent … Cet or a été accumulé avant l’actuel soulèvement  et était destiné à être utilisé pour créer une monnaie panafricaine basée sur le Dinar-or libyen. Ce plan a été conçu pour fournir aux pays africains francophones une alternative au franc français (CFA.  » . Cette mention  était seulement la partie apparente de l’iceberg du Dinar-or de Kadhafi.

Le timing du printemps arabe, rétrospectivement, semble de plus en plus lié aux efforts déployés par  Washington et Wall Street  pour contrôler non seulement les énormes flux de pétrole arabe du Moyen-Orient. Il est maintenant clair,  qu’il  s’agissait également de contrôler leur argent, leurs milliers de milliards de dollars accumulés dans leurs nouveaux fonds souverains.

Cependant, comme cela a été confirmé dans le dernier échange d’e-mails entre  Clinton et Blumenthal en date du 2 avril  2011, il y avait une nouvelle menace qui pesait sur  Wall Street et la City de Londres, « dieux d’argent », émanant du  monde du pétrole arabe et africain.

Le Libyen Kadhafi, le Tunisien Ben Ali  et l’Égyptien Moubarak étaient sur le point de lancer une monnaie islamique basée sur l’or,  indépendante du dollar américain.
Ce plan a été éventé pour la première fois, début de 2012, lors d’une conférence financière et géopolitique en Suisse, par un Algérien ayant une connaissance approfondie du projet. Les données étaient rares à l’époque, mais maintenant, la situation renvoie une image beaucoup plus nette qui met en perspective la cruauté  du Printemps arabe de Washington et de ses harkis islamistes et de son urgence dans le cas de la Libye, souligne le « New Eastern Outlook.

[HillaryLeaks] Le projet panafricain de « dinar-or » derrière la guerre en Libye et l’élimination de Kadhafi

Un échange de courriels déclassifiés entre l’ancienne secrétaire d’État américaine Hillary Clinton et son conseiller Sid Blumenthal montre que Clinton était totalement impliquée dans la conspiration occidentale contre le dirigeant libyen Mouammar Kadhafi et sa  monnaie panafricaine le dinar-or, comme le raconte F. William Engdahl.

Kadhafi n’a pas été le seul dirigeant arabe qui a cherché à détourner ses revenus pétroliers vers des fonds contrôlés par l’État plutôt que de faire confiance aux banquiers de Londres et de New York, après que la guerre américaine contre le terrorisme ait débuté au Moyen-Orient et en Asie centrale.

«En 2008, la perspective d’un contrôle souverain par un nombre croissant d’États pétroliers arabes et africains de leurs revenus pétroliers et gaziers d’État a suscité de graves préoccupations à Wall Street, ainsi qu’à Londres. On parle d’énormes quantités de liquidités, des trillions de dollars qui ne seraient potentiellement plus contrôlés», poursuit Engdahl.

Pendant ce temps, en 2009, Kadhafi, alors président de l’Union africaine, a offert aux États du continent de passer à une nouvelle monnaie, indépendante du dollar américain, le soi-disant dinar-or.

Selon le chercheur, l’idée exprimée par le leader libyen a reçu les éloges de Ben Ali le Tunisien et de l’Égyptien Moubarak.

Kadhafi a appelé les pays africains à créer une alliance monétaire faisant du dinar-or le principal moyen de paiement du pétrole et d’autres ressources.

«Avec les fonds souverains pétroliers des pays arabes de l’OPEP, d’autres pays africains producteurs de pétrole, en particulier l’Angola et le Nigeria, ont commencé des actions pour créer leurs propres fonds nationaux avec la richesse pétrolière au moment où l’OTAN bombardait la Libye en 2011», écrit Engdahl, ajoutant que ces fonds souverains nationaux étaient censés rendre l’Afrique indépendante du contrôle monétaire colonial.

Le rêve des pays africains était en même temps un cauchemar pour les élites financières occidentales.

À la lumière de cela, il est peu surprenant que Wall Street et la City de Londres aient jeté tout leur poids derrière la campagne dirigée par l’OTAN contre le leader libyen rebelle.

Engdahl attire l’attention sur le fait qu’il y avait quelque chose de très louche derrière l’idée des islamistes libyens soutenus par les États-Unis de créer une banque centrale de style occidental en exil (ainsi que leur propre compagnie pétrolière) au milieu de la lutte acharnée contre le gouvernement de Kadhafi.

Le chercheur cite Robert Wenzel qui a écrit dans l’Economic Policy Journal qu’il n’a «jamais entendu parler d’une banque centrale créée seulement quelques semaines après un soulèvement populaire».

«Cela laisse penser que nous avons un peu plus qu’un tas de rebelles en action et qu’il y a des influences assez sophistiquées», a souligné Wenzel.

Les intérêts sophistiqués mentionnés ci-dessus pourraient avoir été liés aux pontes de Wall Street et aux banquiers londoniens qui ont cherché à éliminer l’idée d’une monnaie panafricaine.

«Le rêve de Kadhafi d’un système monétaire arabe et africain basé sur l’or et indépendant du dollar est malheureusement mort avec lui», note Engdahl.

L’histoire n’est pas encore finie : une nouvelle alliance monétaire soutenue par l‘or émerge à l’Est, menaçant à nouveau l’hégémonie du dollar américain. Ce groupe, dirigé par la Chine et la Russie, constitue un tout nouveau défi à la domination monétaire de l’Amérique, ainsi que le remarquent des chercheurs.


CONCLUSION D’AUJOURD’HUI

La guerre nucléaire se profile à l’horizon

 

« …

Certains lecteurs ont demandé pourquoi la Russie considère l’adhésion de la Finlande à l’OTAN comme une provocation. Pour la même raison que l’adhésion de l’Ukraine est une provocation : Des bases de missiles américaines à la frontière de la Russie. Les États-Unis ne disposent pas actuellement de missiles hypersoniques, mais ils en disposeront tôt ou tard. De tels missiles aux frontières de la Russie pourraient atteindre Moscou en 3 ou 4 minutes, ce qui constitue clairement une menace existentielle. Outre la Finlande, Washington veut des bases en Suède et dans les États baltes, et possède déjà des bases de missiles en Pologne et en Roumanie.

Si Washington considère l’adhésion de la Finlande à l’OTAN comme une nouvelle provocation, nous ne devons pas oublier deux autres provocations existantes que le Kremlin a déclarées inacceptables : les bases de missiles existantes en Pologne et en Roumanie. Il est absurde pour la Russie d’empêcher de manière préventive l’installation de bases de missiles en Ukraine et en Finlande tout en permettant le maintien des bases existantes en Pologne et en Roumanie. L’intervention russe contre ces deux bases est probablement la prochaine action d’autodéfense que les Russes entreprendront.

Les médias prostitués de l’Occident ont fait de leur mieux pour créer une indignation mondiale contre la Russie. Les personnes excitées par l’indignation ne perçoivent pas l’irresponsabilité des gouvernements occidentaux qui menacent gratuitement la Russie avec des bases de missiles à ses frontières. Au lieu de percevoir correctement l’installation de ces bases comme une agression contre la Russie, les personnes endoctrinées considèrent la réponse de la Russie aux menaces existentielles comme une agression.

Je souligne depuis des années que ces provocations de la Russie finiront par franchir une ligne rouge et entraîner une guerre nucléaire. J’ai longtemps critiqué le Kremlin pour ne pas avoir mis fin à ces provocations en posant un pied ferme. La Russie a eu cette opportunité en Ukraine, mais le Kremlin a choisi une voie qui n’a pas réussi à donner l’impression nécessaire que les pays qui s’accommodent de l’agression américaine contre la Russie connaîtront la dévastation. Il est moins risqué de faire cette démonstration dans un pays non-OTAN que dans un pays OTAN. En outre, le Kremlin a attendu beaucoup trop longtemps avant d’intervenir en Ukraine, donnant ainsi aux États-Unis huit ans pour armer et entraîner les forces ukrainiennes. En tergiversant en Ukraine, la Russie sera à nouveau confrontée au même problème en Finlande ou ailleurs, en plus des deux bases existantes dans deux pays membres de l’OTAN à la frontière de la Russie. Il ne fait aucun doute que les États-Unis et l’OTAN ont tracé un chemin qui mène tout droit à la guerre nucléaire. Comme rien de ce qui est en dehors du récit ne peut être publié ou discuté dans le monde occidental, rien ne peut être fait pour arrêter cette course folle vers la guerre nucléaire. Il n’est même pas possible de discuter de cette menace dans les cercles de politique étrangère occidentaux. Une fois de plus, le monde se dirige vers la guerre en somnambule, mais cette guerre sera nucléaire et sera la guerre finale.

Tout ce que le Kremlin a obtenu avec sa retenue et sa confiance dans la négociation avec l’Occident, c’est d’intensifier le rythme et le niveau des provocations. M. Stoltenberg, de l’OTAN, courtise la Finlande et la Suède pour qu’elles adhèrent à l’OTAN en leur promettant que leur adhésion serait accélérée et qu’elles bénéficieraient probablement d’autres avantages, notamment des sommes d’argent considérables. Ce rapport devrait réveiller les gens sur la situation réelle, qui est un conflit en expansion.

VOIR L’ARTICLE SUIVANT:

https://www.zerohedge.com/geopolitical/finland-sweden-nato-applications-could-be-imminent-after-stoltenberg-suggests-fast

À un moment donné, des considérations existentielles obligeront la Russie à prendre l’initiative et à cesser de répondre à l’agenda de Washington.


JE VOUS INVITE À VISITER NOS BOUTIQUES EN LIGNES POUR VOS CADEAUX FUTURS

Sur ce lien :Sur Etsy :Vintage par Michel 
                     Sur E Bay: Vintage par Michel

Selon Larry C. Johnson: « L’armée ukrainienne a été vaincue. Ce qui reste est du ratissage »

Question 1– Pouvez-vous m’expliquer pourquoi vous pensez que la Russie est en train de gagner la guerre en Ukraine ?

Larry C. Johnson– Au cours des 24 premières heures de l’opération militaire russe en Ukraine, toutes les capacités ukrainiennes d’interception radar au sol ont été anéanties. Sans ces radars, l’armée de l’air ukrainienne a perdu sa capacité à effectuer des interceptions air-air. Au cours des trois semaines qui ont suivi, la Russie a établi de facto une zone d’exclusion aérienne au-dessus de l’Ukraine . Bien qu’elle soit toujours vulnérable aux missiles sol-air tirés à l’épaule fournis par les États-Unis et l’OTAN aux Ukrainiens, rien ne prouve que la Russie ait dû réduire ses opérations aériennes de combat.

 

L’arrivée de la Russie à Kiev dans les trois jours suivant l’invasion a également retenu mon attention. J’ai rappelé que les nazis de l’opération Barbarossa ont mis sept semaines pour atteindre Kiev et les 7 semaines de plus nécessaires pour soumettre la ville. Les nazis avaient l’avantage de ne pas donner de coups de poing pour éviter les pertes civiles et étaient impatients de détruire les infrastructures critiques. Pourtant, de nombreux soi-disant experts militaires américains ont affirmé que la Russie était enlisée. Lorsqu’un 24 milles (ou 40 milles, selon la source d’information) a été positionné au nord de Kiev pendant plus d’une semaine, il était clair que la capacité de l’Ukraine à lancer des opérations militaires importantes avait été éliminée.Si leur artillerie était intacte, alors cette colonne était un choix facile pour une destruction massive. Cela ne s’est pas produit. Alternativement, si les Ukrainiens avaient une capacité viable à voilure fixe ou à voilure tournante, ils auraient dû détruire cette colonne depuis les airs. Cela ne s’est pas produit. Ou, s’ils avaient une capacité de missile de croisière viable, ils auraient dû faire pleuvoir l’enfer sur la colonne russe soi-disant bloquée. Cela ne s’est pas produit. Les Ukrainiens n’ont même pas monté une importante embuscade d’infanterie contre la colonne avec leurs javelots américains nouvellement fournis.

L’ampleur et la portée de l’attaque russe sont remarquables. Ils ont capturé un territoire en trois semaines qui est plus grand que la masse terrestre du Royaume-Uni. Ils ont ensuite procédé à des attaques ciblées sur des villes clés et des installations militaires. Nous n’avons pas vu un seul exemple d’unité ukrainienne de la taille d’un régiment ou d’une brigade attaquant et battant une unité russe comparable. Au lieu de cela, les Russes ont divisé l’armée ukrainienne en fragments et coupé leurs lignes de communication. Les Russes consolident leur contrôle de Marioupol et ont sécurisé toutes les approches sur la mer Noire. L’Ukraine est désormais coupée au Sud et au Nord.

Je voudrais souligner que les États-Unis ont eu plus de mal à capturer autant de territoire en Irak en 2003 alors qu’ils luttaient contre une force militaire bien inférieure et moins capable. Au contraire, cette opération russe devrait effrayer les dirigeants militaires et politiques américains.

La très grande nouvelle est arrivée cette semaine avec les frappes de missiles russes sur ce qui est de facto des bases de l’OTAN à Yavoriv et Zhytomyr. L’OTAN a organisé une formation sur la cybersécurité à Jytomyr en septembre 2018 et a décrit l’Ukraine comme un « partenaire de l’OTAN ». Jytomyr a été détruit samedi par des missiles hypersoniques. Yavoriv a subi un sort similaire dimanche dernier. C’était le principal centre d’entraînement et de logistique que l’OTAN et l’EUCOM utilisaient pour fournir des combattants et des armes à l’Ukraine. Un grand nombre de militaires et de civils de cette base sont devenus des victimes.

Non seulement la Russie frappe et détruit régulièrement des bases utilisées par l’OTAN depuis 2015, mais il n’y a pas eu d’avertissement de raid aérien et il n’y a pas eu d’arrêt des missiles d’attaque.

 

 

 

Question 2 – Pourquoi les médias tentent-ils de convaincre le peuple ukrainien qu’il peut l’emporter dans sa guerre contre la Russie ? Si ce que vous dites est correct, alors tous les civils envoyés combattre l’armée russe meurent dans une guerre qu’ils ne peuvent pas gagner. Je ne comprends pas pourquoi les médias voudraient induire les gens en erreur sur quelque chose d’aussi grave. Quelles sont vos réflexions sur le sujet ?

Larry C. Johnson– C’est une combinaison d’ignorance et de paresse. Plutôt que de faire de véritables reportages, la grande majorité des médias (imprimés et électroniques) ainsi que les Big Tech soutiennent une campagne de propagande massive. Je me souviens quand George W. Bush était Hitler. Je me souviens quand Donald Trump était Hitler. Et maintenant nous avons un nouvel Hitler, Vladimir Poutine. C’est un livre de jeu fatigué et raté. Quiconque ose soulever des questions légitimes est immédiatement traité de marionnette de Poutine ou de laquais de la Russie. Lorsque vous ne pouvez pas discuter des faits, le seul recours est l’injure.

Question 3– La semaine dernière, le colonel Douglas MacGregor était l’invité du Tucker Carlson Show. Ses vues sur la guerre sont étonnamment similaires aux vôtres. Voici ce qu’il a dit dans l’ interview :

« La guerre est vraiment finie pour les Ukrainiens. Ils ont été broyés en morceaux, cela ne fait aucun doute malgré ce que nous entendons de nos médias grand public. Donc, la vraie question pour nous à ce stade est, Tucker, allons-nous vivre avec le peuple russe et son gouvernement ou allons-nous continuer à poursuivre ce genre de changement de régime déguisé en guerre ukrainienne ? Allons-nous cesser d’utiliser l’Ukraine comme bélier contre Moscou, ce que nous avons effectivement fait. ( Tucker Carlson – Entretien avec MacGregor )

Êtes-vous d’accord avec MacGregor sur le fait que le véritable objectif de pousser la Russie à une guerre en Ukraine était le « changement de régime » ?

 

Deuxièmement, êtes-vous d’accord pour dire que l’Ukraine est utilisée comme terrain de jeu par les États-Unis pour mener une guerre par procuration contre la Russie ?

Larry C. Johnson – Doug est un excellent analyste, mais je ne suis pas d’accord avec lui – je ne pense pas qu’il y ait quelqu’un dans l’administration Biden qui soit assez intelligent pour penser et planifier en ces termes stratégiques. À mon avis, les 7 dernières années ont été l’inertie du statu quo de l’OTAN. Ce que je veux dire par là, c’est que l’OTAN et Washington pensaient qu’ils pouvaient continuer à ramper vers l’est aux frontières de la Russie sans provoquer de réaction. L’OTAN et l’EUCOM organisaient régulièrement des exercices, y compris des entraînements « offensifs », et fournissaient du matériel. Je crois que les rapports aux États-Unis selon lesquels la CIA fournissait une formation paramilitaire aux unités ukrainiennes opérant dans le Donbass sont crédibles. Mais j’ai du mal à croire qu’après nos débâcles en Irak et en Afghanistan, nous ayons soudainement des stratèges du niveau Sun Tzu qui tirent les ficelles à Washington.

Il y a un air de désespoir à Washington. En plus d’essayer d’interdire tout ce qui est russe, l’administration Biden tente d’intimider la Chine, l’Inde et l’Arabie saoudite. Je ne vois aucun de ces pays s’aligner. Je crois que l’équipe de Biden a commis une erreur fatale en essayant de diaboliser toutes choses et tous les Russes. Au contraire, cela unit le peuple russe derrière Poutine et il est prêt à s’engager dans une longue lutte.

Je suis choqué par l’erreur de calcul en pensant que des sanctions économiques contre la Russie les mettraient à genoux. Le contraire est vrai. La Russie est autosuffisante et ne dépend pas des importations. Ses exportations sont essentielles au bien-être économique de l’Occident . S’ils retiennent le blé, la potasse, le gaz, le pétrole, le palladium, le nickel fini et d’autres minéraux clés de l’Occident, les économies européenne et américaine seront ravagées. Et cette tentative de contraindre la Russie avec des sanctions a maintenant rendu très probable que le rôle du dollar américain en tant que monnaie de réserve internationale apparaîtra dans les poubelles de l’histoire.

 

Question 4– Depuis qu’il a prononcé son célèbre discours à Munich en 2007, Poutine se plaint de « l’architecture de la sécurité mondiale ». En Ukraine, nous pouvons voir comment ces problèmes de sécurité lancinants peuvent évoluer en une véritable guerre. Comme vous le savez, en décembre, Poutine a fait un certain nombre de demandes liées à la sécurité russe, mais l’administration Biden les a ignorées et n’a jamais répondu. Poutine voulait des assurances écrites que l’expansion de l’OTAN n’inclurait pas l’Ukraine (adhésion) et que les systèmes de missiles nucléaires ne seraient pas déployés en Roumanie ou en Pologne. Pensez-vous que les demandes de Poutine sont déraisonnables ?

Larry C. Johnson– Je pense que les exigences de Poutine sont tout à fait raisonnables. Le problème est que 99% des Américains n’ont aucune idée du type de provocation militaire que l’OTAN et les États-Unis ont menée au cours des 7 dernières années. On a toujours dit au public que les exercices militaires étaient « défensifs ». Ce n’est tout simplement pas vrai. Nous avons maintenant des nouvelles selon lesquelles DTRA finançait des biolabs en Ukraine. Je suppose que Poutine pourrait accepter d’autoriser les systèmes de missiles nucléaires américains en Pologne et en Roumanie si Biden accepte d’autoriser le déploiement de systèmes russes comparables à Cuba, au Venezuela et au Mexique. Lorsque nous regardons cela en ces termes, nous pouvons commencer à comprendre que les exigences de Poutine ne sont ni folles ni déraisonnables.

 

Question 5– Les médias russes rapportent que des missiles russes « de haute précision lancés par voie aérienne » ont frappé une installation dans l’ouest de l’Ukraine « tuant plus de 100 soldats locaux et mercenaires étrangers ». Apparemment, le centre de formation des opérations spéciales était situé près de la ville d’Ovruch, à seulement 15 miles de la frontière polonaise. Que pouvez-vous nous dire sur cet incident ? La Russie essayait-elle d’envoyer un message à l’OTAN ?

Larry C. Johnson– Réponse courte—OUI ! Les frappes militaires russes dans l’ouest de l’Ukraine au cours de la semaine dernière ont choqué et alarmé les responsables de l’OTAN. Le premier coup est tombé le dimanche 13 mars à Yavoriv, ​​en Ukraine. La Russie a frappé la base avec plusieurs missiles, dont certains auraient été hypersoniques. Plus de 200 personnes ont été tuées, dont des militaires et des services de renseignement américains et britanniques, et des centaines d’autres blessés. Beaucoup ont subi des blessures catastrophiques, telles que des amputations, et sont hospitalisés. Pourtant, l’OTAN et les médias occidentaux ont montré peu d’intérêt à rendre compte de cette catastrophe.

Yavoriv était une base avancée importante pour l’OTAN (voir ici). Jusqu’en février (avant l’invasion de l’Ukraine par la Russie), le Commandement d’entraînement de la 7e armée américaine opérait depuis Yavoriv jusqu’à la mi-février. La Russie ne s’est pas arrêtée là. ASB Military news rapporte que la Russie a frappé un autre site, Delyatyn, qui se trouve à 60 miles au sud-est de Yavoriv (jeudi je crois). Hier, la Russie a frappé Zytomyr, un autre site où l’OTAN était auparavant présente. Poutine a envoyé un message très clair : les forces de l’OTAN en Ukraine seront considérées et traitées comme des combattants. Point final.

Question 6– Le président ukrainien Volodymyr Zelensky a été adulé dans les médias occidentaux comme un « chef de guerre » et un « Winston Churchill » des temps modernes. Ce que les médias omettent de dire à leurs lecteurs, c’est que Zelensky a pris un certain nombre de mesures pour renforcer son emprise sur le pouvoir tout en portant atteinte aux fragiles institutions démocratiques en Ukraine. Par exemple, Zelensky a « interdit onze organes de presse appartenant à l’opposition » et a tenté d’empêcher le chef du plus grand parti d’opposition ukrainien, Viktor Medvedtchouk, de se présenter aux élections sous une fausse accusation de « financement du terrorisme ». Ce n’est pas le comportement d’un dirigeant qui s’engage sérieusement pour la démocratie.

Que pensez-vous de Zelensky ? Est-il vraiment le « leader patriotique » que les médias prétendent être ?

Larry C. Johnson– Zelensky est un comédien et un acteur. Pas très bon à ça à mon avis. L’Occident utilise cyniquement le fait qu’il est juif comme une diversion du contingent important de néo-nazis (et je veux dire de véritables nazis qui célèbrent encore les réalisations de l’unité ukrainienne Waffen SS tout en combattant avec les nazis pendant la Seconde Guerre mondiale). Les faits sont clairs : il interdit les partis politiques d’opposition et ferme les médias d’opposition. Je suppose que c’est la nouvelle définition de la «démocratie».

Question 7– Comment cela se termine-t-il ? Il y a un excellent article sur le site de Moon of Alabama intitulé « What Will Be The Geographic End State Of The War In Ukraine  » . L’auteur du message, Bernard, semble penser que l’Ukraine sera éventuellement divisée le long du fleuve Dniepr « et au sud le long de la côte qui abrite une population majoritairement russe ». Il dit aussi ceci :

« Cela éliminerait l’accès de l’Ukraine à la mer Noire et créerait un pont terrestre vers la Transnistrie sécessionniste moldave qui est sous protection russe. Le reste de l’Ukraine serait un État confiné, principalement agricole, désarmé et trop pauvre pour être préparé à une nouvelle menace contre la Russie de sitôt. Politiquement, elle serait dominée par les fascistes de Galice, ce qui deviendrait alors un problème majeur pour l’Union européenne.

Qu’est-ce que tu penses? Poutine imposera-t-il son propre règlement territorial à l’Ukraine afin de renforcer la sécurité russe et de mettre fin aux hostilités ou un scénario différent est-il plus probable ?

Larry C. Johnson– Je suis d’accord avec Moon. L’objectif principal de Poutine est de protéger la Russie des menaces étrangères et d’effectuer un divorce avec l’Occident. La Russie a les ressources physiques pour être un souverain indépendant et est en train de concrétiser cette vision.

Bio– Larry C Johnson est un vétéran de la CIA et du Bureau de lutte contre le terrorisme du Département d’État. Il est le fondateur et associé directeur de BERG Associates, qui a été créé en 1998. Larry a dispensé une formation à la communauté des opérations spéciales de l’armée américaine pendant 24 ans. Il a été vilipendé par la droite et la gauche, ce qui signifie qu’il doit faire quelque chose de bien. Son analyse et ses commentaires peuvent être trouvés sur son blog, https://sonar21.com/


Voir notre offre de la semaine sur notre boutique en ligne Vintage par Michel sur E Bay:

https://www.cafr.ebay.ca/itm/194938327692?mkevt=1&mkcid=16&mkrid=706-127636-26712-0

Une magnifique théière de l’époque de l’empereur Pu Yi de Chine.

 

 

 

 

 

Attention à la fausse nouvelle:L’armée Russe en déroute en Ukraine? Un peu de sérieux!

A lire les articles quotidiens des media occidentaux on imagine que les forces russes font du sur-place, voire reculent, n’ont plus ni munitions ni essence, et c’est pour cela que la situation « est figée ». On lit également que, suite à la déclaration d’un haut-gradé disant que la Russie allait se « concentrer » sur le Donbass, les media occidentaux disent « la Russie cherche à sortir de son enlisement ». On lit aussi que l’armée russe est désorganisée, démoralisée, que le « bordel » règne dans ses rangs, etc.

Un ramassis de débilités, et je vais donc rectifier tout ceci, « en vrac ».

Spetsnaz du GRU, Renseignement militaire
Spetsnaz du GRU, Renseignement militaire

 

Depuis le début de l’intervention russe, Vladimir Poutine a été clair: Il n’est pas question d’occuper l’Ukraine. La tâche est la démilitarisation, qui passe par la dénazification de l’Ukraine. Il a également précisé que la Russie n’a rien contre le peuple d’Ukraine, et que la première raison de l’intervention est le massacre qui dure depuis 8 ans, des populations du Donbass.

C’est pour cela que d’une part la Russie fait preuve d’une extrême retenue en ne ciblant QUE les objectifs militaires ukrainiens, alors que les ukrainiens eux bombardent régulièrement les villes du Donbass. Il se trouve que bien souvent les militaires ukrainiens s’abritent au cœur des villes. Si une batterie ukrainienne tire sur nos hélicos depuis une cour d’immeuble à Marioupol (c’est arrivé), il est parfaitement clair qu’une frappe sera faite dans cette cour d’immeuble. Qui sont donc à blâmer?! Des vrais soldats, de vrais Hommes, n’ont pas à s’abriter derrière des civils!

Des agents du Renseignement militaire Russe opèrent en Ukraine, certains au sein d’unités de reconnaissances, d’autres en étant infiltrés au sein des villes. Et de nombreux citoyens ukrainiens nous aident également pour localiser et désigner les objectifs militaires à nos forces qui peuvent alors les frapper très précisément.

La démilitarisation passe par la destruction systématique des infrastructures militaires, et c’est ce que nous faisons à l’aide de frappes très précises.

La dénazification passe par l’élimination physique des responsables des unités extrémistes, et c’est ce que nous faisons.

Les combats dans les villes sont toujours très meurtriers, difficiles et longs. Mais le but de la Russie n’est absolument pas de prendre les villes, exception faite des villes du Sud de l’Ukraine majoritairement peuplées de russophones, qui si elles le désirent pourront alors former une grande région indépendante.

La tactique russe est l’encerclement des villes et l’ouverture de « couloirs » pour les réfugiés qui seront acheminés où ils le souhaitent. On note ici que c’est souvent l’armée ukrainienne qui s’oppose par les armes au départ des civils, ils préfèrent les garder comme « boucliers humains ». Et dans les villes encerclées les infrastructures militaires sont détruites, les forces ennemies sont liquidées.

Voyez comment Zelenski pleurniche jour après jour pour demander plus d’armes, plus de matériel lourd à l’OTAN. Si l’armée russe était dans la déroute décrite par la propagande occidentale, pensez-vous qu’il aurait besoin de ça? Zelenski tente désespérément d’entrainer l’OTAN dans la guerre en imaginant pouvoir ainsi sauver non pas les ukrainiens, mais son gouvernement de mafieux! Il ne doit pas se douter que si l’OTAN entre en guerre… Ne pensez-vous pas que nos forces savent avec précision où se cache cette ordure? Allons allons… Si l’OTAN entre en guerre, même une ambassade américaine ne sera pas à l’abri d’un missile.

Si les media occidentaux se gargarisent de leurs certitudes que la Russie est en déconfiture, les responsables militaires américains, eux, ont semble-t-il bien compris la situation et savent que la Russie est bien loin d’utiliser toutes ses possibilités. Ils savent aussi que si l’OTAN intervient, la Russie ne se retiendra plus et les choses se passeront très mal… pour l’OTAN. Une « piqure de rappel » leur a été faite avec quelques volées de missiles sur les dépôts de carburants et de munitions de la ville de Lvov à la frontière polonaise, alors que Biden n’était pas loin. Par « chance » (…) un énorme arrivage de matériel militaire de l’OTAN a été également détruit…. Le message, selon des informations, est bien passé puisque Biden a une fois encore précisé que l’OTAN n’interviendrait pas.

Au sujet de l’état de l’armée russe, d’abord ce ne sont que des engagés volontaires qui sont en Ukraine. Oui il y a eu une « bavure », avec quelques « appelés » envoyés sur place. Ils étaient en fait dans l’intendance et cela a été corrigé très vite, un officier supérieur a été limogé suite à cette erreur. Savez-vous en quoi consiste l’entrainement des militaires professionnels chez nous? Il n’est bien sûr pas question de démoralisation, de désorganisation etc, bien au contraire!

Oui nos généraux et amiraux vont sur le terrain, ce ne sont pas des planqués comme les vieilles badernes européennes croulant sous les médailles obtenues dans leur bureau! Pour avoir participé aux guerres de Tchétchénie, je peux vous affirmer que nos généraux étaient sur place, se battaient, mangeaient et dormaient avec nous dans leurs uniformes sales puant la sueur! C’est la même chose en Syrie, et en Ukraine aujourd’hui. Et donc hélas il y a des pertes, eux ne s’abritent ni derrière leurs hommes, ni derrière des civils!

Oui nous avons des morts parmi nos soldats, hélas. A ce sujet, plusieurs fois les familles de nos soldats tombés au combat ont reçu des coups de téléphone des ukrainiens se moquant de leur père ou fils mort, les insultant etc. Ces ordures se filment souvent et des vidéos tournent sur les réseaux sociaux. Certains ont déjà été identifiés et ont été liquidés par des commandos des forces spéciales russes qui se sont déplacées derrière leurs lignes « juste pour ça ».

 

En fait donc, l’opération suit son cours, il y a bien entendu des adaptations faites en fonction de l’évolution sur le terrain, mais grosso-modo le plan est respecté. Et à la place des occidentaux je m’inquiéterais beaucoup plus des conséquences des « sanctions » contre la Russie… Pour eux! La hausse des prix du gaz et du pétrole n’est qu’une plaisanterie à côté de la pénurie des produits alimentaires de base (céréales…) qui se profile. La Russie et la Biélorussie ont en effet décidé de « sanctionner les sanctionneurs » en cessant d’exporter céréales et engrais. L’Ukraine n’allant pas produire grand chose cette année… que vont donc bien pouvoir manger les européens?! L’argent de nos réserves de notre Banque Centrale, volé par les occidentaux, ne remplacera pas un morceau de pain!

Et si d’aventure les fous furieux avaient le dernier mot (lire ici), ce serait bien pire encore pour les européens et américains. Qu’ils cessent donc d’armer l’Ukraine, ça ne fait que retarder la fin de l’opération russe qui, quoi qu’il arrive, sera menée à son terme. La seule incertitude est le temps que ça prendra, et ceci dépend des occidentaux.

SOURCE


EN COMPLÉMENTAIRE

MON CONSEIL :FAITES DES PROVISIONS RAPIDEMENT

La Russie fixe la date limite de paiement du gaz rouble : 31 mars

Le président russe Vladimir Poutine a autorisé le gouvernement, la banque centrale et Gazprombank à prendre les mesures nécessaires pour transférer tous les paiements pour le gaz naturel russe des « États hostiles » aux roubles à partir du 31 mars.

La mesure vise « les États membres de l’UE et d’autres pays qui ont introduit des restrictions à l’encontre des citoyens de la Fédération de Russie et des entités juridiques russes », indique le mandat publié sur le site Web du Kremlin.

La Russie cessera d’expédier du gaz naturel vers les pays refusant de régler les paiements en roubles, a déclaré lundi le porte-parole du Kremlin, Dmitri Peskov.

C’est comme une foudre d’en haut vers les pays européens. Ils ont négocié leurs contrats avec la Russie pour qu’ils soient payables en EUROS ou en Dollars. Ensuite, ces mêmes pays ont imposé des « sanctions » à la Russie, empêchant du tout le versement d’EURO ou de dollars à la Russie. Ces Sanctions ont servi à faire échouer les contrats, qu’ils le stipulaient ou non.

Les contrats étant détruits, la Russie a alors choisi d’imposer ses propres sanctions et de forcer quiconque tentant d’acheter du gaz naturel russe à payer en roubles. Les Européens ont crié « Cela viole notre contrat » ​​même si c’est l’Europe elle-même qui a détruit tous les contrats en imposant des sanctions.

Alors maintenant, les Européens, qui n’ont pas beaucoup de gaz naturel, sont eux-mêmes dans une impasse. En mettant leur nez collectif dans la situation entre la Russie et l’Ukraine, l’Europe s’est désormais coupée du gaz naturel dont elle a besoin pour chauffer les maisons et produire de l’électricité.

Cette situation devrait apprendre à la foule « éveillée » à s’occuper de ses propres affaires !

Selon la plupart des mesures, l’Europe a maintenant moins de DEUX SEMAINES D’APPROVISIONNEMENT EN GAZ DE RÉSERVE. Lorsque les réserves seront épuisées, les maisons et les entreprises cesseront d’être chauffées et les centrales électriques s’arrêteront faute de carburant pour chauffer l’eau en vapeur pour faire tourner les turbines géantes nécessaires à la production d’électricité.

Bien sûr, il y a encore quelques centrales nucléaires en Europe, mais pas assez pour compenser la fermeture des centrales au gaz.

Dans l’état actuel des choses, il __APPARAÎT__ L’Europe commencera en fait à fermer physiquement dans les deux semaines suivant la DATE LIMITE DU 31 MARS.

Naturellement, une fermeture aussi massive anéantira presque immédiatement l’économie européenne. Quelques jours après l’effondrement de l’économie européenne, l’économie américaine s’effondre également. Ensuite, le reste du monde.

Avez vous de la nourriture stockée à la maison pour vous nourrir, vous et votre famille, pendant quelques mois ?

Mieux vaut en prendre. Vite.

Source:


APPUYEZ NOUS EN VISITANT  NOS BOUTIQUES EN LIGNE

Sur Etsy: Vintage par Michel

Sur E Bay :Vintage par Michel

 

 

 

 

Le dessin historique du jour: 1917…Lénine transporté à Moscou

 

Plus d’un siècle après que l’Allemagne a mis Lénine et sa clique dans « le train scellé », les élites occidentales [qui ne savent rien du fonctionnement réel de la Fédération de Russie] pensent que tout remplacement du gouvernement de Poutine leur appartient (A) et (B) sera moins antagoniste que Poutine.L’histoire se répète!


OFFRE DU JOUR

https://www.cafr.ebay.ca/itm/194928344521?hash=item2d62a27dc9:g:B~YAAOSwEv9iN5IH

 

Les dossiers de Michel Duchaine:Comment les sanctions accélèrent le Reset et la débâcle occidentale

J’ai demandé récemment si on vivait le Grand Reset ou simplement le grand épisode apocalyptique occidental : fin des énergies fossiles, fin de l’ère industrielle et bon écroulement de la cité Potemkine euro-américaine bâtie sur une montagne de dettes. La guerre de Poutine accélère cette formidable déglingue que certains ont prophétisé. Et comme il m’arrive d’être optimiste, je dirais qu’il semble difficile d’établir une dictature totalitaire et numérique dans le cadre d’un effondrement énergétique et systémique. On le peut après une guerre civile mais je ne vois pas nos brillantes élites la gagner cette guerre.

http://

Le litre d’essence est à 2,13 euros, le m3 de gaz à 2500 dollars. On n’est qu’au début. Dirigé par des Trudeau, des Macron et des Biden, l’occident est mal parti. Militairement il est nul (voyez mon texte sur Buchanan) et cela se savait en haut lieu. Cela se sait en tout lieu maintenant. Même Zelenski le dit ! Il n’avait pas vu la défaite face à l’Iran, la défaite au Yémen, en Syrie et leur retraite de ‘roussie’ en Afghanistan ?

Bureaucratie odieuse destinée à plumer le contribuable l’OTAN n’est pas là pour se battre : tout au plus peut-il par son incompétence et sa chutzpah déclencher la Fin du Monde.

Restent la chasse aux chefs d’orchestre et la guerre hybride – qui n’est pas très brillante intellectuellement (souvenez-vous des frites rebaptisées Freedom fries pendant la très utile et morale guerre contre l’Irak). Patrick Armstrong repris par Bruno Bertez écrit à ce sujet :

Pour l’Occident, tel qu’il a été, c’est fini. La confusion, les conneries, la vantardise, l’hystérie, les interdictions : l’Occident n’a plus rien dans sa besace. Verser de la vodka russe dans les toilettes, virer un chanteur et réalisateur, changer le nom d’une boisson ou d’une salade, interdire les chats ou les arbres, sanctionner un ploutocrate russe et voler son yacht, porter un t-shirt bleu et jaune. Pathétique.

Il reste les sanctions, les goulues et jouissives sanctions, les érotomanes sanctions ; qui vont nous faire encore plus mal qu’à la Russie. Pourquoi ? « Les occidentaux ne se tirent plus de balles dans le pied mais dans la tête » disait Charles Gave à Bercoff. On rappellera que nous vivons dans une idiocratie et ce dans tous les pays occidentaux. Pepe Escobar écrit lui sur notre présent effondrement industriel :

…L’Allemagne et d’autres pays n’ont pas commencé à ressentir la douleur de la privation de gaz, de minéraux et de nourriture. CELA va être le vrai jeu…jusqu’à 60 % des industries manufacturières allemandes et 70 % des industries italiennes pourraient être contraintes de fermer définitivement, avec des conséquences sociales catastrophiques. La machine européenne ultra-kafkaïenne non élue à Bruxelles a choisi de commettre un triple hara-kiri en se présentant comme des vassaux abjects de l’Empire, en détruisant toutes les impulsions de souveraineté française et allemande restantes et en imposant l’aliénation de la Russie et de la Chine.

L’occident anglo-saxon en est réduit comme à ses débuts (cf. Keynes) à la piraterie (on vole l’or, l’argent, les yachts, tout ce qui traîne).

Mais Patrick Armstrong ajoute :

Le judo consiste à tromper et à utiliser la force de l’adversaire contre lui. Poutine, le judoka, a poussé l’Occident au suicide. Il a dévoilé ce qui n’était pas compris : Mettez votre argent dans nos banques, nous pouvons le confisquer ; placez vos actifs sur notre territoire, nous pouvons les voler ; utiliser notre argent et nous pouvons l’annuler ; mettez votre yacht dans notre port, nous pouvons le pirater ; Mettez votre or dans notre coffre, nous pouvons le saisir.

Les conséquences sont claires avec la méfiance de tous les pays émergents (c’est le retour de Bandung ou du communisme nationaliste de décolonisation) et fin rapide du SWIFT :

C’est une leçon qui retentira dans le monde entier. Une illustration nue que « l’ordre international fondé sur des règles » est simplement une fiction: nous élaborons les règles et vous ordonnons de leur obéir. Dans 2 ou 3 semaines, tout le monde dans le monde qui est sur la liste des cibles potentielles de l’Occident aura déplacé ses actifs hors de portée de l’Occident. Xi se permettra un petit sourire.

Et Armstrong conclue :

Quant aux sanctions occidentales contre la Russie, je pense qu’il y a une réponse très simple à cela : la semaine dernière, 1.000 mètres cubes de gaz coûtaient 1.000 $ ; aujourd’hui , c’est plus du double. La semaine prochaine, ce ne sera certainement pas moins cher.

Idem pour l’aluminium, la potasse, le titane, le blé. Les compagnies aériennes russes louent leurs avions Maintenant quoi? Les moteurs-fusées russes. Ce que les Occidentaux ne comprennent pas, c’est que le rouble est la monnaie que les Russes utilisent à l’intérieur du pays, mais que le prix du pétrole et du gaz est la monnaie russe à l’extérieur du pays. Je suis stupéfait de la stupidité : ils se coupent la gorge et détruisent leurs propres économies.

Autrement dit pour nos énarques Trissotin : les sanctions ne renforcent pas les russes ; elles les enrichissent. Et Poutine finance ainsi ses opérations. Les menaces démentes de Biden contre l’Inde et le reste du monde ne risquent pas d’accroître la confiance dans ce système américain qui peut à tout moment voler sa clientèle.

Comme on le sait, les Russes (cf. Laurence) ont des problèmes avec leurs banques, avec Apple, avec Facebook, avec Google, les GAFAM étant la dernière émanation impériale destinée à nous tourmenter plus que les Russes ou les Chinois. Mais rien qui ne puisse être réglé promptement (voir l’article de Karine à ce sujet), et celui d’Escobar sur la doctrine Glaziev (couper les ponts avec l’occident, et passer à l’étalon-or).

Il reste à ces élites mondialistes à se venger sur leur troupeau, ce qui semble facile vu le degré de soumission ou de conditionnement de ces populations accoutumées à être conditionnées et maltraitées. On pourrait avoir la confiscation de l’argent, la fin du gaz et de toute électricité, la fin des usines (déjà arrêtées en Allemagne), bref le Grand Reset de Schwab ou le plan Morgenthau, le célèbre banquier de Roosevelt qui voulait réduire de moitié la population allemande.

Sources

–  https://thesaker.is/how-russia-will-counterpunch-the-u-s-eu-declaration-of-war/
–  https://brunobertez.com/2022/03/04/russia-observer-tactiques-strategie-et-operations-article-severe/
–  https://brunobertez.com/2022/03/03/larme-de-lor-le-veritable-objectif-de-poutine-briser-le-dos-de-davos-et-de-ses-agents-aux-etats-unis-et-au-royaume-unis/
–  https://russiepolitics.blogspot.com/2022/03/premiere-victoire-de-larmee-russe.html
–  https://reseauinternational.net/buchanan-et-le-grand-effondrement-moral-et-militaire-americain-et-occidental
–  https://reseauinternational.net/du-grand-reset-a-la-grande-claque-economique-occidentale
–  https://reseauinternational.net/guerre-du-gaz-leurope-prend-les-europeens-en-otage


 

L’avant-guerre touche à sa fin. Les Etats-Unis restaureront leur free lunch par la terreur de l’assertion nucléaire qu’ils annoncent depuis quinze ans. Le monde attend aussi l’événement de force majeure permettant l’effacement des dettes, une guerre mondiale…

Et l’Union Européenne veut abattre l’alternative civilisationnelle chrétienne pour son matérialisme transhumain. Les pays de l’axe atlantico-uniopéen croient se préparer à défendre un pays menacé alors que les Etats-Unis s’apprêtent à les lancer dans une guerre offensive, perdue d’avance pour justifier des frappes nucléaires. 

Depuis 2014 les gouvernements multiplient les déclarations de guerre à la Russie sans que les populations réagissent. Ils seront soudain mis devant l’urgence de réagir à une prétendue agression avant de pouvoir la vérifier, à minuit. Encore un effort et nous aurons définitivement déclenché la troisième guerre mondiale.

Source


 

 

L’avant-guerre touche à sa fin. Les Etats-Unis restaureront leur free lunch par la terreur de l’assertion nucléaire qu’ils annoncent depuis quinze ans. Le monde attend aussi l’événement de force majeure permettant l’effacement des dettes, une guerre mondiale…

Et l’Union Européenne veut abattre l’alternative civilisationnelle chrétienne pour son matérialisme transhumain. Les pays de l’axe atlantico-uniopéen croient se préparer à défendre un pays menacé alors que les Etats-Unis s’apprêtent à les lancer dans une guerre offensive, perdue d’avance pour justifier des frappes nucléaires. 

Depuis 2014 les gouvernements multiplient les déclarations de guerre à la Russie sans que les populations réagissent. Ils seront soudain mis devant l’urgence de réagir à une prétendue agression avant de pouvoir la vérifier, à minuit. Encore un effort et nous aurons définitivement déclenché la troisième guerre mondiale.

Source


BIENVENUE DANS NOTRE BOUTIQUE EN LIGNE SUR ETSY:

VINTAGE PAR MICHEL

 

 

 

 

 

 

 

…ET AUSSI SUR E BAY

VINTAGE PAR MICHEL 

 

 

Alerte climatique: l’Antarctique frappé par une vague de chaleur sans précédent

Plusieurs stations météorologiques du continent ont battu des records de température pour un mois de mars. « C’est un événement comparable au dôme de chaleur de 2021 en Amérique du Nord. Ce n’est pas censé arriver », a réagi sur Twitter un chercheur français.

La base franco-italienne de Concordia, le 24 janvier 2013 en Antarctique. (FRANCOIS LEPAGE / HANS LUCAS / AFP)
La base franco-italienne de Concordia, le 24 janvier 2013 en Antarctique. (

Coup de chaud sur le continent le plus froid de la planète. En Antarctique, plusieurs stations météorologiques ont battu, vendredi 18 mars, des records de chaleur, sidérant les scientifiques spécialistes de la région. Alors que l’automne commence sur ces terres australes, il a ainsi fait -17,7 °C sur la base russe de Vostok (contre -32,7 °C pour le précédent record mensuel), -12,2 °C à Concordia (record tous mois confondus) ou encore 4,9 °C à Dumont d’Urville, la base française de l’est du continent (contre 3,4 °C pour le précédent record mensuel).

 

Pour le chercheur Jonathan Wille, de l’université de Grenoble-Alpes, « c’est un événement comparable au dôme de chaleur de 2021 en Amérique du Nord. Ce n’est pas censé arriver. » 

 

Un événement favorisé par le changement climatique

Cette vague de chaleur intervient alors que la température planétaire grimpe sous l’effet du réchauffement climatique. Interrogé par le Washington Post (en anglais), Jonathan Wille rappelle qu’il est toujours difficile d’attribuer un événement ponctuel à ce phénomène global, mais précise que ce dernier favorise l’apparition de telles vagues de chaleur. « Nous pensons qu’elles deviendront plus intenses, parce que c’est juste de la physique. Mais nous sommes encore en train d’essayer de comprendre les détails. Il me paraît très difficile de dire qu’il n’y a pas la trace du changement climatique dans un événement comme celui-ci », poursuit le chercheur.

Pour le moment, Jonathan Wille ne s’inquiète pas d’une éventuelle fonte des glaciers. « On est plutôt en train de se dire : ‘tiens, c’est bizarre, cela pourrait arriver plus souvent à l’avenir. Et là, cela pourrait être grave », poursuit-il dans les colonnes du journal américain. D’éventuelles fontes en Antarctique alimenteraient encore un peu plus la montée des océans.

une vague de chaleur inédite enregistrée en Antarctique

La température a dépassé de 30 degrés les moyennes habituelles, vendredi 18 mars, dans l’Antarctique. Le réchauffement climatique se constate plus qu’ailleurs dans les régions polaires.

L’Antarctique est l’endroit le plus froid de la terre. Il n’est pas rare que les températures descendent à -80 degrés. Mais vendredi 18 mars, un record de chaleur a été enregistré : -11,8 degrés. Une donnée qui a laissé les chercheurs stupéfaits. « Ce sont des températures complètement anormales pour ce mois de mars. Normalement, les températures moyennes sont autour de -55 degrés », explique Julien Witwicky, glaciologue à la station Concordia-Antarctique.

Le dérèglement de la planète favorise ces vagues de chaleur

Le glaciologue a immortalisé l’instant par des photos. La douceur des températures a provoqué des chutes de neige, événement rare dans ces zones. Il est tombé environ dix centimètres de neige, l’équivalent d’un an de précipitations. Ce coup de chaud est dû à un phénomène météorologique appelé « rivière atmosphérique ». Il s’agit d’un long couloir d’air chaud et humide, constitué d’une grande quantité de vapeur d’eau. Il n’est pas possible d’associer ce phénomène au réchauffement climatique, mais il est certain que le dérèglement de la planète favorise ces vagues de chaleur. 


BIENVENUE DANS NOS BOUTIQUES EN LIGNE:

Vintage par Michel sur E Bay

 

 

 

 

 

…ET TOUJOURS NOTRE BOUTIQUE SUR ETSY:

VINTAGE par MICHEL

 

 

La Criminelle Arnaque du COVID-19:Des preuves biochimiques et statistiques officielles confirment à 100 % que Moderna a créé le Covid-19

1) Lorsque  Kadhafi avait annoncé dans les années 60, en parlant des Américains, « ils fabriqueront des médicaments, et pour vous les fourguer, ils fabriqueront les maladies qui vont avec »; les « experts » l’avaient traité de « fou ». Les mêmes qui traitent aujourd’hui Poutine de fou.
2) Les Big Pharma (Pfizer, Moderna, J&J, etc.) ont sorti leur vaccin Covid en quelques mois, alors qu’habituellement il faut au moins 10 ans, prouve qu’ils étaient tous « au parfum »  de l’arnaque covid qui se préparait chez Moderna.
3) Dès le début de cette pseudo pandémie, nous avons été parmi les premiers à dénoncer cette arnaque et à affirmer que cette « maladie » est artificielle et qu’elle était conçue dans les labos de l’Oncle Sam.  H. Genséric

Des preuves sont apparues prouvant au-delà de tout doute raisonnable que le géant pharmaceutique Moderna, la société qui a gagné des milliards grâce à la vente d’une injection expérimentale appelée vaccin de Covid-19, a en fait créé le virus Covid-19.

Le 23 février, le Daily Mail a publié un article montrant que Moderna avait breveté la séquence de 19 lettres de base (nucléotides) qui code pour le site Furin Cleavage dans Covid-19. 

Il a cité un article rédigé par des scientifiques en Inde, en Suisse, en Italie et aux États-Unis ( avec prudence intitulé : MSH3 Homology and Potential Recombination Link to SARS-CoV-2 Furin Cleavage Site ) dans lequel ils ont calculé que les chances d’une séquence de 19 nucléotides, brevetée par Moderna, apparaissant au hasard dans Covid-19 , dans des circonstances où il n’apparaît nulle part ailleurs dans la nature sont de 1 sur 3 milliards [1].

Mais ils n’ont pas réussi à en tirer la déduction évidente. S’ils avaient fait cette déduction évidente, je crains que cela n’ait été la dernière déduction scientifique qu’ils aient jamais publiée !

Ils ont décidé d’enquêter sur la séquence d’ARN du site de clivage de la furine dans la protéine de pointe Covid-19 pour voir si cela se produisait ailleurs dans la nature. .

Heureusement, le NCBI/NIH a produit la merveilleuse base de données BLAST qui répertorie toutes les séquences de gènes dans la nature connues de l’homme et toutes les séquences de gènes synthétiques brevetées connues de l’office des brevets.

Les chercheurs ont choisi la séquence Furin Cleavage car il s’agit de la seule séquence continue de lettres de gène (séquence de nucléotides) dans Covid-19 avec plus de 3 nucléotides, qui diffère des lettres respectives dans son parent naturel le plus proche, le Bat Coronavirus RaTG13 (toutes les autres différences sont 3 lettres ou moins). C’était donc de loin le meilleur candidat pour déterminer si le Covid-19 était ou non créé par l’homme.

 

De plus, le site de clivage de la furine est la clé de la pathogénicité de Covid-19 . Donc, s’il devait y avoir un gain de fonction créé par l’homme inclus dans le virus, c’est là que l’on pourrait s’attendre à le trouver.

La séquence d’acides aminés du site de clivage de la furine est PRRA (Proline Argenine Argenine Alanine). Chaque acide aminé est codé par un codon composé de 3 nucléotides (lettres de séquence génétique). Ainsi, toutes les différences dans le code génétique entre Covid-19 et RaTG13 sont au plus long d’un codon, d’un acide aminé, autre que la séquence de clivage de la furine, qui est…

CCT CGG CGG GCA

La séquence complémentaire (le brin d’ADN opposé de la double hélice est (GGAGCCGCCCGT) car C se lie à G et A se lie à T

Le compliment inverse (la même chose écrite à l’envers) est donc TGCCCGCCGAGG

Les chercheurs ont effectué une recherche d’alignement BLAST (Basic Local Alignment Search Tool) (ce qui signifie qu’ils recherchent la séquence du gène, la séquence du gène inverse, la séquence du gène complémentaire et la séquence du gène complémentaire inverse) à travers chaque séquence de gènes dans la nature connue de l’homme depuis CTCCTCGGCGGGCACGTAG qui est la séquence de 19 nucléotides contenant la séquence de clivage de la furine, qui apparaît également dans Covid-19, et qui se trouve en fait sous la forme de complément inverse CTACGTGCCCCGCCGAGGAG brevetée par Moderna.

Leurs résultats de recherche peuvent être trouvés ici . 

Le tableau 1 montre qu’il existe bien dans les 5 brevets américains cités ci-dessous…

US9149506B2 : Polynucléotides modifiés codant pour la septine-4 – https://patents.google.com/patent/US9149506B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618953P
2013-12-16 Demande déposée par Moderna Therapeutics Inc
2014-05-22 Publication de US20140141067A1
2015-10-06 Publication de US9149506B2
2015-10-06 Demande accordée
2020-01-10 Premier litige familial mondial déposé

US9216205B2 : Polynucléotides modifiés codant pour la granulysine – https:// patents.google.com/patent/US9216205B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618873P
2013-12-16 Demande déposée par Moderna Therapeutics Inc
2014-04-24 Publication de US20140113960A1 2015-12-22
Publication de US9216205B2 2015-12-22
Demande accordée

SIAH encodant la polynucléotide E3subitine modifiée protéine ligase 1 – https://patents.google.com/patent/US9255129B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618868P
2013-12-16 Demande déposée par Moderna Therapeutics Inc
2014-05-22 Publication de US20140141068A1
2016-02-09 Demande accordée
2016-02-09 Publication de US9255129B2

US9301993B2 : Modified polynucleotides coding apoptosis inducing factor 1 – https://patents.google.com/patent/US9301993B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Mandataire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618957P
2013-12- 16 Demande déposée par Moderna Therapeutics Inc
2014-04-17 Publication de US20140107189A1
2016-04-05 Demande accordée
2016-04-05 Publication de US9301993B2
2020-01-10 Premier litige familial mondial déposé

US9587003B2 : Polynucléotides modifiés pour la production de protéines et de peptides liés à l’oncologie – https://patents.google.com/patent/US9587003B2/en 

Inventeur : Stephane Bancel, Tirtha Chakraborty, Antonin de Fougerolles, Sayda M. Elbashir, Matthias John, Atanu Roy, Susan Whoriskey, Kristy M. Wood, Paul Hatala, Jason P. Schrum, Kenechi Ejebe, Jeff Lynn Ellsworth, Justin Guild

Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618868P
2016-02-04 Demande déposée par ModernaTx Inc
2016-06-02 Publication de US20160152678A1
2017-03-07 Publication de US9587003B2
2017-03-07 Demande accordée

Ainsi, Moderna a déposé une première demande de brevet pour la séquence de 19 nucléotides en 2013 le 16 décembre. Peut-être que le 25 décembre aurait été plus approprié puisqu’il était destiné à devenir la couronne d’épines de Mathew27, Mark15 et John19.

Tableau 2 : montre que la séquence se produit dans Covid-19 du nucléotide 23601 à 23619.

Tableau 3 : montre que cette séquence de gène n’existe pas dans la nature (mais 14 parties nucléotidiques de celle-ci existent). 

J’ai décidé de vérifier leur travail. Oui. Je les ai effectivement vérifiés (j’enverrai une facture aux mondialistes). Cela s’est avéré être un voyage un peu épique. La page de brevet Google pour US9587003B2 ne contient pas la séquence du gène. Le pdf du brevet ne contient pas la séquence du gène et n’est pas consultable à partir des pages 101-304. Mais il a un lien vers une longue section « Liste des séquences » que l’on ne peut pas copier. Je l’ai donc transcrit manuellement de ma main juste –  http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US09587003B2 

À partir de cette page, vous pouvez entrer l’ID de séquence cité dans l’article sous la forme 11652 et accéder à https://seqdata.uspto.gov/?pageRequest=viewSequence&DocID=US09587003B2&seqID=11652 qui a ce qui suit aux nucléotides 2751-2733 en lisant à l’envers…

gccctgatca ccatcatggc ccagatcggc ag ctacgtgc ccgccgagga g gccaccatc 2760

CTACGTGCCCCGCCGAGGAG breveté par Moderna est le complément inverse de CTCCTCGGCGGGCACGTAG, la séquence de 19 nucléotides qui apparaît dans l’ADN de Covid-19 à partir du nucléotide 23601-23619 (qui serait donc couvert par leur brevet).

De même, vous pouvez rechercher la séquence dans US9149506B2 en allant sur https://seqdata.uspto.gov/?pageRequest=viewSequence&DocID=US09149506B2&seqID=11652 , après quoi vous retrouverez la même chose

gccctgatca ccatcatggc ccagatcggc ag ctacgtgc ccgccgagga g gccaccatc 2760

J’ai ensuite recherché la séquence génétique de Wuhan Hu1 (alpha) sur https://www.ncbi.nlm.nih.gov/nuccore/NC_045512 et j’ai trouvé 

23581 ttatcagact cagactaatt ct cctcggcg ggcacgtag t gtagctagtc aatccatcat de https://www.ncbi.nlm.nih.gov/nuccore/NC_045512 

Qui a la séquence de 19 nucléotides CTCCTCGGCGGGCACGTAG de 23601-23619 comme décrit dans le tableau 3. 

J’ai ensuite effectué ma propre recherche par explosion non alignée de toutes les séquences de gènes brevetées pour le compliment inverse directement (ou peut-être pour un compliment inversé) et j’ai obtenu les mêmes résultats que les chercheurs. 

Et pareil pour les 3 autres brevets américains.

Je peux donc confirmer, et le lecteur peut confirmer en utilisant les liens ci-dessus, que Moderna a demandé un brevet non seulement sur le complément inverse du site de clivage de la furine à 12 nucléotides dans Covid-19, mais en fait sur la séquence de 19 nucléotides le contenant comme décrit au dessus.

De plus, ils n’ont pas simplement déposé une demande de brevet le 4 février 2016 avec US9587003B2 : comme le rapporte le Daily Mail. Ils ont effectivement déposé le 16 décembre 2013 pour 4 brevets avec US9149506B2, US9216205B2, US9255129B2, US9301993B2 : également.

Ainsi, Moderna avait développé la séquence de gènes de 19 nucléotides contenant le site de clivage de la furine qui donne à Covid19 son infectivité pour l’homme grâce à une recherche brevetée sur le gain de fonction dès 2013, 6 ans avant l’épidémie de Wuhan. Pas 3 comme rapporté dans le Mail et viralement ailleurs.. 

Alors maintenant, nous examinons les chances que cela se produise naturellement. L’article calcule la probabilité que cette séquence particulière de 19 nucléotides se produise de manière aléatoire dans un virus de 30 000 nucléotides comme

(30 000-18) × (1/4) 19   = 1,09 × 10 -7

Ce qui est correct car il y a 30 000 à 18 places pour commencer la séquence étant donné qu’il faut encore 18 lettres supplémentaires pour la compléter. Mais il y a en fait 29 904 nucléotides dans Wuhan HU1 (alpha). Un calcul plus précis serait donc

(29 904-18) × (1/4) 19   = 1,087 × 10 -7

Ensuite, ils calculent les chances que la séquence de 19 nucléotides se produise dans la bibliothèque brevetée de 24 712 séquences d’une longueur moyenne de 3 300 nucléotides. Mais ce calcul n’est pas pertinent car la séquence n’est pas apparue au hasard dans 5 demandes de brevet Moderna. La séquence était connue pour coder pour un site de clivage de la furine, qui est connu pour fournir un gain de fonction aux coronavirus.

Il y a été mis délibérément et breveté en raison de son pouvoir infectieux chez l’homme, que nous verrons plus loin dans l’article, résulte du remplacement du codon viral normal de l’arginine (R) AGA (utilisé dans 45 % des codons viraux de l’arginine) par le le codon de l’arginine humaine CGG (utilisé dans 0 % des codons de l’arginine virale) dans le site de clivage de la furine.

Tout ce que nous essayons de déterminer ici, c’est quelles sont les chances qu’une séquence de 19 nucléotides brevetée par Moderna apparaisse dans Covid-19 par des causes naturelles, les mutations naturelles du Bat Coronavirus RaTG13 ou d’un autre virus.

Les nucléotides forment des codons qui sont des triplets. Il y a donc 64 triplets possibles des 4 nucléotides d’ADN ACGT (4x4x4 = 64). Mais tous les triplés se produisent. 61 codent pour 20 acides aminés de manière redondante et 3 sont des codons stop qui indiquent au ribosome d’arrêter de fabriquer la protéine.

Mais les choses ne sont pas aussi simples car le site de clivage Furin apparaît dans la protéine de pointe là où il doit être et la protéine de pointe n’a que 1273 × 3 = 3819 nucléotides. Les chances que la séquence de 19 nucléotides Furin Cleavage apparaisse dans la protéine de pointe sont 

(3 819-18) × (1/4) 19   = 1,389 × 10 -8

Soit 1 sur 72 millions. Ce seraient donc les chances qu’une variante particulière, disons la première variante de Covid-19, ait la séquence de 19 nucléotides au bon endroit (le pic). Et il l’a fait. Donc, certainement selon la prépondérance des probabilités, et certainement au-delà de tout doute raisonnable (1 sur 72 millions étant un doute déraisonnable), Moderna a créé Covid-19. 

Preuve 100% biochimique que Covid19 a été créé par l’homme

Le double codon CGG utilisé dans le site de clivage spécifique de la furine Moderna ne se produit dans aucun autre site de clivage de la furine dans aucun autre virus dans la nature. Les sites de clivage de la furine se produisent dans d’autres virus mais PAS du tout dans d’autres bétacoronavirus comme Covid-19 et PAS du tout avec le double codon CGG.

L’arginine (R), peut être codée par l’un des 6 triplets : AGG, AGA, CGA, CGC, CGG, CGT. Dans le Covid-19, le site de la furine (PRRA), compte 12 nucléotides (3 x 4). Dans le Covid-19, le doublet RR du site de la furine est codé par CGG-CGG.  

Antonio R. Romeu

Deux biochimistes, le professeur Antonio R. Romeu et le professeur assistant Enric Ollé, ont analysé le doublet RR à partir d’un large échantillon de sites de clivage de la furine de plusieurs types de virus . Ils ont découvert qu’il n’y avait aucun doublet RR codé par les codons CGG-CGG dans aucun virus dans la nature. Ils ont observé que le triplet AGA était le codon majoritaire impliqué dans ces doublets RR viraux.

Dans toute recombinaison génétique (où une partie d’un génome fusionne avec un autre génome), le code donneur est transmis à l’accepteur. Mais il n’y a tout simplement AUCUN VIRUS CONNU avec un site de clivage de la furine spécifique de Moderna (ayant la paire de codons CGG-CGG) qui existe pour donner un site de clivage de la furine spécifique de Moderna à Covid19. Donc, la seule façon dont cette séquence pourrait entrer dans Covid-19 est de Moderna. Moderna était le donateur. La nature ne l’était pas. CQFD. Affaire classée..  

Mais ça empire.

Les professeurs espagnols ont décidé d’analyser l’utilisation du codon de l’arginine dans chaque protéine de Covid-19. Le constat suivant…
AGG (13%)
AGA (45%)
CGA (5%)
CGC (10%)
CGG (3%)
CGT (24%). 

Ainsi, le triplet de codons AGA était majoritaire et, fait intéressant, CGG était le codon minoritaire de l’arginine dans le virus. 

Mais c’est encore pire.

Dans le cas particulier de la protéine S, sur les 42 Arginines (R) dont elle dispose, 20 sont codées par AGA, et seulement 2 par CGG. Ces 2 bien sûr, sont les deux dans le site de clivage Moderna Specific Furin.

Ainsi, la seule arginine dans la protéine de pointe qui est codée à la Moderna se trouve sur le site Furin Cleavage. Les 40 autres instances n’utilisent pas du tout CGG. 

Ils poursuivent ensuite en commentant que chaque espèce individuelle dans la nature a ses propres préférences de codons. De toute évidence, les virus aiment AGA, et n’aiment pas du tout CGG, dans la nature.

Mais devinez quelle espèce utilise CGG pour l’arginine plus que les 5 autres codons concurrents – oui, son vieil homo sapiens. Nos préférences de codage pour l’arginine sont

AGG (20 %)
AGA (20 %)
CGA (11 %)
CGC (19 %)
CGG (21 %)
CGT (9 %).

Ainsi, le codon CGG dans le site de clivage de la furine SERA issu de la recherche sur le gain de fonction chimère (combinaison homme-animal). 

Quelqu’un d’autre que Moderna aurait-il pu créer le Covid-19 en utilisant le site de clivage de la furine spécifique de Moderna ?

« De nouveaux documents montrent que 18 mois seulement avant l’apparition des premiers cas de Covid-19, les chercheurs avaient soumis des plans pour libérer des nanoparticules et des aérosols pénétrant dans la peau contenant de « nouvelles protéines de pointe  » de coronavirus de chauve-souris  des cavernes du Yunnan, en Chine. Ils prévoyaient également de créer des virus chimériques, génétiquement améliorés pour infecter plus facilement les humains, et ont demandé 14 millions de dollars à la Defense Advanced Research Projects Agency (Darpa) pour financer les travaux.

Des articles, confirmés comme authentiques par un ancien membre de l’administration Trump, montrent qu’ils espéraient introduire des «sites de clivage spécifiques à l’homme» pour les coronavirus de chauve-souris, ce qui faciliterait l’entrée du virus dans les cellules humaines.
Lorsque Covid-19 a été séquencé génétiquement pour la première fois, les scientifiques étaient perplexes quant à la façon dont le virus avait développé une telle adaptation spécifique à l’homme au site de clivage de la protéine de pointe, raison pour laquelle il est si infectieux. – le Telegraph

Je peux voir tous les grands journalistes du Daily Mail et du Telegraph (sans parler des scientifiques du monde entier) faire toutes ces recherches sur Covid19 et arriver à la conclusion logique inévitable qu’il y a eu une fuite accidentelle ou délibérée d’un laboratoire et doivent ensuite formuler leurs conclusions de manière à étiqueter cette forte probabilité comme une possibilité faible. 

Mais ci-dessus, nous l’avons prouvé comme un fait (puisque le codon CGG de la séquence de clivage spécifique de la furine de Moderna n’apparaît dans aucun site de clivage de la furine dans aucun virus naturel et, par conséquent, il ne peut pas avoir été le résultat d’une recombinaison génétique naturelle. Il doit donc être le résultat d’une insertion génétique faite par l’homme. 

En théorie, une autre partie impliquée avec le NAIAD ou le NIH aurait pu utiliser le site de clivage de la furine breveté par Moderna et fabriquer Covid19 eux-mêmes. Cela n’aurait brisé aucun brevet de Moderna. Le site de clivage Furin lui-même n’est pas brevetable étant connu depuis au moins 2004

US7223390B2 : Insertion de sites de clivage de la furine protéase dans les protéines membranaires 
et leurs
utilisations

Bien que Moderna ait en fait pu breveter le codage Moderna Specific (CGG pour AGA) du site de clivage de la furine qui n’était pas connu dans la nature même aujourd’hui (si nous acceptons que Covid-19 soit créé par l’homme).

Mais étant donné que la fuite de laboratoire (délibérée ou accidentelle) est venue de Wuhan, et compte tenu de la dissimulation chinoise et des démentis de Fauci exposés par le sénateur Rand Paul, et étant donné les dissimulations du NIH, du NIAID et des services de renseignement américains, quand leur Un rapport de 3 mois sur l’origine de Covid-19 commandé par l’imitateur présidentiel Biden n’a rien donné, et compte tenu des relations entre le NIAID, le NIH, le WIV, l’EcoHealth Alliance, l’Université de Caroline du Nord et Moderna, je ne vois aucune pièce pour quelqu’un d’autre.

De plus, toute la cabale impie des mauvais acteurs a commencé à développer le vaccin Moderna avant que la pandémie ne frappe – https://www.infowars.com/posts/must-watch-nih-claimed-joint-ownership-of-moderna-mrna-vaccine- a commencé-le-développement-des-semaines-avant-la-pandémie/ 

Mais les choses ne sont pas aussi simples que cela parce que la nature a certainement eu 100 000 ans pour fabriquer des virus humains et elle n’a jamais mis une seule fois un site de clivage de furine spécifique à Moderna (CGG pour AGA) dans quoi que ce soit, ni mis la séquence de 19 nucléotides dans quoi que ce soit auparavant.

Pourtant, dans les 6 ans suivant le brevetage de Moderna, nous le trouvons dans Covid-19 dans des circonstances où Moderna travaille avec ce virus. Donc juste là, la probabilité n’est pas de 100 000 contre 6 ou 16 666 contre 1 que Moderna soit responsable plutôt que la nature. Non c’est à 100% car la nature ne l’a pas fait. Il ne l’a jamais fait et rien ne prouve qu’il le fera un jour.

C’est l’homme qui mélange les codons humains et viraux de l’arginine, pas la nature. 

Le prof. Luc Montagnier a passé les dernières années de sa vie à prouver que le COVID-19 était créé par l’homme et qu’il contenait une grande partie du code génétique du VIH1

Le professeur Luc Montagnier, avant de mourir le 8 février 2022, a totalement détruit le concept selon lequel Covid-19 a évolué naturellement en montrant qu’il avait une équivalence massive avec VIH. Le diagramme ci-dessous montre une région de 275 nucléotides de Covid-19 qui contient 200 nucléotides du VIH/SIV (Simian ImmunoVirus). Et rappelez-vous qu’il y a 61 codons spécifiant 20 acides aminés. On peut donc dire la même chose en moyenne de 3 manières différentes avec des codons.

Vous pouvez télécharger un pdf de son étude ici et les documents supplémentaires ici . C’est très technique. Mais il a remporté le prix Nobel pour avoir découvert le virus VIH. Donc, si quelqu’un savait si Covid avait été boosté par le VIH, ce serait lui. Il a souligné que Covid-19 avait été créé par l’homme au début de la pandémie et qu’il avait lui-même été stipendié par la presse et les « vérificateurs des faits » pour avoir dit la vérité scientifique. Tous les « vérificateurs de faits » qui l’ont attaqué avaient tort.

Aucune de leurs vérifications des faits n’avait de fondement scientifique. Ces gens ne sont pas du tout des vérificateurs de faits bien sûr. Ce sont des agences de désinformation mondialistes, des fils de Goebbels, des fact chuckers et des négateurs de la science. Ils sont à peu près aussi dignes de confiance qu’une élection américaine. Je peux vérifier un fait par moi-même merci beaucoup. Je n’ai pas besoin qu’un taliban soumis au lavage de cerveau me dise son opinion sur un sujet qu’il n’a jamais étudié à l’université.

Puisque nous avons prouvé au-delà de tout doute raisonnable (au-delà d’un doute sur 1 sur 72 millions de manière statistique et avec 100% de certitude biochimique à partir du site de clivage de la furine spécifique de Moderna) que Moderna a fabriqué Covid-19. Et puisque Moderna et Fauci n’ont pas admis l’avoir fait et ont en fait dissimulé des preuves à cet effet, il se peut qu’ils cachent également autre chose.

Maintenant, les deux seules théories qui restent sont la théorie des fuites accidentelles de laboratoire et la théorie des fuites délibérées de laboratoire. Nous savons que la grande majorité des fuites politiques ne sont pas des accidents. Ce sont des stratégies délibérées pour procurer un avantage au bailleur ou au payeur. Il est bien connu dans l’industrie informatique que les virus apparaissent lorsque des ventes d’antivirus sont nécessaires. Pourquoi les choses seraient-elles différentes avec les virus humains, maintenant qu’ils peuvent aussi être créés par l’homme ? Surtout si l’on considère le rôle massif de Bill Gates et de sa fondation et de GAVI et GVAP dans le secteur mondial de la vaccination.

La seule raison pour laquelle Moderna créerait Covid-19 est de le lancer sur le marché. Sinon, tout l’exercice serait financièrement futile, commercialement inutile.

La raison invoquée par Fauci pour faire de la recherche sur le gain de fonction est que l’homme doit être en avance sur la nature ou les mauvais acteurs afin d’avoir un vaccin en temps utile si une maladie mute ou est génétiquement modifiée par « les Chinois ou les Russes » pour être mortelle !!

Mais pour croire cela, il faut croire que Moderna s’intéresse à sauver la vie des gens. Je m’excuse. Toutes leurs actions me montrent qu’ils sont intéressés à vacciner les gens sachant à quel point cela risque de leur coûter la vie.

Ils sont intéressés par le profit, le profit qui découle d’une pandémie. Ils ne sont pas des sauveurs de l’humanité comme ils le représentent. Ce sont nos exploiteurs et nos agresseurs.

Ils ont produit le virus pour le faire fuiter, pour se faire passer pour nos sauveurs de leur propre fuite. Ce ne sont pas les activités d’une figure de sauveur. Luc Montagnier essayait d’être notre sauveur d’eux et il a été assassiné (professionnellement) par leurs groupies. [La fiotte Macron a snobé le décès du Savant]
Moderna effectuait des recherches sur le gain de fonction afin de libérer le virus et de forcer un vaccin contre celui-ci d’une manière qui maximiserait ses profits. Ce n’est pas une théorie du complot. C’est ce qui s’est passé précisément. Le cours de leur action a été multiplié par 20. 

Ils l’ont sorti pour vendre leurs vaccins et détruire le système immunitaire de leurs clients car notre système immunitaire réduit leurs profits. C’est le business de Big Pharma. 

La raison pour laquelle l’écrivain est si confiant que Moderna ou leurs agents ont fabriqué et divulgué Covid-19 et la raison pour laquelle je l’ai appelé ainsi au début de la pandémie pour presque autant de ridicule que le professeur Montagnier a reçu (que Dieu le bénisse) est que le les Écritures disent dans Matthieu27, Marc15 et Jean19 : 

29 Et ils (les soldats du gouverneur du verset 27) placèrent une couronne d’épines et la mirent sur sa tête, et un roseau dans sa main droite ; et ils s’agenouillèrent devant lui, et se moquèrent de lui, disant : Salut, roi des Juifs !
30 Et ils crachèrent contre lui, prirent le roseau et le frappèrent sur la tête. (Matthieu 27 ASV)

Puis-je donc demander votre indulgence pendant que j’interprète ces mots : 

Le département américain de la défense a financé l’épissage génétique du coronavirus des protéines de pointe (Covid-19) par l’intermédiaire du NIH, du NIAID et de la DARPA, qui a d’abord infecté Jésus, par l’intermédiaire de son fiancé, les saints de la Nouvelle Alliance, juste après qu’il soit devenu le roi séculier, César à ces saints, les Juifs antitypiques, ceux qui se sont engagés à être des fils angéliques de Jacob, les nés de nouveau angéliquement.

Nous avons calculé que la malédiction qui a empêché Jésus de devenir César des saints s’est terminée en 2019Tishri15 (17/18 octobre). Glenn Beck a réalisé un documentaire montrant que 10 hôpitaux de Wuhan ont pris en charge des cas présentant des symptômes de Covid19 en octobre 2019. Oui les gens. Le Covid-19 est une preuve que Jésus est désormais le Roi séculier sur les saints, les Juifs antitypiques, les Juifs par l’alliance angélique du salut, au moins.

Mais ensuite, les soldats ont craché sur lui. Car c’est ainsi que Covid19 est transféré, à travers de petites gouttelettes d’aérosol expirées par la bouche. Les soldats lui ont délibérément craché dessus. Ce n’était pas une FUITE DE SALIVE ! Ils ont frappé Jésus sur la tête parce que les saints sont à la tête de l’église et ils ont attrapé Covid19 non pas par une infection fortuite au hasard mais par un coup délibéré avec une lecture, une arme biologique, une attaque armée délibérée. Pour en savoir plus, voir ici .

Alors ce que le Pr Montagnier a vu avec son expertise en virologie, je l’ai vu avec mon expertise théologique. Montrer que si les vérificateurs de faits et la science s’excluent mutuellement, la science et la théologie sont en fait d’accord, lorsqu’elles sont bien comprises (et c’est une grande mise en garde). Le Pr M nous a appris que les vaccins provoquent les variants. En effet, la virologie de base interdit la vaccination de masse pendant une pandémie pour cette raison même. Il a dit que la courbe des décès suit la courbe des vaccinations. Remarquez, paradoxalement, si les vaccins ont causé Omicron, alors ils nous ont sauvés d’eux-mêmes !

Le temps est venu de demander des comptes aux personnes et aux organisations

Les fabricants de Covid19, les fabricants de vaccins génétiques. leurs bailleurs de fonds et leurs promoteurs, qui comprennent presque tous les gouvernements, secteurs publics et services de santé dans le monde, sont donc coupables de génocide et de crimes contre l’humanité. Ils ont poussé le viol génétique, la maladie et la mort sur la moitié de la population mondiale afin d’enrichir les poches des sociétés pharmaceutiques. Les gouvernements et les secteurs publics du monde entier ont abandonné leur réglementation des services de santé aux milliardaires et aux entreprises sans cœur

Au Royaume-Uni, tout l’impôt sur le revenu que nous payons va au service de santé et tous ses protocoles sont déterminés par ses régulateurs et tous ses régulateurs sont contrôlés et financés par Big Pharma qui cherchent à nuire puis à gérer notre santé à leur profit.

Ainsi, chaque cent que nous dépensons en impôt sur le revenu nous rapproche un peu plus de la maladie, de la mort et de la toxicomanie.

Le professeur Luc Montagnier,en 2008.

Alors pourquoi le professeur Montagnier a-t-il choisi de passer les dernières années de sa vie à prouver que le Covid-19 était une création humaine et que les protéines de pointe, et donc les vaccins, étaient une menace existentielle pour l’espèce ? Que lui restait-il à prouver à lui-même ou à qui que ce soit d’autre à 87-89 ? Il ne l’a certainement pas fait pour accroître sa réputation dans la profession.

Non, il était animé par la même passion qui l’a poussé à découvrir le VIH. Une passion pour SAUVER l’humanité des virus et de ceux qui voudraient les concevoir pour nous nuire. Et pourquoi a-t-il rendu l’âme en février 2022 ? Parce qu’il savait qu’Omicron avait battu les vaccins. Son travail a été fait par un plus grand virologue que lui. Il a donc pu reposer en paix et aller voir des gens qui ont compris l’ampleur de sa contribution.

Covid-19 n’a pas été fabriqué en 2019. Il a été fabriqué à partir du site de clivage de la furine chimérique spécifique de Moderna (CGG pour AGA) à 19 nucléotides qui n’existe nulle part dans la nature.
Et chaque décès de Covid et chaque décès par vaccin Covid est carrément garé à la porte de ModeRNA en attente de justice.

Mais nous n’exécuterons pas cette justice assez vite. Et donc le fléau final sur l’humanité d’Apocalypse 6: 8, livré par le 4e cavalier de l’apocalypse, que Bill Gates lui-même a prophétisé, arrivera plus tard cette année (après la guerre et après la famine, les 2e et 3e cavaliers).

Source: BREAKING: Official Biochemical and Statistical Evidence 100% confirms Moderna created Covid-19

 


N’hésitez pas à visiter notre boutique en ligne:vous trouverez plein de cadeaux pour vos proches

Sur ce lien:Vintage par Michel