La Criminelle Arnaque du Covid-19: Des composés métalliques toxiques trouvés dans tous les échantillons de vaccin COVID

Un groupe de scientifiques allemands indépendants a trouvé des composants toxiques – principalement métalliques – dans tous les échantillons de vaccin COVID-19 qu’ils ont analysés, « sans exception » en utilisant des techniques de mesure médicales et physiques modernes.
Le groupe de travail pour l’analyse des vaccins COVID indique que certains des éléments toxiques trouvés à l’intérieur des flacons de vaccins AstraZenecaPfizer et Moderna 
n’étaient pas répertoriés dans les listes d’ingrédients des fabricants.

Les éléments métalliques suivants ont été trouvés dans les vaccins :

  –  Métaux alcalins : césium (Cs), potassium (K)
–  Métaux alcalino-terreux : calcium (Ca), baryum (Ba)
–  Métaux de transition : cobalt (Co), fer (Fe), chrome (Cr), titane (Ti)
–  Métaux de terres rares : cérium (Ce), gadolinium (Gd)
–  Groupe minier/métal : aluminium (Al)
–  Groupe de carbone : silicium (Si) (en partie matériau de support/glissière)
–  Groupe oxygène : soufre (S)

Ces substances, en outre, « sont visibles au microscope à fond noir sous forme de structures distinctes et complexes de différentes tailles, ne peuvent être expliquées que partiellement par des processus de cristallisation ou de décomposition, [et] ne peuvent pas être expliquées comme une contamination due au processus de fabrication,  » ont découvert les chercheurs.

Ils ont déclaré que  leurs conclusions sont préliminaires.

Les résultats « s’appuient sur les travaux d’autres chercheurs de la communauté internationale qui ont décrit des résultats similaires, tels que le Dr Young, le Dr Nagase, le Dr Botha, le Dr Flemming, le Dr Robert Wakeling et le Dr Noak« , a déclaré le Dr. Janci Lindsay, Ph.D., une toxicologue non impliquée dans l’étude, a déclaré à Epoch Times.
« Le nombre et la cohérence des allégations de contamination à elles seules, associées au silence inquiétant des organismes mondiaux de sécurité et de réglementation, sont gênantes et déconcertantes en termes de ‘transparence’ et d’allégations continues de ces organismes selon lesquelles les vaccins génétiques sont ‘sûrs’« , a ajouté Lindsay.

 

La comparaison des cristaux dans le sang et dans le vaccin; à gauche, des formations cristallines se trouvent dans le sang des sujets testés vaccinés avec Comirnaty (BioNTech/Pfizer), les images de droite montrent que ces types de cristaux se trouvent également dans les vaccins Comirnaty.

 

 

 

 

 

 

 

 

 

 

 

 

Helena Krenn, la fondatrice du groupe, a soumis les conclusions aux autorités gouvernementales allemandes pour examen.

« Nous l’avions soumis aux participants du gouvernement et à d’autres adresses de journaux avec la plateforme open-debate.euuniquement en Allemagne, en Autriche et en Suisse », a déclaré Krenn à Epoch Times.

Deux autres découvertes importantes étaient que les échantillons de sang des vaccinés présentaient des « changements marqués » et que davantage d’effets secondaires étaient observés proportionnellement à « la stabilité de l’enveloppe des nanoparticules lipidiques« .

Une nanoparticule lipidique est une particule extrêmement petite, une membrane liposoluble qui est le cargo de l’ARN messager (ARNm).

Méthodologie

« En utilisant un petit échantillon d’analyses de sang vivant provenant d’individus vaccinés et non vaccinés, nous avons déterminé que l’intelligence artificielle (IA) peut distinguer avec une fiabilité de 100 % le sang des vaccinés et des non vaccinés. Cela indique que les vaccins COVID-19 peuvent affecter des changements à long terme dans la composition du sang de la personne vaccinée sans que cette personne soit consciente de ces changements ”, indique l’étude.

Les découvertes de changements physiologiques aigus et chroniques dans le sang des personnes inoculées avec les vaccins, systématiquement discernées via un logiciel d’IA, « fait également écho aux découvertes de nombreux autres chercheurs et soutiennent les affirmations de contamination et/ou d’adultération« , a déclaré Lindsay.

« Nous avons établi que les vaccins COVID-19 contiennent systématiquement, en plus des contaminants, des substances dont nous ne sommes pas en mesure de déterminer le but« , indique leur étude.

Le groupe est composé de 60 membres, dont des médecins, des physiciens, des chimistes, des microbiologistes et des praticiens de la santé alternative, soutenus par des avocats et des psychologues.

Objets anormaux dans le vaccin vectoriel Janssen de Johnson & Johnson. Il est à noter que des objets de ce type n’ont pas été retrouvés dans tous les échantillons.

 

 

 

 

 

 

 

 

 

 

 

Les scientifiques affirment que leurs résultats ont été confirmés à l’aide des techniques de mesure suivantes : « Microscopie électronique à balayage, spectroscopie à rayons X à dispersion d’énergie, spectroscopie de masse, analyse de plasma à couplage inductif, microscopie à fond clair, microscopie à fond noir et diagnostic d’images de sang vivant, ainsi que l’analyse d’images à l’aide de l’intelligence artificielle. ”

Les analystes expliquent qu’ils ont coopéré avec d’autres groupes dans différents pays qui ont mené des enquêtes similaires et ont obtenu des résultats conformes aux leurs.

« Les résultats de notre analyse des vaccins peuvent, par conséquent, être considérés comme validés de manière croisée« , indique le rapport de synthèse de leurs conclusions.

« Il faut reconnaître bien sûr que [le travail du groupe de travail allemand] est décrit comme des «résultats préliminaires», non encore publiés dans une revue à comité de lecture et cette chaîne de responsabilité ainsi que l’identité de bon nombre de ces scientifiques sont inconnues.

« Cependant, dans ce climat fortement chargé et censuré en ce qui concerne les défis à la » sécurité et à l’efficacité « des vaccins génétiques, je peux moi-même attester des difficultés à mener la recherche fondamentale, et encore moins à publier cette même recherche chez une revue à comité de lecture, afin de répondre à ces questions et de diffuser les résultats ”, a déclaré Lindsay.

Le vaccin Comirnaty de BioNTech/Pfizer présente
une diversité et un grand nombre d’objets insolites.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Le grand nombre de plaquettes et de formes cristallines peut difficilement être interprété comme des impuretés. Ils apparaissent régulièrement et en grand nombre dans tous les échantillons. Crédit photo : Helen Krenn

Astra ZenecaModernaPfizer et J&J n’ont pas répondu à une demande de commentaire.

Source: The Epoch Times


 

UNE INVITATION À VISITER NOS BOUTIQUES EN LIGNE

Passez une bonne journée,mes ami(e)s!

 

 

La tyrannie sanitaire…l’histoire continue

Les GUERRES des FOUS, sociopathes-psychopathes,  des tyrans  CONTRE les PEUPLES
Celà pourrait être le Titre d’un livre dans l’Histoire de l’Humanité.

Que l’on remonte à l’Antiquité, en passant par les Romains, L’Eglise ses croisades et son INQUISITION ses guerres pour des CROYANCES contre les cathares, la guerre de 30 ans, plus récemment le Stalinisme, le Nazisme, le Djihad, les CROYANCES entretenue sont à l’origine de ces guerres.

 » NOUS SOMMES EN GUERRE COÛTE QUE COÛTE « , est le dernier épisode de ces FOUS d’une Secte contre les peuples par cupidité et soif de pouvoir.

En Ukraine on a condamné un jeune de 20 ans qui n’a rien demandé dans cette guerre par procuration de l’OTAN contre la Russie, pour CRIME DE GUERRE.
Les vrais criminels ne sont jamais poursuivis, Je m’explique :

La guerre COÛTE QUE COÛTE actuelle est le summum du délire humain contre un ennemi FABRIQUÉ, de synthèse par des FOUS, un morceau d’ARN génétiquement modifié par des ciseaux à ADN ou ARN (CRISP Cas 9), appelé  » VIRUS ».  En fait un morceau de CHAROGNE d’ARN de chauve souris avec insertion de fragments de CHAROGNES d’ARN humain ou de primate, que depuis le début du XXème siècle grâce à Rockefeller, on appelle  » VIRUS » du latin poison. Rockefeller s’est  inspiré de l’ESCROQUERIE, du  HOAX de Pasteur sur son vaccin contre la Rage ou le vaccin contre le Charbon (l’Anthrax), qui n’a jamais fonctionné, et de son père, un charlatan vendant des remèdes. Mais passons sur l’incroyable histoire des vaccins, que des historiens ont parfaitement décrit.

Un  » VIRUS » est un TOXIQUE, mais n’appartient  pas au monde du vivant, il ne peut pas se reproduire, il n’a pas la mécanique cellulaire pour cela, pour exemple pas de ribosomes pour transcrire l’ARN ou l’ADN et pour fabriqué quoi que ce soit. En réalité c’est un morceau MORT de charogne d’ADN ou d’ARN, parfois libre, parfois encapsulé comme une spore en sommeil (et pourquoi pas dans permafrost mais sans vie), son enveloppe probablement fabriqué lors d’une intoxication d’un organisme vivant par ses défenses immunitaires: les phagocytes, macrophages, globules blancs de l’immunité innée. Autrement dit, des débris de cellules mortes pour une raison ou une autre.
Pour exemple, la Poliomyelite n’est pas due à un virus, mais à des TOXIQUES, le DDT et autres ou métaux lourds, qui comme par hasard ont été massivement produits par Rockfeller dans l’industrie chimique IG Farben Bayer Monsanto. Pourtant on continue à VACCINER depuis contre un virus inexistant, c’est  » PROMETTEUR » mais pas pour les vaccinés INUTILEMENT.

Idem pour le Charbon qui a l’origine des expériences vaccinales provenait d’animaux morts, de la CHAROGNE qui n’a jamais été transmise à d’autres animaux qu’en y ajoutant des morceaux de tissu en décomposition. Une imposture de plus.

La fausse pandémie du COVID 19 permet à des politiciens néolibéraux d’augmenter leurs pouvoirs de contrôle sur le peuple…comme une vraie dictature.
Ici,les premiers ministres François Legault du Québec et Justin Trudeau du Canada.

De l’importance des mots dans les CROYANCES :

Dire que l’on utilise des virus morts ou atténués, alors qu’au départ ils n’ont jamais été vivants, est un canular, une manipulation mentale entretenue par le Marketing ou la PROPAGANDE jusque dans les universités de médecine, faut-il le rappeler, mises en place par Rockefeller aux États-Unis, pour FORMATER les étudiants, tout en brevetant tous les remèdes existants donc RENTABLES, et en détruisant toutes les écoles de médecine conventionnelle utilisant des remèdes non brevetables.

La  » grippe  » espagnole a été inventé par le co-fondateur de la fondation de Santé Rockefeller, ça ne s’invente pas, Frederick Taylor Gates, le  » VIRUS  » de cette  » grippe » n’a jamais été à l’origine des 50 millions de morts, confère l’article publié par le Patron du système de Santé américains depuis 40 ans, le Dr Anthony FAUCI lui même en 2008, les 50 millions de décès étaient dû à des infections bactériennes sur une population au terrain immuno-déprimé par 4 années de guerre mondiale dans les tranchées et une population carencée en tout. C’est pour eux le TERRAIN qui a tué, comme aujourd’hui dans la Covid l’âge, l’immuno-dépression acquise ou génétique (plus rarement), par le diabète, l’obésité, l’HTA…., l’isolement, le confinement, la carence en vitamine D (un prix Nobel)  essentielle pour réguler notre système immunitaire, la carence en antioxydants, la vit C (un prix Nobel) pour exemple, les confinements étant par ailleurs immuno-dépresseurs et responsable de stress oxydatif, comme l’absence de vie sociale est responsable de dépressions, elle même d’Immuno-depression, et cerise sur le gâteau on a interdit les antibiotiques (consensus médical professionnel dans les pneumopathies atypiques), on a interdit tous les traitements actifs mais non rentables, pour exemple l’Ivermectine ( un prix Nobel) , l’hydroxychloroquine ( voir #LancetGate), l’Artrmisia, au départ même les anti-inflammatoires non stéroïdiens et les stéroïdiens corticoïdes et bien d’autres (voir  #TraitementsCovid préventifs et précoces), non RENTABLES en leurs préférant des traitements  » PROMETTEURS  » très RENTABLE mais soit pouvant être mortels comme le Remdesevir ou CONTRE INDIQUÉ en cas d’infections, comme les anti IL6 Tolicizumab.

La démission récente d’Horacio Arruda devient un sérieux aveux d’échec très gênant pour François Legault qui continue de rêver à trois mandats successifs.Il ne s’agit plus,depuis le début,d’une crise sanitaire mais d’un opportunisme politique pour le système corrompu à la merci de ces malades mentaux!

En fait ce sont les CRIMINELS de la Secte donnant les ordres aux chefs d’états complices, ils ont tout fait pour un #CRIMECONTRELHUMANITE (Cliquez), jusqu’à autoriser les dépresseurs respiratoires pour achever les handicapés ou les personnes âgés, sans même souvent un avis médical.

Concernant la grippe espagnole, elle est au départ secondaire à un essai clinique d’un vaccin contre la méningite bactérienne sur des militaires américains en 2017 par la fondation Rockefeller, ce sont ces militaires probablement immuno-déprimés qui ont été malades en diffusant ensuite leurs pneumopathies bactériennes.

Les dits  » virus  » n’ont été décrit qu’en 1933 et voir un morceau de débris organique, n’en fait qu’un corps étrangers. La représentation aujourd’hui n’est que l’aspect au microscope électronique avec des colorants métalliques et une image par reconstruction numérique.

CONCLUSIONS

La Secte du WEF de Davos du Club Bilderberg (voir #RokefellerGatesHomoDavos & Co,) mène une guerre contre des fragments d’organismes morts appelés  » VIRUS  » (poison), fabriqué en laboratoire en coopération Chine États-Unis-Europe (peut-être Ukraine), nous ont vendu des traitements  » PROMETTEURS  » RENTABLE et mortels, en attendant des  » vaccins ARN  » fragments de Spike génétiquement modifié de SYNTHESE ou morceaux de fragments de charogne de cellules organiques, qui non seulement provoqué un SIDA Vaccinal, autrement dit un déficit immunitaire acquis s’accentuant au fil des doses (7 étaient déjà prévues sur Ameli Pro), mais favorise les variants, notre système IMMUNITAIRE favorisant les mutations sous la pression immunitaire de ces morceauc de corps étrangers morts appelés  » VACCINS ARN  » maintenant avec des MORTS en masse chez les personnes en parfaite santé, même des grands sportifs sans aucune lésion endovasculaire préalables comme chez les obèses , les diabétiques , les hypertendus, les athéromateux…, les mêmes causes provoquant les mêmes effets en pire par la multiplication des doses, alors que la Covid donne une IMMUNITE naturelle ABSOLUE dans 97 % des cas contre une IMMUNITÉ négative des dits  » VACCINS ARN « .
Alors ce jeune soldat russe inconscient est condamné pour CRIME de GUERRE, les responsables de millions de MORTS dans des CRIMES CONTRE L’HUMANITÉ tout entière depuis plus d’un siècle contre des fragments d’ARN , d’ADN de CHAROGNES (voir #ScandaleDesVaccins ), sont toujours en liberté, poursuivent leurs méfaits pire que tous les FOUS précédents, sauf peut-être Tamerlan en Asie centrale (Ouzbékistan) qui a son époque a  éliminé environ 20 % de la population environnante, mieux que les Kmehrs rouge, Staline , les Nazis ou l’Eglise catholique en mission pour EXTETMINER des civilisations entière au Caraïbes, en Amérique Centrale, en Amérique du Sud jusqu’aux Etats-Unis avec les indiens au nom d’une CROYANCE !

On n’a pas entendu les Papes, pas même sous les Nazis, par contre aujourd’hui Poutine serait le Diable en personne à les entendre, mais je n’ai pas vu de symbole de Moloch, de Baphomet de Satan dans son bureau ou ailleurs, contrairement à nos chefs d’Etats, dans certains pays dont les États-Unis des statuts, ou chez les francs maçons l’Oeil inversé de la Providence de Dieu ou symbole satanique dans les brevets américains du contrôle Social WO2020/060606 ou le brevet américains des  » vaccins  » à l’hydroxyde de graphène avec son 666, un copier-coller du brevet chinois.

NB Vous pourrez toujours me qualifier de  » complotiste antivaxx… » à la différence des comploteurs du COMPLOT PERMANENT pour le pouvoir l’argent et le c…, j’ai une Morale, une Éthique, une Conscience fait un Serment à la différence de la Secte qui veut  gouverner le Monde sans Foi ni Loi hors la LEUR, sans Morale ni Éthique d’ailleurs toutes violées durant la Covid  » PROMETTEUSE  » pour EUX, mortelle pour les autres, certains lanceurs d’alertes  » complotistes » sont même morts dans des circonstances INEXPLIQUÉS !

Au contraire du FUCK-CHECKING tous les FAITS sont vérifiables, les preuves ont été publiées sous les  » #ScandaleDesVaccins ou #CrimeContreLhumanite « .

SOURCE: le rédacteur désire garder l’anonymat!


UNE INVITATION À VISITER NOS BOUTIQUES EN LIGNE

Passez une bonne journée,mes ami(e)s!

 

La Criminelle Arnaque du COVID 19:La Russie déclare que Covid est une arme biologique américaine. Twitter annule le compte russe pour avoir dévoilé cette vérité connue

Ce matin, la RT russe a rapporté que Twitter avait suspendu le compte officiel du ministère russe des Affaires étrangères : Twitter a temporairement suspendu le compte appartenant au ministère russe des Affaires étrangères, ont révélé des responsables à Moscou. Selon la porte-parole du ministère, Maria Zakharova, la mesure punitive a été imposée après que les diplomates ont cité un commandant militaire russe, qui avait allégué que les États-Unis auraient pu être à l’origine de la pandémie de Covid-19.

 

Mardi, Zakharova a publié un message sur sa chaîne Telegram, disant que le 5 août, Twitter « a bloqué pendant sept jours le compte officiel du ministère des Affaires étrangères en anglais ». Le diplomate a expliqué que la réaction brutale avait été déclenchée par la publication par le ministère d’un tweet contenant des extraits d’un discours prononcé plus tôt par le chef des troupes russes de protection nucléaire, biologique et chimique, le lieutenant-général Igor Kirillov.

Le tweet du ministère en question citait des affirmations selon lesquelles l’Agence des États-Unis pour le développement international aurait pu être à l’origine de la pandémie de Covid-19…

Le tweet qui a conduit à la suspension est précédé d’une plaque indiquant qu’il « a violé les règles de Twitter sur le partage d’informations fausses ou trompeuses qui pourraient nuire aux populations touchées par la crise« . La plateforme a toutefois noté qu’elle avait choisi de conserver le message « à des fins de responsabilité« .

Après que la guerre de la Russie avec l’Ukraine a éclaté il y a six mois, de nombreuses sanctions occidentales sévères ont été imposées à la Russie et à des Russes individuels. Mais cette suspension était sans précédent, aucune mesure de ce type n’ayant jamais été prise contre un compte Twitter officiel du gouvernement russe.

Cette mesure radicale souligne l’énorme gravité de ces accusations russes. Si le monde commençait à soupçonner que Covid était une arme biologique américaine, le paysage politique mondial pourrait changer radicalement.

Compte tenu de l’importance de ce dernier développement, il convient de récapituler la séquence d’événements précédente.

Le professeur Jeffrey Sachs de l’Université de Columbia est l’universitaire américain de haut rang qui avait présidé la commission Covid du Lancet, une revue médicale de premier plan. En mai, il a co-écrit un article dans la prestigieuse revue américaine PNAS soulignant les preuves très solides que Covid a été bio-conçu dans un laboratoire et a appelé à une enquête indépendante sur ses origines.

    A call for an independent inquiry into the origin of the SARS-CoV-2 virus (Un appel à une enquête indépendante sur l’origine du virus SARS-CoV-2)     Neil L. Harrison et Jeffrey D. Sachs • PNAS • 19 mai 2022 • 2 800 mots

Dans cet article, il a souligné que l’EcoHealth Alliance, fortement financée par notre propre ministère de la Défense, avait collecté très activement le type exact de virus qui constituait probablement le stock précurseur du virus Covid génétiquement modifié.

Ces affirmations dramatiques de personnalités universitaires de premier plan auraient dû faire les grands titres des médias, mais au lieu de cela, elles ont été ignorées par pratiquement tous les médias traditionnels et alternatifs, bien que j’en ai parlé dans une colonne.

Le mois suivant, le professeur Sachs a pris la parole lors d’une conférence de groupe de réflexion espagnol et il a fortement suggéré que le virus Covid semblait avoir émergé de la biotechnologie américaine. Quelques semaines plus tard, RT a publié un court article soulignant les déclarations de Sachs, et un extrait de ses remarques est devenu super viral quelques jours plus tard, étant retweeté plus de 11.000 fois et accumulant un million de vues, comme je l’ai décrit dans une colonne :

Le populiste britannique Daily Mail a finalement décidé de couvrir l’histoire, la portant à l’attention d’un public grand public :

    Covid a fui d’un laboratoire AMÉRICAIN (et non de l’installation chinoise notoire) au centre de la dissimulation de la pandémie, affirme le meilleur professeur américain décrit comme un « propagandiste de Xi »

    Connor Boyd • Daily Mail • 4 juillet 2022 • 1 500 mots

La semaine suivante, j’ai noté que la catastrophe nucléaire de Tchernobyl en 1986 avait joué un rôle majeur dans l’effondrement de l’Union soviétique, et que l’épidémie de Covid a été peut-être mille fois plus importante dans son impact mondial. Si le monde commençait à croire que le Covid avait une origine américaine, l’impact géopolitique serait monumental. Et avec plus d’un million d’Américains morts et deux ans de confinement et de vies perturbées, les conséquences politiques intérieures seraient tout aussi énormes :

    Mille fois plus grande que la catastrophe nucléaire de Tchernobyl

    Ron Unz • La revue Unz • 11 juillet 2022 • 2 300 mots

En partie à la suite des affirmations explosives du professeur Sachs, j’ai été interviewé fin juillet par Sputnik News, un média russe grand public avec 20 millions de visites mensuelles. Cela a finalement permis à mon analyse Covid d’atteindre un public beaucoup plus large et plus mondial :

    Éditeur américain : Et si l’épidémie de COVID faisait partie du plan de guerre biologique du Pentagone ?

    Ekaterina Blinova • Actualités Spoutnik • 31 juillet 2022 • 1 500 mots

L’article de Spoutnik semble avoir été l’un des plus populaires sur leur site Web, avec plus de 100 endossements par les lecteurs, et ma propre chronique sur la polémique a également généré un fort trafic, avec plus de 300 commentaires :

    Spoutnik fait le scoop du Daily Mail

    Ron Unz • La revue Unz • 1er août 2022 • 1 800 mots

Quelques jours après la publication de l’article de Spoutnik, le lieutenant-général Igor Kirillov, chef des Forces de défense radiologiques, chimiques et biologiques de la Russie, a tenu un briefing public au cours duquel il a évoqué la possibilité d’une responsabilité américaine dans l’épidémie mondiale de Covid. Comme l’a rapporté RT :

« Compte tenu de l’intérêt de l’administration américaine pour l’étude d’agents biologiques étroitement ciblés, de telles déclarations obligent à porter un regard neuf sur les causes de la pandémie du nouveau coronavirus et sur le rôle des biologistes militaires américains dans l’émergence et la propagation du Covid. -19 pathogène », a déclaré Kirillov.

La Russie soupçonne maintenant que l’USAID pourrait avoir été directement responsable de l’émergence du virus Covid-19, selon Kirillov, qui a souligné un article du Lancet du professeur de Columbia Jeffry Sachs, qui a suggéré que le virus a probablement été créé dans un laboratoire avec l’aide des dernières réalisations américaines dans le domaine de la biotechnologie…

« La mise en œuvre du scénario de développement COVID-19 et l’arrêt d’urgence du programme Predict par l’USAID en 2019 suggèrent la nature délibérée de la pandémie et l’implication des États-Unis dans son apparition« , a déclaré Kirillov.

    Le gouvernement américain pourrait être complice de l’émergence de Covid – Russie

Moscou évalue la possibilité qu’une agence de Washington DC ait joué un rôle dans la création de Covid-19

    RT News • 4 août 2022 • 500 mots

Après que le ministère russe des Affaires étrangères a publié un Tweet contenant des extraits du discours du lieutenant-général Kirillov, son compte a été immédiatement suspendu par Twitter.

Je n’ai aucune idée particulière de la pensée des moniteurs Twitter qui ont suspendu le compte de la Russie, mais je soupçonne qu’ils considéraient sincèrement ces accusations russes de Covid comme totalement absurdes et dangereuses, une « théorie du complot » scandaleuse n’ayant absolument aucun fondement dans la réalité. [au contraire, je pense que Twitter a obéi à un ordre venant du gouvernement américain qui a compris la dangerosité de cette information, et son impact énorme sur les populations américaines et mondiales. H.G.]

Les dirigeants d’entreprise tirent probablement leur compréhension du monde des mêmes sources médiatiques que le grand public, et si aucun journaliste occidental n’a jamais laissé entendre que Covid aurait pu être une arme biologique américaine, la notion semblerait tout aussi inimaginable à un responsable Twitter qu’elle le serait pour son propre voisin de palier. Ceux qui contrôlent les médias contrôlent les contours de la réalité perçue.

Pendant plus de deux ans, j’ai été stupéfait par la réticence totale de pratiquement tous les journalistes traditionnels ou alternatifs à prendre connaissance des preuves très solides de la culpabilité américaine. Pas plus tard qu’hier, j’ai envoyé cette note à un membre de l’élite américaine avec qui je suis ami depuis de nombreuses années :

… toute la situation ébranle l’imagination.

Pour le même argument, supposons que j’ai raison et qu’il y a au moins de bonnes chances que le contrecoup d’une attaque de guerre biologique non autorisée ait maintenant tué un million d’Américains.

Pouvez-vous penser à quoi que ce soit dans l’histoire du monde, sans parler de l’histoire de l’Amérique, qui soit comparable à cela ? Comme je l’ai soutenu dans l’un de mes articles récents, c’est probablement 1000 fois une catastrophe mondiale plus importante que Tchernobyl.

Et l’idée qu’absolument personne ne veut en discuter est tout simplement incroyable. C’est comme si le NKVD de Staline allait les  envoyer au Goulag [ou à Gaza] s’ils disaient quoi que ce soit. Je veux dire que c’est une chose si les gens ont peur de se faire tirer dessus, mais c’en est une autre s’ils ont simplement peur d’être critiqués sur Twitter…

Je ne comprends tout simplement pas pourquoi absolument personne ne veut prendre position publiquement sur cette question. Une fois que tous les faits ont été connus il y a plus d’un an, j’ai supposé que le barrage se briserait d’une semaine à l’autre.

Des centaines de manifestants à Sydney,Australie,le 24 juillet5 2021

Et sa réponse :

C’est assez incroyable.

Début août, le professeur Sachs a accordé une longue interview à Current Affairs, une publication alternative progressiste, dans laquelle il a décrit les obstacles rencontrés par son enquête du Lancet sur les origines de Covid. Les membres scientifiques servant sous ses ordres ont refusé d’explorer tout rôle américain dans la création du virus et n’étaient pas disposés à divulguer les récentes recherches américaines dans des domaines connexes :

Ce que je demande n’est pas la conclusion. J’appelle à l’enquête. Enfin, après deux ans et demi de cela, il est temps d’admettre qu’il pourrait être sorti d’un laboratoire et voici les données que nous devons connaître pour savoir si c’est le cas…

On a en fait demandé au NIH à un moment donné : donnez-nous votre programme de recherche sur les virus de type SRAS. Et vous savez ce qu’ils ont fait ? Ils ont publié la page de couverture et rédigé 290 pages. Ils nous ont donné une page de garde et 290 pages vierges ! C’est NIH, pour l’amour du ciel. Ce n’est pas une société. C’est le gouvernement américain chargé de nous garder en bonne santé.

    Pourquoi le président de la commission COVID-19 du Lancet pense que le gouvernement américain empêche une véritable enquête sur la pandémie

    Jeffrey Sachs • Current Affairs • 2 août 2022 • 4 300 mots

Depuis avril 2020, j’ai soutenu que l’épidémie de Covid était probablement due à une attaque américaine de guerre biologique contre la Chine (et l’Iran), tout comme les Iraniens l’avaient affirmé à l’époque. Cette attaque s’est presque certainement produite sans l’autorisation personnelle du président Trump et constituait donc une «opération voyou».

Ma propre longue série d’articles a documenté les preuves très solides de la culpabilité américaine, y compris notamment la prescience évidente de l’épidémie de Wuhan. Tous les éléments sources sous-jacents ont été fournis dans les reportages des médias établis et ne peuvent pas être facilement niés.

Mais des journalistes timorés ont détourné les yeux et ont refusé de prêter attention à ce qui avait été révélé dans leurs propres publications.

    Covid/Biowarfare Series
Ron Unz • The Unz Review • Avril 2020-décembre 2021 • 60 000 mots

J’ai également présenté ces mêmes informations dans un certain nombre d’entretiens en podcast, qui ont maintenant été visionnés près d’un million de fois, dont près de 50.000 vues au cours des deux derniers jours. Au fur et à mesure que les faits qu’ils présentent deviennent plus largement connus, des changements politiques dramatiques peuvent commencer à se produire.

Je soupçonne que si les dirigeants de Twitter avaient pris connaissance de ces informations factuelles, ils auraient pu considérer les déclarations publiques du ministère russe de la Défense sous un jour très différent.

Trois des présentations les plus importantes totalisent près de quatre heures et sont facilement disponibles sur Rumble.

Kevin Barrett, FFWN • February 16, 2022 • 15m
Video Link

Geopolitics & Empire • February 1, 2022 • 75m
Video Link

Red Ice TV • February 3, 2022 • 130m
Source

Par Ron UNZ : Twitter Cancels Russia Over Covid Biowarfare Accusations

Unz Review

RÉCHERCHEZ  AUSSI CES INFOS HISTORIQUES

13 mars 2020 CONFIRME. Les USA ont introduit le COVID-19 en Chine à l’occasion des « Jeux Militaires » de Wuhan
l6 mars 2020 Coronavirus. Après la Chine, les soldats américains infestent l’Europe, le Japon, la Corée du Sud, etc.
11 mai 2020 Des sportifs français contaminés par le Covid-19 dès octobre aux Jeux militaires de Wuhan ?
6 décembre 2020 Bis repetita. La « Grippe Espagnole » de 1918 était une pandémie mondiale provoquée par Rockefeller et l’armée américaine
20 décembre 2020 COVID. Les tenants et les aboutissants de l’Arnaque. Par Foster Gamble
17 février 2021 Ils ont baptisé « conspirateur COVID » de nombreux chercheurs sérieux.
15 avril 2021 Covid-Arnaque. Microchip sous la peau: Le Pentagone a conçu un hydrogel injectable
17 juin 2021 Les États-Unis ont fabriqué la bio-arme Covid et l’ont d’abord disséminée en Chine et en Iran. Ils ont contaminé le Monde
2 août 2021 USA. Le virus Covid-19 se serait échappé du laboratoire dès juillet 2019
25 février 2022 Ukraine. Les Russes vont découvrir l’énorme complexe de laboratoires américains d’armes biologiques
Beaucoup d’encre a coulé depuis le déclenchement mondial de la « crise du Covid-19 ». Et pourtant, les réactions des philosophes sur la question laissent entièrement à désirer. La plupart ont pris pour argent comptant la narration officielle faite de ladite « crise », et n’ont pas songé à interroger les fondements mêmes de cette narration, pourtant d’évidence cousue de fil blanc en tous ses points stratégiques

UNE INVITATION À VISITER NOS BOUTIQUES EN LIGNE

Passez une bonne journée,mes ami(e)s!

 

 

 

 

La Criminelle Arnaque du COVID-19:Les vaccins anti-Covid enfin reconnus dangereux !

La télévision Fox News vient de le révéler aux Américains. Or, Jean-Marc Sabatier ne cesse de le répéter : la multiplication des doses de vaccins affaiblit l’immunité naturelle.

 

 

 

 

 

 

 

 

La vérité a parfois du mal à s’imposer, surtout si elle dérange les consciences, si elle touche de gros intérêts financiers, si elle remet en cause le dogme. Toutes les vérités, même scientifiques, ne sont pas bonnes à dire. Rappelons-nous Galilée. Pour avoir affirmé que la terre était ronde, le mathématicien a failli connaître les tourments du bûcher.
Il en va ainsi des vaccins anti-Covid censés sauver l’humanité d’une pandémie dévastatrice. Administrés massivement et sous contrainte, ils n’ont empêché ni l’infection, ni la réinfection et encore moins la transmission du virus. Pire : la multiplication des doses s’est révélée être plus dangereuse que bénéfique en raison des effets secondaires nombreux et, parfois, très graves, qu’elles engendrent.

« Un facteur de risque majeur »

Un article du Lancet publié en février 2022 sur la population suédoise constatait « une diminution progressive de l’efficacité du vaccin contre l’infection par le SRAS-CoV-2 ». Au mois de juin, un médecin japonais, Kenji Yamamoto, publiait un article intitulé « Effets indésirables des vaccins et mesures pour les prévenir ».
Reprenant les éléments du Lancet, il écrit : « L’étude a montré que la fonction immunitaire des personnes vaccinées 8 mois après l’administration de deux doses de vaccin Covid-19 était inférieure à celle des personnes non vaccinées. Selon les recommandations de l’Agence européenne des médicaments, des injections de rappel fréquentes de la Covid-19 pourraient avoir un effet négatif sur la réponse immunitaire et ne sont peut-être pas réalisables. (…) Par mesure de sécurité, les nouvelles vaccinations de rappel doivent être interrompues. (…) En conclusion, la vaccination COVID-19 est un facteur de risque majeur pour les infections chez les patients en état critique. »

Un lien de causalité

D’autres scientifiques ont plus récemment alerté sur les dangers de la vaccination répétée. Stephanie Seneff, Greg Nigh, Anthony Kyriaakopoulos et Peter McCullough ont publié un article intitulé « Suppression de l’immunité innée par les vaccinations à l’ARNm du SRAS-CoV-2 : Le rôle des quadruplexes G, des exosomes et des micro-ARN. »

Dans cet article, les scientifiques présentent « des preuves que la vaccination induit une altération profonde de la signalisation de l’interféron de type I, qui a diverses conséquences néfastes sur la santé humaine. Les cellules immunitaires qui ont absorbé les nanoparticules du vaccin libèrent dans la circulation un grand nombre d’exosomes contenant une protéine de pointe ainsi que des microARN critiques qui induisent une réponse de signalisation dans les cellules réceptrices à distance… Ces perturbations ont potentiellement un lien de causalité avec les maladies neurodégénératives, la myocardite, la thrombocytopénie immunitaire, la paralysie de Bell, les maladies du foie, l’immunité adaptative altérée, la réponse altérée aux dommages de l’ADN et la tumorigenèse… Nous pensons qu’une évaluation complète des risques et des avantages des vaccins à ARNm remet en question leur contribution positive à la santé publique. »

Une découverte fondamentale

Jean-Marc sabatier
Jean-Marc sabatier

 

 

 

 

 

 

 

 

 

Si le public américain découvre aujourd’hui à la télévision les effets nocifs des vaccins (voir la vidéo ci-dessous), les lecteurs d’infodujour.fr sont alertés depuis longtemps par les articles de Jean-Marc Sabatier*.
Dès le mois d’avril 2020 le scientifique publiait un article révélant l’atteinte de l’immunité innée induite par le SARS-CoV-2 (via sa protéine Spike) et décrivait le dysfonctionnement du système rénine-angiotensine responsable des maladies Covid-19.
En décembre 2020, dans un article intitulé « Et si le SRA expliquait la Covid-19 ? » nous évoquions alors « l’histoire d’une découverte fondamentale française, celle du Pr Jean-Marc Sabatier, qui pourrait bouleverser la compréhension et le traitement de cette maladie décidément bien mystérieuse. »
Plus récemment, deux articles ont ébranlé les données scientifiques.
Le 29 juin, dans une interview qui a fait du bruit « Covid-19 : les limites de la vaccination » Jean-Marc Sabatier expliquait pourquoi « la vaccination pourrait, elle-même, favoriser l’infection ». En conclusion : « des injections vaccinales répétées d’un même antigène, quel qu’il soit (ici la protéine Spike du SARS-CoV-2), à des niveaux qui dépassent le seuil ‘’critique’’, conduisent inévitablement à un dérèglement de l’immunité innée, et à l’apparition de potentiels troubles auto-immuns. Ainsi, pour les vaccins anti-Covid-19 actuels, il existe au moins trois bonnes raisons scientifiques de ne pas procéder à des injections vaccinales multiples, avec l’action directe et néfaste de la protéine Spike sur le SRA et l’immunité innée, la répétition de ces injections qui dérègle également l’immunité innée de l’hôte et les effets nocifs potentiels de certains adjuvants, dont les nanoparticules lipidiques. »

Un fact checking bidon

Il est vrai qu’un fact checking de l’AFP est venu contredire les propos du scientifique. Un jeune ‘’vérificateur’’ (diplômé en histoire !) s’est cru autorisé à remettre en cause les infos contenues dans cet article.
Jean-Marc Sabatier et infodujour.fr ont donc apporté une réponse circonstanciée le 24 mai 2022 à ce fact checking à la sauce Pfizer.
L’historien-fact checker réfute l’idée selon laquelle le vaccin endommagerait le système immunitaire. Réponse de Jean-Marc Sabatier : « Les vaccins et rappels anti-Covid-19 altèrent (affaiblissent) le système immunitaire de l’hôte, car la protéine spike vaccinale est capable d’agir sur les cellules de l’immunité innée (via les récepteurs AT1R et Toll-like, notamment TLR4 et TLR2) et d’altérer leur fonctionnement.
La protéine Spike (vaccinale ou virale) affecte aussi l’immunité adaptative/acquise. Il existe ainsi une lymphocytopénie induite (liée au syndrome d’activation macrophagique et une hémo-phagocytose associée qui tue des lymphocytes T CD4+ auxiliaires et CD8+ cytotoxiques, les lymphocytes B et les cellules NK tueuses) conduisant à un syndrome d’immunodéficience acquise/induite.
Etudes : 1, 23, 4, 5, 6, etc. »

La vérité est parfois difficile à admettre et longue à s’imposer. Mais elle finit par triompher face à des faits tenaces. L’histoire tourmentée de la Covid-19 et de ses vaccins qui n’en sont pas, resteront dans les annales des mensonges de l’Histoire.

*Jean-Marc Sabatier est directeur de recherches au CNRS et docteur en Biologie Cellulaire et Microbiologie, HDR en Biochimie. Éditeur-en-Chef des revues scientifiques internationales : « Coronaviruses » et « Infectious Disorders – Drug Targets ». Il s’exprime ici en son nom propre.

 

 

 

 

 

 

 

 

 

Comme il s’agit de la Vérité,vous ne pouvez pas  l’écrire sur Facebook…vous serez traité comme un complotiste et perdrez peut-être votre  compte Facebook censuré que vous aimez tant!


UNE INVITATION À VISITER NOS BOUTIQUES EN LIGNE

Passez une bonne journée,mes ami(e)s!

 

 

 

 

 

La Gigantesque Arnaque du COVID-19:Coup de tonnerre sur les origines du Covid

Depuis le premier jour de l’apparition de l’arnaque Covid, nous avons soutenu que (1) aucun virus n’a été isolé , (2) l’origine de cette arme biologique mortelle est américaine, et (3) cette arme a été initialement testée sur l’Iran (plusieurs milliers de morts) et la Chine. Avec plus de 2 ans de retard, Ron Unz confirme tout cela et plus encore. 

Ron Unz
Il arrive que la trajectoire de l’histoire humaine puisse être déviée par une petite étincelle, lorsque celle-ci met le feu à un baril de poudre idéologique. Tombant à point nommé pour la fête nationale des États-Unis du quatre juillet, une énorme explosion dans l’attention du grand public vient de submerger les origines de l’épidémie de Covid, et de relancer le débat sur les causes de l’épidémie globale qui a emporté plus d’un million de vies aux États-Unis et a perturbé le monde entier.

Wow Prof. Jeffrey Sachs: « J’ai présidé pendant 2 ans la commission du Lancet sur le Covid. Je suis convaincu que ce virus est sorti d’un laboratoire de biotechnologie étasunien […] Nous n’en avons pas la preuve, mais nous disposons de suffisamment d’éléments. [Pourtant] aucune enquête n’est menée, ni aux États-Unis, ni ailleurs »

Le professeur Jeffrey Sachs est l’universitaire de haut niveau qui a présidé la commission Lancet sur le Covid, et il y a quinze jours, il a fait des déclarations publiques qui semblent indiquer que le virus aurait été fabriqué aux États-Unis. Le 1er juillet, j’ai republié un bref article produit par RT faisant part de ces déclarations, et le lendemain, un petit clip faisant état de ses remarques est devenu ultra-viral sur les réseaux sociaux : il a été retweeté plus de 9000 fois et la vidéo a été vue 800 000 fois, avec une croissance qui s’est constatée de minute en minute. En toute fin de compte, nos médias occidentaux vont peut-être se retrouver confrontés au problème qu’ils ont mis tant de soin à éviter d’évoquer depuis plus de deux ans.

Wow😯Prof. Jeffrey Sachs:

« J’ai présidé pendant 2 ans la commission du Lancet sur le Covid. Je suis convaincu que ce virus est sorti d’un laboratoire de biotechnologie étasunien […] Nous n’en

avons pas la preuve, mais nous disposons de suffisamment d’éléments. [Pourtant] aucune enquête n’est menée, ni aux États-Unis, ni ailleurs ». pic.twitter.com/IYvSJnlv1q

— Arnaud Bertrand (@RnaudBertrand) 2 juillet 2022

La suggestion incendiaire émise par Sachs tombe un mois après qu’il a co-signé un article universitaire au sein du prestigieux journal Proceedings of the National Academy of Sciences, indiquant les éléments importants qui laissent à penser que le Covid était le produit fabriqué génétiquement dans un laboratoire, et demandant une enquête indépendante sur le rôle possible des États-Unis dans la fabrication du virus qui a tué plus de 20 millions de gens dans le monde entier.

A call for an independent inquiry into the origin of the SARS-CoV-2 virus
Neil L. Harrison and Jeffrey D. Sachs • PNAS • 19 mai 2022 • 2800 mots

Il y a deux ans, la commission qu’il a présidée sur le Covid avait conclu que le virus était sans doute d’origine naturelle, un verdict rapidement adopté de manière uniforme par les médias des États-Unis, et Facebook en était même venu à censurer les opinions contraires. Le retournement public de Sachs sur cette question centrale représente donc une bombe gigantesque, mais à l’exception d’un seul article paru dans the Intercept, l’événement est resté totalement ignoré par les médias, malgré mes propres efforts pour le mettre en lumière.

Mais un Tweet bien rédigé a désormais attiré un tel niveau d’attention qu’il va sans doute devenir très difficile désormais pour les médias de continuer à ignorer ce sujet.

En parcourant l’énorme fil Twitter, la seule réfutation substantielle que j’ai trouvée venait du professeur Richard H. Ebright de Rutgers, un virologue influent très impliqué dans le débat sur le Covid, qui prétend que les propos de Sachs ont été mal interprétés. À en croire Ebright, Sachs ne faisait que suggérer que c’était la biotechnologie étasunienne, et non concrètement un laboratoire étasunien, qui avait été responsable du Covid :

Il s’agit d’une mauvaise interprétation de l’affirmation et de la conclusion de Sachs.

Sachs a parlé d’une « biotechnologie de laboratoire des États-Unis », pas d’« un laboratoire de biotechnologie des États-Unis. » (les articles « un » et « de » sont des interpolations erronées faites par l’auteur du Tweet). Sachs conclut que le virus provient d’un laboratoire chinois faisant usage de biotechnologie étasunienne.

— Richard H. Ebright (@R_H_Ebright) 2 juillet 2022

Les mots employés par Sachs sont certes un peu indistincts et peut-être quelque peu ambigus, et je les avais personnellement interprétés de la même manière et j’avais pensé qu’il induisait purement et simplement que le virus aurait pu être produit aux États-Unis, mais sans l’affirmer explicitement. Mais l’autre principal candidat à constituer la source du virus a toujours été le laboratoire de Wuhan, et Sachs n’a jamais fait ne serait-ce que mention de cette possibilité, ce qui reflète possiblement ses doutes à ce sujet. Quoi qu’il en soit, l’affirmation d’Ebright que « Sach[s] conclut que le virus est sorti d’un laboratoire chinois faisant usage de biotechnologie étasunienne » est un résumé totalement erroné de ce qu’affirme Sachs.

Cette étrange et fallacieuse affirmation émise par Ebright peut enfin attirer l’attention sur son implication personnelle étrange et plutôt détournée dans le débat sur les origines du Covid, un sujet que j’avais traité en détail dans un article que j’ai publié il y a presque un an, dont certains extraits méritent d’être cités.

Alors que le coronavirus commençait peu à peu à se répandre hors des frontières de la Chine, un autre développement s’est produit, qui a grandement multiplié mes soupçons. La plupart de ces premiers cas s’étaient produits exactement là où on pouvait les attendre, dans les pays d’Asie de l’Est jouxtant la Chine. Mais à la fin du mois de février, l’Iran était devenu le second épicentre de l’épidémie globale. Plus surprenant encore, les élites politiques de ce pays avaient été très fortement touchées, avec pas moins de 10% des membres du parlement iranien rapidement infectés, et au moins une douzaine de dirigeants du pays tués par le virus, parmi lesquels des hommes plutôt âgés. De fait, les activistes néo-conservateurs se réjouissaient sur Twitter de voir leurs ennemis iraniens détestés tomber comme des mouches.

Examinons les implications de ces faits. Dans le monde entier, les seules élites politiques qui ont jusqu’ici subi des pertes humaines significatives ont été celles de l’Iran, et ils sont morts très tôt, avant que l’épidémie n’ait significativement éclaté où que ce soit dans le monde, hormis la Chine. Aussi, nous voyons les États-Unis assassiner le plus haut commandant militaire iranien le 2 janvier, puis, quelques semaines plus tard, de vastes franges des élites dirigeants iraniennes subitement infectées par un nouveau virus mystérieux et mortel, qui a tué un grand nombre d’entre eux. Est-ce qu’une personne dotée de raison peut considérer ces événements comme une simple coïncidence ?

Les Iraniens avaient tout à fait conscience de ces éléments, et leurs hauts-dirigeants politiques et militaires ont accusé publiquement les États-Unis de mener une attaque biologique interdite contre leur pays et contre la Chine, leur ancien président allant jusqu’à émettre une plainte officielle auprès des Nations Unies. Mais bien que ces accusations explosives aient été largement couvertes par la presse iranienne, elles sont restées totalement ignorées des médias étasuniens, si bien que presque aucun habitant des États-Unis n’en a quasiment entendu parler.

Et le rôle central pour réfuter ces accusations explosives en provenance d’Iran a été joué par Ebright, dont très tôt les positions publiques sur le virus ont été strictement opposées à celles qu’il a ensuite affirmé avoir tenues depuis le départ. Comme je l’ai écrit :

Je pense que cette reconstruction des événements est soutenue par les positions publiques remarquablement contraires entre elles adoptées par le professeur Richard H. Ebright, un biologiste moléculaire et expert en sûreté biologique très réputé de Rutgers, qui s’est récemment positionné comme soutien scientifique le plus cité de la théorie du virus-ayant-fuité-du-laboratoire-de-Wuhan.

Au mois de janvier, Nicholson Baker avait cité Ebright, qui affirmait que des années durant il avait été préoccupé par le laboratoire de Wuhan et des travaux qui y étaient menés en vue de créer des coronavirus de chauve-souris de type SARS « chimériques »« présentant une infectivité humaine améliorée ». Au sein d’un e-mail, le scientifique avait en outre déclaré que « Dans le présent contexte, la nouvelle d’un nouveau coronavirus à Wuhan ***criait*** à la fabrication en laboratoire. »

Peu de temps après, Ebright est devenu l’un des signataires de premier-plan de la lettre ouverte du mois de mars, critiquant vertement le rapport de l’OMS, et appelant à une nouvelle enquête internationale sur le laboratoire de Wuhan, et a soutenu ses opinions dans une longue interview accordée à Independent Science News. Selon l’article de Vanity Fair, lorsque les tous premiers rapports d’épidémie de Covid étaient apparus, ses soupçons à l’encontre d’un virus artificiel fuité du laboratoire de Wuhan avaient été immédiats, en l’espace d’« une nanoseconde ou une picoseconde. » Les affirmations d’Ebright ont également constitué une pièce maîtresse de l’article fondateur de Wade :

Il est clair et limpide que l’Institue de Virologie de Wuhan s’employait de manière systématique à fabriquer de nouveaux coronavirus chimériques, et évaluait leur capacité à infecter des cellules humaines ainsi que des souris ACE2 exprimant des gènes humains. Il est également clair que, selon les contextes génomiques constants choisis pour les analyses, ces travaux auraient pu produire le SARS-CoV-2 ou un progéniteur proche du SARS-CoV-2… Il est clair que tout ou partie de ces travaux étaient réalisés suivant un standard de biosécurité… qui allait provoquer des risques inacceptablement élevés d’infection du personnel du laboratoire. Il est également clair que ces travaux n’auraient jamais dû être financés, et n’auraient jamais dû avoir lieu.

Pourtant, de manière tout à fait étrange, Ebright, durant les premiers mois de l’épidémie, avait semblé tenir une position publique absolument contraire. Dans son interview du 29 janvier 2020 au Washington Postil avait déclaré : « Sur la base du génome et des propriétés du virus, il n’existe aucune indication d’aucune sorte qu’il puisse s’agir d’un virus fabriqué [artificiellement]. Et selon un article du Post paru quelques semaines plus tard, il avait également ajouté : « La possibilité qu’il puisse s’agir d’une arme biologique délibérément déclenchée peut être nettement exclue. »

Les affirmations radicales d’Ebright avaient pour objet de réfuter les allégations très répandues selon lesquelles le Covid était une arme biologique chinoise qui avait été propagée par accident, mais bientôt, elles se sont avérées très utiles à notre propre RFE/RL1, sponsorisé par notre gouvernement, dénonçant l’accusation de guerre biologique lancée par l’Iran comme « affirmation infondée » soutenue par « aucune preuve » et citant les affirmations radicales d’Ebright pour réfuter cette thèse. Cet apparent consensus scientifique selon lequel le virus était naturel garantissait que toute nouvelle accusation iranienne serait sommairement rejetée comme totalement irrationnelle par les médias internationaux, contraignant Téhéran à abandonner ses vaines tentatives.

Que ma propre analyse des motivations d’Ebright soit correcte ou non, la réalité indéniable est que la voix scientifique ayant affirmé haut et fort en premier que le Covid était naturel est devenue la voix que l’on entend le plus pour affirmer que le virus est sorti d’un laboratoire, une thèse qu’il maintient désormais avoir soutenue depuis le tout début. Au sein des médias, nul ne paraît avoir commenté ou même remarqué ce changement de position radical.

Aussi, lorsque début 2020 les Iraniens ont accusé les États-Unis d’avoir lancé une attaque de guerre biologique contre leur pays et la Chine en utilisant le virus du Covid, les déclarations du professeur Ebright selon lesquelles le virus était absolument naturel avaient été utilisées pour repousser les accusations portées contre le gouvernement des États-Unis. Mais plus tard la même année, après que ces accusations iraniennes furent oubliées, Ebright s’est mis à affirmer que depuis le tout début, il avait estimé que le virus était artificiel, très probablement un produit chinois sorti du laboratoire de Wuhan. Dans chacun des cas, sa position a parfaitement servi à soutenir les intérêts de propagande immédiats de l’establishment de sécurité des États-Unis, et dans nos médias, il ne s’est trouvé absolument personne pour lui demander d’expliquer ces positionnements totalement contradictoires. Peut-être que des personnes actives sur Twitter devraient à présent commencer à lui poser des questions sur ces sujets.

Les laboratoires militaires secrets de Wuhan,vus du ciel.

Le sous-texte absolument tabou du débat en cours est la possibilité évidente que le virus du Covid ait pu être créé dans un laboratoire des États-Unis, puis délibérément déployé contre la Chine et l’Iran, exactement comme dénoncé à l’époque par le gouvernement iranien, pour finir par se répandre et dévaster les États-Unis et le reste de l’Occident.

Au cours des deux dernières années, je suis resté pratiquement seul à soutenir cette hypothèse controversée, qui est restée presque totalement exclue à la fois des médias dominants et des médias alternatifs. On peut lire ma longue suite d’articles sur mon site, qui ont été assemblés dans un eBook disponible librement, déjà téléchargé plus de 110 000 fois :

Covid/Biowarfare Series
Ron Unz • The Unz Review • avril 2020-décembre 2021 • 60000 mots

 

Les interviews filmées au cours desquelles j’ai présenté mes analyses sur les origines du Covid ont déjà été vues presque 600 000 fois ; en voici les trois plus populaires et importantes. Je m’attends à ce que ces nombres de visionnages augmentent fortement si les commentaires émis par Sachs portent le sujet au cœur du débat public.

 

 

 

 

Par Ron Unz − Le 4 juillet 2022 − Source unz.com


UNE INVITATION À VISITER NOS BOUTIQUES EN LIGNE

Passez une bonne journée,mes ami(e)s!

La Criminelle Arnaque du COVID-19:Découverte de Vaxxins Covid-19 pour enfants contenant de la Drogue Scopolamine qui peut les Zombifier et en faire des Proies faciles pour les Pédophiles !

De la scopolamine trouvée dans les vaccins Covid pour enfants ! 
L’armée américaine a trouvé la drogue scopolamine dans des vaccins Covid-19 destinés à atteindre les bras des enfants, ont déclaré des sources du bureau du général David H. Berger à Michael Baxter. 
La scopolamine est connue sous plusieurs noms, notamment hyoscine, burandanga, « Haleine du diable » et « la drogue des zombies ».

Dérivée des plantes de la morelle, elle a acquis une certaine notoriété en Colombie où les criminels l’utilisent pour droguer les touristes naïfs et imprudents. 

Sur Internet, les histoires abondent de touristes qui font la tournée des bars, discutent avec les femmes du coin, s’évanouissent et se réveillent trois jours plus tard pour découvrir qu’ils ont été volés et que leurs comptes bancaires ont été vidés. 

Certains ne reprennent jamais conscience. 
La drogue, soluble, inodore et sans saveur, est censée priver une personne de son libre arbitre et la zombifier. 

L’effet est si puissant que des victimes de la scopolamine ont aidé leurs agresseurs avant de tomber inconscientes. 

Elles remettent volontairement leurs portefeuilles, leurs cartes de crédit et leurs codes pin, et ont même aidé leurs agresseurs à vider leurs appartements ou leurs chambres d’hôtel de leurs objets de valeur. 
La puissance de cette drogue n’a pas échappé aux services de renseignement américains : la CIA ajouterait de la scopolamine à diverses formules de « sérum de vérité ». 

Il est incompréhensiblement effrayant de croire que des fabricants de produits pharmaceutiques incluraient ce mélange dans des vaccins conçus pour des enfants particulièrement jeunes, mais l’armée prétend que c’est vrai. 
Après que la FDA a donné à Pfizer et Moderna la permission d’injecter des vaccins aux enfants, et que des sites de vaccination de masse pour les enfants ont commencé à apparaître dans les bastions libéraux, l’armée américaine a commencé à s’infiltrer subrepticement dans ces lieux pour collecter des flacons pour des analyses chimiques. 

Mais ils ne cherchaient pas de scopolamine. 

En mai, Michael Baxter a rapporté que les Chapeaux Blancs avaient trouvé et détruit un entrepôt de Moderna ; les ampoules de vaccins obtenues dans l’entrepôt contenaient des pesticides. 
« Big Pharma a des centaines d’entrepôts discrètement cachés à travers le pays. 

Les trouver tous était impossible. 

Lorsque nous avons trouvé des pyréthroïdes dans des ampoules à un seul endroit, nous avons su que ce n’était pas un incident isolé. 

Ils voulaient empoisonner des enfants. 

Maintenant il est évident que le complot est plus profond. 

Je ne peux pas dire comment exactement nous avons obtenu les vaccins contaminés – nous les avons trouvés à New York et en Californie. » 
Il a déclaré que les Chapeaux Blancs avait confisqué une douzaine de flacons Moderna sur un important site de vaccination d’enfants à Massapequa, dans l’État de New York, et davantage sur un site similaire à San Bernadino, en Californie. 

Les flacons ont été expédiés aux alliés des Chapeaux Blancs à l’U.S. Army Medical Research. 

Cinquante pour cent contenaient des quantités appréciables de Scopolamine. 
A San Bernadino, 25% des vaccins contenaient des quantités significatives de la drogue. 
« C’est une information horrible », a dit notre source. 

« Nous n’avons vraiment aucun moyen de savoir combien d’enfants ont été injectés avec cette merde. » 
Les vaccinateurs en folie
Les Chapeaux Blancs, dit-il, craignent que la scopolamine, lorsqu’elle est administrée à de jeunes enfants impressionnables et malléables, les tue purement et simplement ou les contraigne à obéir aux ordres. 
« Nous ne parlons pas ici de nourrissons, d’accord. 

Mais si un enfant de cinq ans est drogué et qu’un pédophile lui dit d’enlever ses vêtements, vous voyez le tableau ? 

Il est possible que des milliers, des dizaines ou des centaines de milliers d’enfants aient reçu cette substance. 

Nous n’en connaissons pas encore l’ampleur », a déclaré notre source.

Source : https://changera3.blogspot.com/2022/07/decouverte-de-vaxxins-enfants-contenant.html#more

Luc Boileau ,le responsable de la Santé Publique au Québec,était tout fier d’annoncer que les petits enfants pourront tous être vaccinés à partir d’aujourd’hui!Espérons que ce criminel politique finira en prison un jour!

UNE INVITATION À VISITER NOS BOUTIQUES EN LIGNE

Passez une bonne journée,mes ami(e)s!

La Criminelle Arnaque du COVID -19:Voici le Top 7 des « événements indésirables » post-vaccin les plus EFFRAYANTS

Ces « événements indésirables » deviennent de plus en plus courants, même si le complexe industriel du vaccin et les MSM les cachent totalement.

Le CDC et les MSM appellent cela « l’hésitation aux vaccins », mais il s’agit davantage de « la science des vaccins » qui montre que les piqûres de mutation du gène COVID-19 sont expérimentales, dangereuses et inefficaces. Ce n’est pas une « hésitation » si les statistiques révèlent que se faire un caillot est BEAUCOUP plus dangereux pour la majorité de la population que d’attraper le dernier coronavirus. Ce n’est pas une théorie du complot selon laquelle les injections de caillots sont au mieux expérimentales, avec des approbations « d’urgence uniquement » et des essais cliniques frauduleux qui révèlent des effets secondaires et des événements indésirables cauchemardesques.

Ce n’est pas parce que les médias grand public (fake news) ne couvrent pas les faits qu’ils ne se produisent pas tout autour de nous. Si un arbre tombe dans la forêt, mais que vous n’entendez pas ses craquements, cela ne signifie pas qu’il n’est jamais tombé. Lorsque des athlètes, des pilotes et des militaires en parfaite santé tombent morts suite à des caillots sanguins, de myocardite, de crises cardiaques et d’accidents vasculaires cérébraux, quelques jours ou semaines seulement après avoir reçu une injection de thérapie génique COVID-19, il y a de bonnes raisons d’être très inquiets.

Pourquoi donner à un adolescent, un préadolescent ou un enfant un caillot mortel du virus échappé d’un labo alors qu’il n’y a pratiquement aucune chance qu’il meure du COVID ?

Même après que le CDC et la FDA admettent que les adolescents et les enfants courent un très faible risque de contracter ou de mourir de la grippe Fauci, ils continuent de pousser et de propager la vaccination pour tous, à cause de… attendez… les profits astronomiques de la vache à lait et le programme de dépopulation . C’est comme pousser le vaccin contre le VPH (virus du papillome humain), une injection pour une maladie sexuellement transmissible, à des enfants de 9 ans. C’est comme rendre obligatoire le vaccin contre le sida pour chaque terrien.

Nous avons des droits, et l’un d’entre eux est de savoir si des toxines doivent ou non être injectées dans notre sang par des médecins voyous et des scientifiques intrigants qui profitent énormément de leur médicament à la poudre de perlimpinpin. Quelle est la prochaine étape, la chimiothérapie pré-cancéreuse obligatoire pour tous ?

Le complexe industriel des vaccins a déboursé plus de 4 milliards de dollars pour les effets secondaires néfastes et handicapants  et les décès induits par les vaccins au cours des deux dernières décennies, et les injections de COVID-19 sont PLUS MORTELLES que tous les autres vaccins combinés, depuis les années 1960.

Bill Gates, l’empereur des vaccins

Les deux tiers de tous les Américains ont subi un lavage de cerveau par une campagne de propagande basée sur la peur pour obtenir les piqûres COVID

Les jours de la science fondée sur des preuves sont morts en Amérique et en Europe. L’époque des freins et des contrepoids est révolue. Les agences de réglementation regorgent de gourous de Big Pharma qui établissent toutes les règles et tous les mandats en se basant sur la science zéro. Seule la peur pourrait faire que des centaines de millions d’êtres humains se retrouvent coincés avec des injections qui obstruent le sang, inondent les organes et provoquent le «syndrome de la mort subite de l’adulte».

Seule une campagne basée sur la peur pour un virus (dont l’existence n’a JAMAIS été démontrée) qui cause un taux de mortalité très inférieur à 1% pourrait convaincre les deux tiers des Américains de porter un masque antibactérien pendant deux années consécutives.

Seule une escroquerie pourrait prendre autant d’argent des contribuables et le remettre aux corrompus scientifiques, politiciens et crétins de la réglementation qui l’ont financé, conçu et propagé. Avouons-le, il n’y a RIEN de « sûr » ou « d’efficace » dans les vaccins contre la grippe Fauci. Évitez-les comme la peste.

Les 7 « événements indésirables » post-vaccin les plus effrayants de COVID-19 que les MSM et les CDC ne mentionnent jamais par crainte d’une « hésitation à la vaccination »

#1. Tomber mort subitement de « causes inattendues » alias SADS (Sudden Adult Death Syndrome) syndrome de mort subite de l’adulte

#2. Caillots sanguins étranges, longs, caoutchouteux et fibreux (bio-structures)

#3. Myocardite, battements cardiaques irréguliers et crises cardiaques

#4. Le cancer et les tumeurs éclatent à l’improviste

#5. Attraper et/ou mourir du COVID-19 ou de ses variantes

#6. Paralysie des bras, des jambes ou du visage (syndrome “Ramsay Hunt” de Justin Bieber)

#7. Souffrant soudainement de SGB (Guillain-Barre Syndrome), AIDS, ADE, ou VAED

Ajoutez Vaccines.news  à vos sites Web indépendants préférés pour obtenir des mises à jour.

Les sources de cet article incluent : Health.ClevelandClinic.orgTheGatewayPundit.comNaturalNews.com

————————————————————————-

EN COMPLÉMENTAIRE

Rudolf Steiner, un visionnaire qui dérange…

Rudolf Steiner

Rudolf Steiner a connu, jeune, la réalité de ce qu’il nommera plus tard  » le monde suprasensible « . Il cherche à établir la base philosophique de ses connaissances élargies à ce monde.

Il trouve dans l’approche goethéenne un exemple du passage de l’observation de la nature à celle du monde spirituel.
C’est avec la  » Philosophie de la liberté  » qu’il établit en 1894 les fondements de sa recherche.

Ses investigations dans le domaine spirituel ne cesseront de se développer, apportant des connaissances sur la nature de l’homme, (corps, âme, esprit), la réincarnation et le karma (Théosophie, 1904), la cosmogonie et l’histoire de la terre (Science de l’occulte, 1910), la Christologie. Il a favorisé la création artistique (théâtre, architecture, eurythmie).

Steiner donne des conférences dans de nombreuses villes d’Europe jusqu’à la fin de sa vie, et répond aux questions concrètes qui lui sont posées.

Ainsi est lancé en 1919, le mouvement pour la triple articulation sociale (Liberté dans la vie culturelle, Égalité dans les rapports entre les êtres, Fraternité dans la vie économique), et sont donnés, de 1921 à 1924, les cours aux pédagogues (Écoles Steiner / Waldorf), aux médecins (médecine anthroposophique), aux thérapeutes (pédagogie curative) et aux agriculteurs (Agriculture bio-dynamique).

Source : https://www.anthroposophie.fr/

Il y a plus de cent ans, Rudolf Steiner a écrit ce qui suit :

« Dans le futur, on éliminera l’âme par des médicaments.

Sous prétexte d’un « point de vue sain » se trouvera un vaccin par lequel l’organisme humain sera traité, dès que possible, éventuellement directement à la naissance, afin que l’être humain ne puisse développer la pensée de l’existence d’âme et Esprit.

Aux médecins matérialistes sera confiée la tâche d’éliminer l’âme de l’humanité.

Comme aujourd’hui, on vaccine les gens contre cette maladie ou telle maladie, ainsi à l’avenir, on vaccinera les enfants avec une substance qui pourra être produite précisément de telle sorte que les gens, grâce à cette vaccination, seront immunisés d’être soumis à la « folie » de la vie spirituelle.

Il serait extrêmement intelligent mais il ne développerait pas une conscience et c’est le véritable objectif de certains cercles matérialistes.

Avec un tel vaccin, vous pouvez facilement faire en sorte que le corps éthérique se détache dans le corps physique.

Une fois le corps éthérique détaché, la relation entre l’univers et le corps éthérique deviendrait extrêmement instable et l’homme deviendrait un automate, car le corps physique de l’homme doit être poli sur cette Terre par une volonté spirituelle.

Alors le vaccin devient une sorte de force arymanique ; l’homme ne peut plus se débarrasser d’un sentiment matérialiste donné. Il devient matérialiste de constitution et ne peut plus s’élever au spirituel. »

Rudolf Steiner (1861-1925) dans « La chute des esprits des ténèbres » aux éditions Triades.
Le passage cité est à la fin de la page 79 et au début de la page 80 – cinquième conférence, du 7 octobre 1917. Un autre passage sur le même thème (les vaccins) se trouve à la page 188 – treizième conférence, du 27 octobre 1917.

 

 

 

 

 

 

 

 


 

UNE INVITATION À VISITER NOS BOUTIQUES EN LIGNE

Passez une bonne journée,mes ami(e)s!

 

 

 

 

La Criminelle Arnaque du COVID 19:Suite à la découverte d’un insecte dans un flacon, Moderna retire près de 800 000 doses de vaccin

Un moustique a été découvert à l’intérieur d’un flacon dans un centre de vaccination de Malaga, en Espagne. Invoquant la « présence d’un corps étranger », l’Agence espagnole des médicaments et des produits de santé (AEMPS) a annoncé le retrait, le 8 avril, de lots du vaccin Moderna, rapporte le quotidien El Pais. Le laboratoire Moderna a dû procéder au rappel de 764 900 doses de vaccin.

Le lot dont était issu le flacon avait été produit dans une usine située à San Sebastian de los Reyes, près de Madrid, où sont réalisés le remplissage des flacons et leur conditionnement. Le contenant est, lui, produit en Suisse.

Moderna fait face à un autre problème : depuis la mi-janvier 2022, les fioles ont été distribuées dans plusieurs pays en dehors de l’Espagne : la Norvège, la Suède, la Pologne et le Portugal. Tous sont concernés par le rappel annoncé par le laboratoire. Les autorités norvégiennes sont d’ailleurs à l’origine du dévoilement de la raison de ce retrait.

Pour autant, le laboratoire a voulu se montrer rassurant en publiant un communiqué commun avec l’entreprise responsable de la fabrication (Rovi) : « Le flacon impacté […] n’a pas été administré », assurent-ils, ajoutant qu’une enquête est en cours. Moderna soutient par ailleurs qu’« aucun problème de sécurité n’a été signalé chez les personnes ayant reçu un vaccin […] de ce lot », faisant valoir les 900 millions de doses de leur vaccin injectées à travers le monde.


EN COMPLÉMENTAIRE

Au Japon,en 2021, Moderna était contraint de retirer 1,63 million de doses de vaccins

Août 2021-Le Japon a retiré du marché 1,63 million de doses du vaccin Moderna après qu’une alerte venue de plusieurs centres de vaccination a signalé des lots contenant des impuretés. Après consultation avec le ministère de la Santé japonais, le groupe pharmaceutique nippon Takeda qui distribue le vaccin au Japon a décidé de suspendre l’utilisation des doses et demandé à Moderna de mener l’enquête.

La production du vaccin Moderna s’inscrit dans une longue chaîne de fabrication, une chose qui ne lui est pas propre puisque tous les fabricants de vaccins ont fait appel à des sous-traitants pour produire en quantité et répondre le plus rapidement possible à une demande mondiale très élevée.

Concernant le vaccin Moderna et les lots défectueux japonais, le principe actif composé d’ARN messager est fabriqué en Suisse tandis que son conditionnement est sous-traité en Espagne, près de Madrid par la société Rovi. Le problème viendrait du conditionnement et la société Rovi aurait, selon le quotidien El Pais « reconnu dans une lettre que le problème a pu survenir dans une de ses lignes de production et qu’il ne concerne qu’un lot, bien que les autres lots soient analysés à titre préventif ».

Ce problème sanitaire vient s’ajouter à une situation sanitaire déjà critique dans un pays, qui malgré le programme de vaccination de masse mis en place depuis mai, connaît un taux d’infections record depuis l’arrivée du variant Delta, plus contagieux.


une plainte pour crime d’empoisonnement déposée au Tribunal judiciaire de Paris

 

Une plainte criminelle contre X pour crime contre l’humanité, empoisonnement et tentative d’empoisonnement, rédigée par un collectif de juristes et d’avocats, est envoyée cette semaine au Tribunal judiciaire de Paris par l’association BonSens.org, l’Association internationale pour une médecine scientifique indépendante et bienveillante (AIMSIB) et des citoyens victimes d’effets secondaires des vaccins contre le Covid-19.

Au cours des dernières semaines, la campagne présidentielle et la guerre en Ukraine ont subitement puis totalement pris le pas sur la politique sanitaire du gouvernement, qui avait envahi nuit et jour l’espace médiatique au cours des deux dernières années. Marquée par l’obligation indirecte de prendre un vaccin à l’efficacité contestée et aux effets secondaires de plus en plus avérés (Voir : Le Sénat à l’écoute des victimes présumées d’effets secondaires graves du vaccin et « Il y a une volonté de ne pas savoir » : le collectif « Où est mon cycle » au Parlement européen), la crise du Covid-19 a jeté le doute sinon franchement mis en cause dans les esprits des Français, la probité de l’action du gouvernement et de son chef. Dernièrement, les affaires McKinsey et du Rothschild Gate sont venus renforcer au sein de la population ce sentiment de dichotomie entre l’intérêt général et les intérêts privés de la caste dirigeante. C’est pourquoi des associations poursuivent, malgré les embûches, la bataille judiciaire en vue d’obtenir au pénal réparation pour les victimes des conséquences de la politique vaccinale. C’est dans ce cadre que nous avons interviewé Maître Jean-Pierre Joseph, avocat au barreau de Grenoble, qui représente les plaignants.

Pourraient être impliqués, et par la suite, mis en examen : Jean Castex, Premier ministre ; Edouard Philippe, ancien Premier ministre ; Olivier Véran, ministre des Solidarités et de la Santé ; Frédérique Vidal, ministre déléguée à l’Enseignement supérieur et à la Recherche et membre de la « task force » vaccin ; Agnès Pannier-Runacher, ministre déléguée à l’Industrie, responsable de la « task force » vaccin ; Jérôme Salomon, directeur général de la santé ; Alain Fischer, coordonnateur de la stratégie vaccinale de l’État ; Louis-Charles Viossat, ancien responsable de la « task force » interministérielle vaccination Covid-19  ; Laetitia Buffet, responsable de la « task force » interministérielle vaccination covid-19  ; Bernard Celli, responsable de la « task force » interministérielle vaccination Covid-19  ; Patrick Bouet, président du Conseil national de l’Ordre des médecins.

close
volume_off

Les membres du conseil scientifique constitué à titre de l’urgence sanitaire en application de la loi n°2020-290 du 23 mars 2020 d’urgence pour faire face à l’épidémie de Covid-19 (ci-après conseil scientifique, créé par le décret du 3 avril 2020) : Jean-François Delfraissy, président du Conseil scientifique Covid-19 ; Laetitia Atlani-Duault, anthropologue ; Daniel Benamouzig, sociologue ; Lila Bouadma, réanimatrice ; Simon Cauchemez, modélisateur ; Catherine Chirouze, infectiologue ; Angèle Consoli, pédopsychiatre ; Pierre Louis Druais, médecine de ville ; Arnaud Fontanet, épidémiologiste ; Marie-Aleth Grard, milieu associatif ; Olivier Guérin, gériatre ; Aymeril Hoang, spécialiste des nouvelles technologies ; Bruno Lina, virologue ; Denis Malvy, infectiologue ; Yazdan Yazdanpanah, infectiologue ; la Haute Autorité de santé (HAS) ; Dominique Le Guludec, directrice générale de la HAS ; l’Agence nationale de sécurité du médicament (ANSM) ; Christelle Ratignier-Carbonneil, directrice générale de l’ANSM ; l’Agence européenne du médicament ; Emer Cooke, directrice de l’Agence européenne du médicament ; la Commission européenne ; Ursula van der Leyen, présidente de la Commission européenne ; la société Pfizer SAS ; Henriette Rosenquist, présidente de la société Pfizer SAS ; Franck Le Breguero, pharmacien responsable et directeur général de la société Pfizer SAS ; la société Pfizer Holding ; Florence Petelet, gérante de la société Pfizer Holding ; Marie-Gabrielle Laborde-Rayna, pharmacien responsable et gérante non-associée de la société Pfizer Holding ; la société Pfizer inc. ; Albert Bourla, PDG de la société Pfizer inc. ; la société BioNtech AG ; Helmut Jeggle, président de la société BioNtech AG.

Et toutes autres personnes à déterminer.

FranceSoir : Me Joseph, quel est l’intérêt de cette plainte pour les victimes des conséquences des injections ?

Me Joseph : Pour les victimes et les proches de victimes, l’intérêt est double. D’une part, il est de se voir reconnues comme victimes d’un acte que le juge qualifiera, mais qui, selon les plaignants, réunit les conditions du crime d’empoisonnement.

Ainsi, les fabricants doivent répondre des substances qu’ils ont conçues et mises sur le marché, nous y reviendrons. Les ministres en charge et les différentes agences et commissions qui sont intervenues pour administrer ces substances aux Français (HAS, ANSM, Conseil scientifique) engagent également leur responsabilité. Tout comme la Commission européenne, sa présidente et l’Agence européenne du médicament, ils ne pouvaient ignorer que tout indiquait, avant leur mise sur le marché, qu’elles étaient mal évaluées, donc potentiellement dangereuses. Ceci, d’autant plus que depuis près d’un an, de nombreux scientifiques les en informent et que de nombreux citoyens ont attiré leur attention sur une des dispositions du contrat signé entre la Commission européenne et Pfizer, précisant (p. 48 et 49) que les parties au contrat reconnaissent ignorer l’efficacité et les effets indésirables du « vaccin » et trouvent étranges que ces « vaccins » ne protègent soi-disant que pendant 4 mois, n’empêchent pas de contracter la maladie et rendent les « vaccinés » potentiellement contagieux, ce qui a justifié que l’on oblige pendant plusieurs mois, les « vaccinés » à porter le masque, qui reste obligatoire, même pour eux, dans les transports.

J’ajouterai qu’à un tel niveau de responsabilité, il est impossible de se prévaloir de son ignorance, surtout si, au lieu de vérifier ce que leur expliquaient de nombreux médecins, biologistes, virologues, statisticiens de renommée internationale, ils ont dénigré ces derniers, se campant dans une certitude méprisante et suffisante, les qualifiant de « complotistes », plutôt que de « lanceurs d’alerte ». Dans ce cas, les responsables publics sont tenus de s’informer de la façon la plus précise, surtout s’agissant de la santé de la population. Si, malgré tout, on ne sait pas, le simple bon sens ou même l’application du principe de précaution doivent conduire à ne pas faire prendre un risque aussi inconsidéré aux Français, femmes enceintes et enfants compris, pour une maladie dont on sait qu’elle tue peu, qu’elle tue essentiellement les personnes les plus âgées et, surtout, que de nombreux traitements existent pour la combattre. Malheureusement, tous les traitements prescrits par des médecins, faisaient l’objet de poursuites de la part du Conseil de l’Ordre pour qui « Il n’y avait pas de traitement… »

D’autre part, les victimes, fortes de la faute pénale ainsi reconnue pourront se tourner vers les responsables et, singulièrement les fabricants, pour voir les préjudices qu’ils ont subis indemnisés. Ces derniers espéraient probablement, de ce que l’on sait des contrats d’achat avec la Commission européenne, échapper à leur responsabilité civile en incluant dans ces contrats des clauses exonératoires. En d’autres termes, les fabricants et la Commission européenne, représentée par sa présidente, Ursula von der Leyen, auraient convenu que ni la Commission ni les États membres ne pourraient se retourner contre les fabricants.

La loi du 25 juillet 2021 sur la gestion de la crise sanitaire a d’ailleurs choisi d’intégrer la vaccination contre le Covid-19 au dispositif de l’Office national d’indemnisation des accidents médicaux, des affections iatrogènes et des infections nosocomiales (ONIAM), qui propose une indemnisation amiable des victimes d’accidents médicaux et se charge, le cas échéant, de poursuivre le responsable en remboursement. Mais cela signifie aussi que, s’agissant d’une procédure amiable, l’intégralité des préjudices ne sera pas réparée. Et, surtout, l’indemnisation des victimes relèvera de la Solidarité nationale. Si ce financement est, en soi, défendable, il l’est moins dans le contexte actuel.

En effet, le contribuable qui aura financé la recherche, avec les fonds d’urgences attribués par la Commission européenne aux fabricants, puis l’achat de ces substances doit maintenant assumer l’indemnisation des conséquences des injections… Pendant le même temps, le groupe Pfizer, par exemple, annonce un chiffre d’affaires, pour 2021, de 81,3 milliards de dollars, en augmentation de 95% par rapport à l’année précédente et un bénéfice record de 22 milliards de dollars.

Toutefois, on peut penser que la reconnaissance par la justice de la faute pénale des fabricants permettra, ensuite, aux victimes de se retourner directement contre eux pour obtenir l’indemnisation de leur préjudice, puisque la voie de l’ONIAM n’est qu’optionnelle et ne ferme pas la voie juridictionnelle aux victimes.

Cette plainte peut être téléchargée en fin d’article afin d’être communiquée par les victimes à leurs avocats.

FS : En quoi consiste l’empoisonnement qui fait l’objet de cette plainte ?

JPJ : Dans cette affaire, l’empoisonnement, qui est un crime consistant à donner la mort par administration d’une substance mortelle, prend plusieurs formes.

D’abord, le professeur Jean-Michel Claverie, professeur émérite de médecine, PU-PH de l’université d’Aix-Marseille, a récemment évalué la quantité d’ARNm de la protéine Spike qui pénètre le corps humain à chaque injection de l’une des substances géniques expérimentales, abusivement nommées « vaccin ». Il est parvenu à la conclusion suivante :

– Une dose du produit Pfizer délivre autant d’ARNm de la protéine Spike que ce qui est contenu dans 6,75 m³ de fluide nasal infecté par le virus.
– Le même constat peut être fait à propos du produit Moderna, qui délivre autant d’ARNm de la protéine Spike que ce qui est contenu dans 23 m³ de fluide nasal infecté par le virus.

Le professeur Claverie évoque une quantité « véritablement astronomique » d’ARNm de la protéine Spike ainsi injectée dans le corps humain.

Une de ses conclusions est que « l’injection de ces vaccins ne mime absolument pas le processus d’infection naturel par le SARS-CoV2, mais constitue une modification locale de la concentration en ARNm totalement non-physiologique pour les cellules qui l’incorporent. Même au cours d’une infection virale très virulente, on estime que le nombre de molécules d’ARN messager ne dépasse pas une centaine d’exemplaires par cellule infectée, pour les gènes viraux les plus fortement exprimés ».

L’inquiétude augmente encore lorsqu’on lit, toujours d’après le professeur Claverie, que ces produits contiennent des « impuretés totalement inattendues ».

Ainsi, « une publication récente, par le laboratoire Moderna lui-même, décrit la présence d’impuretés totalement inattendues dans le principe actif même du vaccin, dans lequel une partie de l’ARNm injecté est modifiée par une réaction chimique avec l’enveloppe lipidique des nanoparticules chargées de le véhiculer à l’intérieur des cellules. S’agissant d’une modification chimique inconnue à ce jour, dont la toxicité éventuelle n’a pas été évaluée, cette découverte aurait dû poser la question de la suspension éventuelle de l’autorisation conditionnelle de mise sur le marché, ce qui n’a pas été fait. La même modification chimique a probablement lieu également dans le vaccin BNT-162b2 de BioNTech/Pfizer (dont la composition est proche de celle de la préparation de Moderna), mais à ma connaissance, aucune vérification n’a été publiée ».

Le rapport du professeur Claverie est en téléchargement avec la plainte, au pied de l’article.

Ensuite, et c’est une information particulièrement inquiétante révélée par des travaux de recherche de mai 2021, confirmés en février 2022 : les cellules humaines auraient la capacité de transformer l’ARNm des substances géniques expérimentales en ADN et, donc, de l’intégrer à leur propre génome, entraînant des modifications du génome humain. Bien entendu, les conséquences de telles modifications, qui auront nécessairement des effets sur la descendance des personnes concernées, sont à ce jour totalement imprévisibles.

Cette découverte est d’autant plus choquante que le mécanisme de la transcriptase inverse (qui permet la transformation d’un ARNm en ADN) au sein des cellules humaines est connu depuis 1970. Les derniers travaux de 2021 et de 2022 ne font que confirmer la possibilité d’intégration de l’information délivrée par l’ARNm vaccinal injecté, dans le génome humain. Il n’y a donc plus de doute possible : les substances géniques expérimentales peuvent modifier, voire endommager le génome humain.

Que doit-on penser, lorsque le professeur Claverie ajoute que « la possibilité d’une intégration génomique, longtemps considérée comme improbable vient d’être démontrée (…) avec des quantités expérimentales d’ARNm largement inférieures à celles (…) découvertes dans les injections ARNm » ? On ne peut qu’en déduire que le risque de modification du génome est d’autant plus considérable, vu les quantités injectées aux Français.

Enfin, les travaux de Christine Cotton, biostatisticienne pour l’industrie pharmaceutique pendant 23 ans, ont révélé un autre fait scandaleux. Les essais cliniques préalables comportent d’importants biais méthodologiques, rendant peu fiables les conclusions d’efficacité. Il apparaît également que la baisse de l’immunité et les effets secondaires potentiellement dangereux pouvaient être anticipés. Ces faits étaient connus des fabricants, tout comme les autorités européennes et françaises au moment de l’autorisation en vie réelle.

Malheureusement, les chiffres vertigineux des décès et des blessures consécutifs à l’injection provenant des organismes de pharmacovigilance des pays concernés sont la preuve de cette désinvolture criminelle.

Par ailleurs, avec maintenant une année de recul, les chercheurs observent, dans tous les pays qui ont eu recours aux injections, une surmortalité inexpliquée, spécialement marquée chez les personnes de 15 à 44 ans. Or, la courbe de la surmortalité épouse parfaitement celle des campagnes vaccinales. La corrélation est telle que l’hypothèse d’une surmortalité de la population due à la vaccination est désormais avancée.

Ces éléments sont d’une extrême gravité, puisqu’ils touchent à la santé des Français, mais aussi à celle des enfants à naître, pour les femmes enceintes qui auraient reçu l’injection, et à l’espèce humaine, elle-même, dont le génome pourrait être modifié de façon aléatoire, inconnue et incontrôlée. Or, les autorités françaises ne peuvent ignorer les informations que je viens d’exposer et qui sont consignées dans la plainte.

Pourtant, les campagnes de vaccination se poursuivent aveuglément. Le chantage à l’emploi continue, la ségrégation et la discrimination sont toujours d’actualité (on rappellera qu’un passe sanitaire est toujours exigé pour entrer à l’hôpital), les menaces et les insultes ne sont qu’en sourdine. Doit-on rappeler que de nombreux responsables publics et personnalités médiatiques n’ont pas été en reste pour proférer insultes et menaces publiques contre les personnes non-injectées. Ainsi, Laurent Alexandre ou Gilbert Deray voient en elles « des criminels », à qui, renchérissent Christian Estrosi ou François Sauvadet, il faut supprimer chômage et aides sociales. Olivier Véran impute lui, sans autre procès, la responsabilité du Covid dans un Ehpad à une soignante non-injectée. Emmanuel Lechypre déclare vouloir les faire « emmener de force par des policiers », tandis que Gabriel Attal n’y voit qu’une « frange capricieuse », à qui le gouvernement promet une « vie de merde ». Dans cette ambiance délétère, CNews a dû trouver vendeur de titrer « Antivax : comment s’en débarrasser ? »

C’est pourquoi, face à des constats aussi alarmants, BonSens.org, l’AIMSIB et les autres plaignants ont décidé de déposer une plainte criminelle pour les chefs d’accusation d’empoisonnement, de complicité d’empoisonnement et de crime contre l’humanité contre tous ceux qui ont incité ou forcé, selon les cas, les Français à se faire injecter une substance, toujours au stade de l’essai clinique, mal évaluée, dont la dangerosité pouvait être anticipée et qui continue à tuer et à blesser chaque jour. Il s’agit donc d’actes criminels.

FS : Pensez-vous que les faits soient suffisamment graves pour que l’on puisse parler de crime contre l’humanité ?

JPJ : Oui. Le crime contre l’humanité est rarement invoqué devant les juridictions françaises. Il l’a été pour des crimes commis sous l’occupation nazie (Touvier, Barbie) ou pour des crimes commis à l’étranger pour lesquels la juridiction française est compétente (par exemple, le juge pénal peut poursuivre les crimes commis au Rwanda et en ex-Yougoslavie, si les responsables vivent en France).

Cependant, les faits sont là et les qualifications pénales également. Or, il ne fait pas de doute que la campagne de vaccination que nous subissons, relève de la définition du crime contre l’humanité, spécialement maintenant qu’on en mesure mieux les conséquences psychologiques, sociales, économiques et en termes de santé.

Ce qu’il importe de comprendre, c’est que le crime contre l’humanité, ce ne sont pas seulement des actes criminels isolés (forcer les Français à se faire injecter une substance potentiellement mortelle). Ce sont des actes criminels, commis de façon coordonnée par un groupe criminel, contre une population ou un groupe de population, inscrits dans un plan exécuté au nom d’un « État pratiquant une politique d’hégémonie idéologique », pour reprendre les termes de la Cour de cassation.

Ces actes, et c’est ce qui caractérise un crime aussi terrible que le crime contre l’humanité, dépassent la simple intention de tuer. Ils visent à déshumaniser les victimes, à nier leur nature humaine, à les rejeter en dehors de la communauté des Hommes, ceci, pour des motifs purement idéologiques.

Or, nous sommes bien, avec « l’idéologie vaccinale » actuelle, dans le cadre d’une politique d’hégémonie idéologique. En effet, la finalité des politiques discriminatoires, de ségrégation, de persécution et, finalement, d’empoisonnement, pratiquées depuis plus de deux ans est bien de dénier leur humanité aux personnes réfractaires. Elle a, d’ailleurs, trouvé sa synthèse dans les propos du président de la République, selon lequel, un « irresponsable », ce terme désignant une personne non-injectée, « n’est plus un citoyen ».

Comment mieux dire qu’il s’agit de retirer à cette partie de la population ce qui est le plus intimement attaché à sa personne, au sens juridique comme au sens politique : sa citoyenneté, son appartenance à la nation française, laquelle constitue son identité et, non, un artefact dont on pourrait se débarrasser. Porter atteinte à la qualité de citoyen revient ainsi à porter atteinte à la personne même, dans son identité et dans sa dignité. On rappellera, à cet égard, dans un domaine très proche, que la perte de nationalité est une sanction infamante, réservée à certaines infractions particulièrement graves.

Il y a pire encore. Nous savons désormais que les substances géniques expérimentales pourront avoir des effets sur la descendance des personnes injectées dont l’ADN aura été endommagé. En d’autres termes, les faits que dénoncent les plaignants sont, non seulement une attaque généralisée et systématique contre une population, pour reprendre les termes du code pénal, mais ils constituent également une attaque contre l’espèce humaine, elle-même, dès lors qu’existe la possibilité de modification du génome humain.

FS : Cette plainte intervient dans un contexte particulier ?

JPJ : En effet. La question des effets indésirables de ces substances a, enfin, été saisie par le Parlement, dont l’Office parlementaire d’évaluation des choix scientifiques et technologiques (Opecst) a été chargé, selon son vice-président, Gérard Longuet, de « rassembl(er) les éléments techniques et scientifiques sur les effets du vaccin ».

On remarquera d’emblée que la création de cette commission d’enquête est due à l’initiative des citoyens et non à celle des parlementaires ou d’autres responsables publics. C’est ainsi une pétition citoyenne, déposée par le docteur Devilleger, cardiologue, sur le site du Sénat qui, ayant recueilli plus de 33 600 signatures en quelques semaines, a incité les sénateurs à saisir l’Opecst. Ainsi, « constatant la forte dynamique des signatures », le Sénat « a décidé d’y donner suite sans attendre » pour « répondre aux inquiétudes qui s’expriment ». Le cycle d’auditions, qui a débuté le 28 mars, est prévu pour durer trois mois. Souhaitons que, comme l’annonce Gérard Longuet, les parlementaires « prendront (leurs) responsabilités » sur une question aussi importante pour les Français.

Par ailleurs, un colloque scientifique international s’est tenu à l’Institut hospitalo-universitaire Méditerranée, dirigé par le Pr Didier Raoult, les 30 et le 31 mars dernier et à Massy, les 1er et 2 avril, l’International Covid Summit (ICS), intitulé « Covid-19, premier bilan des connaissances et controverses scientifiques », qui a réuni de nombreux experts du monde entier. La science progresse donc, envers et contre tout a-t-on envie de dire, sur la maladie, son traitement et sur les effets des « vaccins ».

Dans ce sens, on ne peut qu’espérer que l’épisode dramatique que nous vivons nous ramènera à ce qu’est la science : le doute, la controverse, la remise en question. Lorsqu’on entre dans le monde des certitudes, comme nous l’observons avec le tout vaccinal que l’on tente d’imposer aux Français, on est dans l’idéologie, plus dans la science. Malmener la science, l’instrumentaliser ne peut, l’histoire nous l’avait pourtant déjà enseigné, que mener à des catastrophes, telle celle que nous expérimentons. Et, face à l’incurie, pour le moins, de nos responsables politiques, sourds aux souffrances que leurs politiques ont créées, la seule arme qui reste au citoyen pour mettre un terme à cette situation et pour rendre justice aux victimes, est la juridiction pénale. Nous ne doutons pas de la diligence du juge pénal, car, dans le droit humaniste qui était le nôtre avant la crise sanitaire, de tels actes sont des crimes.

La plainte avec ses pièces peut être téléchargée sur ce lien :
Télécharger la plainte

Télécharger les annexes


VISITEZ NOS BOUTIQUES EN LIGNE POUR DE MAGNIFIQUES CADEAUX:

Sur ces liens: Vintage par Michel sur Etsy

                          Vintage par Michel sur E Bay

 

La Criminelle Arnaque du COVID-19:Le département de la Défense des États-Unis a attribué un contrat pour la «recherche sur la COVID-19» en Ukraine 3 mois avant même que l’existence la Covid ne soit connue

Le monde a commencé à entendre parler d’un nouveau coronavirus au début de janvier 2020, avec des rapports faisant état d’une nouvelle pneumonie présumée comme une maladie se propageant à Wuhan, en Chine. Cependant, le monde n’a réellement connu la Covid-19 qu’en février 2020, car ce n’est que le 11 de ce mois que l’Organisation mondiale de la santé a officiellement nommé la nouvelle maladie à coronavirus, la Covid-19.

Donc, ceci étant la vérité officielle, pourquoi les données du gouvernement des États-Unis montrent-elles que le département américain de la Défense (DOD) a attribué un contrat le 12 novembre 2019 à Labyrinth Global Health INC. pour la «recherche COVID-19», au moins un mois avant l’émergence présumée du nouveau coronavirus, et trois mois avant qu’il ne soit officiellement surnommé [virus de la] Covid-19 (Coronavirus Desease 2019 ] ?

 

Cependant, les résultats choquants ne s’arrêtent pas là. Le contrat attribué en novembre 2019 pour la «recherche COVID-19» n’était pas seulement chargé de se dérouler en Ukraine, il faisait en fait partie d’un contrat beaucoup plus vaste pour un «programme de réduction des menaces biologiques en Ukraine».

Cela explique peut-être pourquoi Labyrinth Global Health collabore avec l’EcoHealth Alliance de Peter Daszak et Metabiota d’Ernest Wolfe depuis sa création en 2017.

Le gouvernement des États-Unis a un site Web appelé  » USA Spending » , une source officielle de données ouvertes sur les dépenses fédérales. Selon le site, au 12 avril 2021, le gouvernement américain a dépensé un montant époustouflant de 3630 milliards de dollars « en réponse à la COVID-19 ». Mais ce ne sont pas les seules informations sur Covid qui peuvent être trouvées sur le site.

Cachés dans la « recherche d’attribution », se trouvent des détails sur un contrat attribué par le ministère de la Défense à une société nommée  » Black & Veatch Special Projects Corp » , qui serait « une société mondiale d’ingénierie, d’approvisionnement, de conseil et de construction spécialisée dans le développement d’infrastructures ».

Le contrat a été attribué le 20 septembre 2012 et est décrit comme « Services professionnels, scientifiques et techniques ». Évidemment, c’est très vague et très probablement de peu d’intérêt pour quiconque tombe dessus. Mais il y a quelque chose de profond dans les détails qui devrait intéresser tout le monde.

L’« Historique des attributions » du contrat contient un onglet pour les « Sous-attributions » détaillant les bénéficiaires, la date d’action, le montant et une très brève description pour 115 transactions de sous-attribution. La plupart des sous-prix sont extrêmement banals pour des choses telles que « l’équipement de laboratoire pour Kiev » ou « le mobilier de bureau pour Kiev ».

Mais il y a un sous-prix qui se démarque parmi les autres, et il a été décerné à Labyrinth Global Health INC pour « SME Manuscript Documentation and COVID-19 Research ».

Un prix pour la recherche sur la Covid-19 n’est pas vraiment choquant alors que le monde est prétendument en proie à une pandémie de Covid-19, mais compte tenu du fait que le contrat de sous-traitance a été attribué le 12 novembre 2019, au moins un mois avant l’émergence présumée de le nouveau coronavirus, et trois mois avant qu’il ne soit officiellement surnommé Covid-19 [Coronavirus Desease 2019 ], le prix de la recherche sur la Covid-19 devrait être un choc pour tout le monde.

Mais le choc ne s’arrête pas là, car le lieu où le contact pour la recherche sur Covid-19 a été chargé d’avoir lieu était l’Ukraine, tout comme l’ensemble du contrat attribué par le DOD à Black & Veatch Special Projects Corp.

Les détails du contrat trouvés sur le site « USA Spending » révèlent en fait que le département spécifique du DOD qui a attribué le contact était la Defense Threat Reduction Agency (DTRA). Le contrat a été attribué le 20 septembre 2012 et conclu le 13 octobre 2020.

Bien que les détails soient vagues, le site du gouvernement américain révèle également que 21,7 millions de dollars sur les 116,6 millions de dollars de contact ont été dépensés pour un « programme de réduction des menaces biologiques en Ukraine ».

Pourquoi le ministère de la Défense a-t-il payé une entreprise qui est prétendument « une société mondiale d’ingénierie, d’approvisionnement, de conseil et de construction spécialisée dans le développement d’infrastructures », pour l’aider à mettre en œuvre un « programme de réduction des menaces biologiques en Ukraine » ?

Et pourquoi le DOD et ladite société ont-ils ensuite payé Labyrinth Global Health INC pour mener des recherches sur la COVID-19 en Ukraine au moins un mois avant l’émergence présumée du nouveau coronavirus, et trois mois avant qu’il ne soit officiellement surnommé Covid-19 ?

Fondée en 2017, Labyrinth Global Health serait une « petite entreprise détenue par des femmes avec une expertise approfondie et une expérience éprouvée dans le soutien d’initiatives pour le progrès scientifique et médical ».

Elle se décrit comme  » une organisation multiculturelle et internationale avec des bureaux dans quatre pays et une équipe d’experts aux parcours et compétences divers, notamment en microbiologie, virologie, santé mondiale, soins infirmiers en maladies infectieuses émergentes, anthropologie médicale, épidémiologie de terrain, recherche clinique, et les systèmes d’information sur la santé. »

Il se trouve que l’un de ces bureaux se trouve à Kiev, en Ukraine, que la société qualifie de «porte d’entrée vers l’Europe de l’Est».

L’équipe de direction de Labyrinth Global se compose de Karen Saylors, PHD, qui est la directrice générale ; Mary Guttieri, PHS, qui est la directrice scientifique ; et Murat Tartan qui est le directeur financier.

Karen Saylors, PhD, qui a cofondé Labyrinth Global Health, aurait travaillé dans le domaine de la santé publique internationale pendant plus d’une décennie et a passé de nombreuses années à vivre en Afrique pour établir des réseaux de surveillance mondiaux, « travailler avec des partenaires pour améliorer la politique de santé mondiale sur la détection, la réponse et le contrôle des maladies infectieuses ».

Au Labyrinthe, le Dr Saylors se spécialise dans les études qui visent à comprendre et à atténuer le risque biologique et comportemental de transmission de maladies. Le Dr Saylors a travaillé avec le réseau d’essais cliniques de l’Université d’Oxford au Vietnam sur la recherche sur la surveillance des maladies zoonotiques et continue de coordonner avec des partenaires régionaux les épidémies émergentes dans les populations animales et humaines.

Mais avec qui le Dr Karen Saylors et Labyrinth Global Health choisissent-ils de travailler ? Ce ne sont autres que « Eco Health Alliance » et « Metabiota ».

Le Dr Karen Saylors, Eco Health Alliance et Metabiota ont travaillé ensemble sur le programme « PREDICT » de l’Agence des États-Unis pour le développement international (USAID) à partir de 2009, tandis que Labyrinth Global Health a travaillé aux côtés de l’EHA et de Metabiota sur le programme PREDICT à partir de 2017.

Lancé en 2009 et financé par l’USAID, PREDICT était un système d’alerte précoce pour les maladies nouvelles et émergentes dans 21 pays. Il a été dirigé par le Davis One Health Institute de l’Université de Californie («UC») et les principaux partenaires comprenaient EcoHealth Alliance («EHA»), Metabiota, Wildlife Conservation Society et Smithsonian Institution, et comme nous venons de le révéler; Santé globale du labyrinthe. PREDICT a été un précurseur du projet plus ambitieux Global Virome.

L’USAID décrit PREDICT comme ayant apporté  » des contributions significatives au renforcement des capacités mondiales de surveillance et de diagnostic en laboratoire pour les virus connus et nouvellement découverts au sein de plusieurs groupes de virus importants, tels que les filovirus (y compris les virus Ebola), les virus de la grippe, les paramyxovirus et les coronavirus  » .

Voici l’une des nombreuses études publiées par Eco Health Alliance, Metabiota et Labyrinth Global Health prouvant le lien –

PREDICT s’est associé à l’Eco Health Alliance (EHA) à but non lucratif pour mener à bien ses efforts de 9 ans pour cataloguer des centaines de milliers d’échantillons biologiques,  » dont plus de 10 000 chauves-souris  » . Une étude financée par PREDICT en 2015 sur la « diversité des coronavirus chez les chauves-souris » comprenait également Peter Daszak, président de l’EHA, parmi ses participants.

Eco Health Alliance est répertorié comme partenaire de l’Institut de virologie de Wuhan (« WIV ») sur les pages archivées de son site Web et a été mentionné comme l’un des « partenaires stratégiques » de l’institut par le directeur général adjoint du WIV en 2018.

Notamment, la relation entre le WIV et l’établissement américain de biodéfense a été avancée par le conseiller politique de l’EHA, David R. Franz, ancien commandant du laboratoire américain d’armes biologiques à Fort Detrick.

Le Dr Shi Zhengli de WIV, alias « Batwoman », avait également travaillé avec Daszak de l’EHA sur des études liées aux chauves-souris. Dès 2005, Daszak et Zhengli menaient des recherches sur les coronavirus de type SRAS chez les chauves-souris. Plusieurs études financées par PREDICT sur les coronavirus de type SRAS et la grippe porcine comptent à la fois sur les contributions de Zhengli et de Daszak. La plus remarquable d’entre elles est peut-être une étude financée par PREDICT et NIH en 2015, qu’elle a co-écrite et intitulée : « Un groupe de coronavirus circulants de chauve-souris de type SRAS montre un potentiel d’émergence humaine ».

Pendant ce temps, Nathan Wolfe est le fondateur de Metabiota et de l’organisation à but non lucratif Global Viral. Il a passé plus de huit ans à mener des recherches biomédicales en Afrique subsaharienne et en Asie du Sud-Est. Sans surprise, le juif Wolfe est un  leader mondial du Forum économique mondial. Plus particulièrement, depuis 2008, il était membre du DSRC (Defense Science Research Council) de la DARPAjusqu’à sa dissolution.

Toutes ces personnes et organisations travaillent depuis au moins la dernière décennie à étudier les coronavirus et à aider à mettre en place des Biolabs en Ukraine. Tous utilisent des fonds du département américain de la Défense pour le faire. Vous pouvez en savoir plus à ce sujet iciici et ici.

Laissant de côté pour l’instant les biolabs en Ukraine, revenons au sujet de la Covid-19. Si le gouvernement américain finançait la recherche sur la Covid-19 avant que l’existence de la Covid-19 ne soit connue du public, cela suggère qu’ils savaient soit que la Covid-19 existait naturellement, soit qu’ils étaient impliqués dans la construction de ce virus dans un laboratoire.

Mais si les preuves contractuelles ne suffisent pas pour que vous parveniez à cette conclusion (ce devrait être le cas), alors associez-les peut-être à des preuves que l’Institut national américain des allergies et des maladies infectieuses (NIAID) et Moderna avaient un candidat coronavirus dans Décembre 2019 le sera.

Un accord confidentiel qui peut être consulté ici, stipule que les fournisseurs « Moderna » aux côtés de « l’Institut national des allergies et des maladies infectieuses » (NIAID) ont accepté de transférer les « candidats vaccins contre le coronavirus à ARNm » développés et détenus conjointement par le NIAID et Moderna aux destinataires. L’Université de Caroline du Nord à Chapel Hill’ le 12 décembre 2019.

L’accord a également été signé par deux représentants du NIAID, dont Amy F. Petrik PhD, spécialiste du transfert de technologie qui a signé l’accord le 12 décembre 2019 à 8h05. L’autre signataire était Barney Graham MD PhD, chercheur pour le NIAID, mais cette signature n’était pas datée.

Les derniers signataires de l’accord étaient Sunny Himansu, enquêteur de Moderna, et Shaun Ryan, conseiller général adjoint de Moderna. Les deux signatures ont été faites le 17 décembre 2019.

Toutes ces signatures ont été faites avant toute connaissance de l’émergence présumée du nouveau coronavirus. Ce n’est que le 31 décembre 2019 que l’Organisation mondiale de la santé (OMS) a pris connaissance d’un groupe présumé de cas de pneumonie virale à Wuhan, en Chine. Mais même à ce stade, ils n’avaient pas déterminé qu’un nouveau coronavirus présumé était à blâmer, déclarant plutôt que la pneumonie était de « cause inconnue ».

Tout cela nécessite des recherches beaucoup plus poussées pour assembler toutes les pièces du puzzle, mais voici ce que nous savons définitivement jusqu’à présent :

    Un nouveau coronavirus est apparu à Wuhan en décembre 2019.

    Le monde n’a entendu parler de ce nouveau coronavirus que début janvier 2020.

    Le monde ne savait pas que ce nouveau coronavirus s’appelait  Covid-19 jusqu’en février 2020, lorsque l’Organisation mondiale de la santé l’a officiellement nommé ainsi.

    Le département américain de la Défense a attribué un contrat de services professionnels, scientifiques et techniques à Black & Veatch Special Projects Corp‘, qui serait « une société mondiale d’ingénierie, d’approvisionnement, de conseil et de construction spécialisée dans le développement d’infrastructures ».

    Ce contrat concernait un programme de réduction des menaces biologiques en Ukraine.

    Dans le cadre de ce contrat plus important, un autre contrat a été attribué à Labyrinth Global Health pour la «recherche COVID-19» le 12 novembre 2019.

    Ce prix a été décerné au moins un mois avant l’émergence présumée du nouveau coronavirus et trois mois avant qu’il ne soit officiellement surnommé [virus de la maladie – MIRASTNEWS] Covid-19.

    Labyrinth Global Health travaille aux côtés de « Eco Health Alliance » et de « Metabiota », et a participé au programme USAID PREDICT. Toutes ces personnes et organisations travaillent depuis au moins la dernière décennie à étudier les coronavirus et à aider à mettre en place des Biolabs en Ukraine. Tous utilisent des fonds du département américain de la Défense pour le faire.

    Les informations trouvées ici indiquent qu’Eco Health Alliance a participé à la création du virus de la Covid-19.

    Les informations trouvées ici indiquent que Moderna a participé à la création du virus de la Covid-19.

    « Moderna », aux côtés du « National Institute of Allergy and Infectious Diseases » (NIAID), a accepté de transférer des « candidats de vaccins contre le coronavirus à ARNm » développés et détenus conjointement par le NIAID et Moderna, aux destinataires « l’Université de Caroline du Nord à Chapel Hill » le le 12 décembre 2019.

A quoi tout cela renvoie-t-il ? C’est à vous de réfléchir et de décider. Mais nous vous promettons qu’il y a beaucoup plus à venir sur ce qui précède…

Traduction : MIRASTNEWS


Je vous invite à visiter nos  boutiques en ligne conçues pour financer notre site web:

Sur ce lien: Vintage par Michel sur Etsy

Sur cet autre lien:Vintage par Michel sur E Bay

La Criminelle Arnaque du COVID-19:Des preuves biochimiques et statistiques officielles confirment à 100 % que Moderna a créé le Covid-19

1) Lorsque  Kadhafi avait annoncé dans les années 60, en parlant des Américains, « ils fabriqueront des médicaments, et pour vous les fourguer, ils fabriqueront les maladies qui vont avec »; les « experts » l’avaient traité de « fou ». Les mêmes qui traitent aujourd’hui Poutine de fou.
2) Les Big Pharma (Pfizer, Moderna, J&J, etc.) ont sorti leur vaccin Covid en quelques mois, alors qu’habituellement il faut au moins 10 ans, prouve qu’ils étaient tous « au parfum »  de l’arnaque covid qui se préparait chez Moderna.
3) Dès le début de cette pseudo pandémie, nous avons été parmi les premiers à dénoncer cette arnaque et à affirmer que cette « maladie » est artificielle et qu’elle était conçue dans les labos de l’Oncle Sam.  H. Genséric

Des preuves sont apparues prouvant au-delà de tout doute raisonnable que le géant pharmaceutique Moderna, la société qui a gagné des milliards grâce à la vente d’une injection expérimentale appelée vaccin de Covid-19, a en fait créé le virus Covid-19.

Le 23 février, le Daily Mail a publié un article montrant que Moderna avait breveté la séquence de 19 lettres de base (nucléotides) qui code pour le site Furin Cleavage dans Covid-19. 

Il a cité un article rédigé par des scientifiques en Inde, en Suisse, en Italie et aux États-Unis ( avec prudence intitulé : MSH3 Homology and Potential Recombination Link to SARS-CoV-2 Furin Cleavage Site ) dans lequel ils ont calculé que les chances d’une séquence de 19 nucléotides, brevetée par Moderna, apparaissant au hasard dans Covid-19 , dans des circonstances où il n’apparaît nulle part ailleurs dans la nature sont de 1 sur 3 milliards [1].

Mais ils n’ont pas réussi à en tirer la déduction évidente. S’ils avaient fait cette déduction évidente, je crains que cela n’ait été la dernière déduction scientifique qu’ils aient jamais publiée !

Ils ont décidé d’enquêter sur la séquence d’ARN du site de clivage de la furine dans la protéine de pointe Covid-19 pour voir si cela se produisait ailleurs dans la nature. .

Heureusement, le NCBI/NIH a produit la merveilleuse base de données BLAST qui répertorie toutes les séquences de gènes dans la nature connues de l’homme et toutes les séquences de gènes synthétiques brevetées connues de l’office des brevets.

Les chercheurs ont choisi la séquence Furin Cleavage car il s’agit de la seule séquence continue de lettres de gène (séquence de nucléotides) dans Covid-19 avec plus de 3 nucléotides, qui diffère des lettres respectives dans son parent naturel le plus proche, le Bat Coronavirus RaTG13 (toutes les autres différences sont 3 lettres ou moins). C’était donc de loin le meilleur candidat pour déterminer si le Covid-19 était ou non créé par l’homme.

 

De plus, le site de clivage de la furine est la clé de la pathogénicité de Covid-19 . Donc, s’il devait y avoir un gain de fonction créé par l’homme inclus dans le virus, c’est là que l’on pourrait s’attendre à le trouver.

La séquence d’acides aminés du site de clivage de la furine est PRRA (Proline Argenine Argenine Alanine). Chaque acide aminé est codé par un codon composé de 3 nucléotides (lettres de séquence génétique). Ainsi, toutes les différences dans le code génétique entre Covid-19 et RaTG13 sont au plus long d’un codon, d’un acide aminé, autre que la séquence de clivage de la furine, qui est…

CCT CGG CGG GCA

La séquence complémentaire (le brin d’ADN opposé de la double hélice est (GGAGCCGCCCGT) car C se lie à G et A se lie à T

Le compliment inverse (la même chose écrite à l’envers) est donc TGCCCGCCGAGG

Les chercheurs ont effectué une recherche d’alignement BLAST (Basic Local Alignment Search Tool) (ce qui signifie qu’ils recherchent la séquence du gène, la séquence du gène inverse, la séquence du gène complémentaire et la séquence du gène complémentaire inverse) à travers chaque séquence de gènes dans la nature connue de l’homme depuis CTCCTCGGCGGGCACGTAG qui est la séquence de 19 nucléotides contenant la séquence de clivage de la furine, qui apparaît également dans Covid-19, et qui se trouve en fait sous la forme de complément inverse CTACGTGCCCCGCCGAGGAG brevetée par Moderna.

Leurs résultats de recherche peuvent être trouvés ici . 

Le tableau 1 montre qu’il existe bien dans les 5 brevets américains cités ci-dessous…

US9149506B2 : Polynucléotides modifiés codant pour la septine-4 – https://patents.google.com/patent/US9149506B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618953P
2013-12-16 Demande déposée par Moderna Therapeutics Inc
2014-05-22 Publication de US20140141067A1
2015-10-06 Publication de US9149506B2
2015-10-06 Demande accordée
2020-01-10 Premier litige familial mondial déposé

US9216205B2 : Polynucléotides modifiés codant pour la granulysine – https:// patents.google.com/patent/US9216205B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618873P
2013-12-16 Demande déposée par Moderna Therapeutics Inc
2014-04-24 Publication de US20140113960A1 2015-12-22
Publication de US9216205B2 2015-12-22
Demande accordée

SIAH encodant la polynucléotide E3subitine modifiée protéine ligase 1 – https://patents.google.com/patent/US9255129B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618868P
2013-12-16 Demande déposée par Moderna Therapeutics Inc
2014-05-22 Publication de US20140141068A1
2016-02-09 Demande accordée
2016-02-09 Publication de US9255129B2

US9301993B2 : Modified polynucleotides coding apoptosis inducing factor 1 – https://patents.google.com/patent/US9301993B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Mandataire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618957P
2013-12- 16 Demande déposée par Moderna Therapeutics Inc
2014-04-17 Publication de US20140107189A1
2016-04-05 Demande accordée
2016-04-05 Publication de US9301993B2
2020-01-10 Premier litige familial mondial déposé

US9587003B2 : Polynucléotides modifiés pour la production de protéines et de peptides liés à l’oncologie – https://patents.google.com/patent/US9587003B2/en 

Inventeur : Stephane Bancel, Tirtha Chakraborty, Antonin de Fougerolles, Sayda M. Elbashir, Matthias John, Atanu Roy, Susan Whoriskey, Kristy M. Wood, Paul Hatala, Jason P. Schrum, Kenechi Ejebe, Jeff Lynn Ellsworth, Justin Guild

Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618868P
2016-02-04 Demande déposée par ModernaTx Inc
2016-06-02 Publication de US20160152678A1
2017-03-07 Publication de US9587003B2
2017-03-07 Demande accordée

Ainsi, Moderna a déposé une première demande de brevet pour la séquence de 19 nucléotides en 2013 le 16 décembre. Peut-être que le 25 décembre aurait été plus approprié puisqu’il était destiné à devenir la couronne d’épines de Mathew27, Mark15 et John19.

Tableau 2 : montre que la séquence se produit dans Covid-19 du nucléotide 23601 à 23619.

Tableau 3 : montre que cette séquence de gène n’existe pas dans la nature (mais 14 parties nucléotidiques de celle-ci existent). 

J’ai décidé de vérifier leur travail. Oui. Je les ai effectivement vérifiés (j’enverrai une facture aux mondialistes). Cela s’est avéré être un voyage un peu épique. La page de brevet Google pour US9587003B2 ne contient pas la séquence du gène. Le pdf du brevet ne contient pas la séquence du gène et n’est pas consultable à partir des pages 101-304. Mais il a un lien vers une longue section « Liste des séquences » que l’on ne peut pas copier. Je l’ai donc transcrit manuellement de ma main juste –  http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US09587003B2 

À partir de cette page, vous pouvez entrer l’ID de séquence cité dans l’article sous la forme 11652 et accéder à https://seqdata.uspto.gov/?pageRequest=viewSequence&DocID=US09587003B2&seqID=11652 qui a ce qui suit aux nucléotides 2751-2733 en lisant à l’envers…

gccctgatca ccatcatggc ccagatcggc ag ctacgtgc ccgccgagga g gccaccatc 2760

CTACGTGCCCCGCCGAGGAG breveté par Moderna est le complément inverse de CTCCTCGGCGGGCACGTAG, la séquence de 19 nucléotides qui apparaît dans l’ADN de Covid-19 à partir du nucléotide 23601-23619 (qui serait donc couvert par leur brevet).

De même, vous pouvez rechercher la séquence dans US9149506B2 en allant sur https://seqdata.uspto.gov/?pageRequest=viewSequence&DocID=US09149506B2&seqID=11652 , après quoi vous retrouverez la même chose

gccctgatca ccatcatggc ccagatcggc ag ctacgtgc ccgccgagga g gccaccatc 2760

J’ai ensuite recherché la séquence génétique de Wuhan Hu1 (alpha) sur https://www.ncbi.nlm.nih.gov/nuccore/NC_045512 et j’ai trouvé 

23581 ttatcagact cagactaatt ct cctcggcg ggcacgtag t gtagctagtc aatccatcat de https://www.ncbi.nlm.nih.gov/nuccore/NC_045512 

Qui a la séquence de 19 nucléotides CTCCTCGGCGGGCACGTAG de 23601-23619 comme décrit dans le tableau 3. 

J’ai ensuite effectué ma propre recherche par explosion non alignée de toutes les séquences de gènes brevetées pour le compliment inverse directement (ou peut-être pour un compliment inversé) et j’ai obtenu les mêmes résultats que les chercheurs. 

Et pareil pour les 3 autres brevets américains.

Je peux donc confirmer, et le lecteur peut confirmer en utilisant les liens ci-dessus, que Moderna a demandé un brevet non seulement sur le complément inverse du site de clivage de la furine à 12 nucléotides dans Covid-19, mais en fait sur la séquence de 19 nucléotides le contenant comme décrit au dessus.

De plus, ils n’ont pas simplement déposé une demande de brevet le 4 février 2016 avec US9587003B2 : comme le rapporte le Daily Mail. Ils ont effectivement déposé le 16 décembre 2013 pour 4 brevets avec US9149506B2, US9216205B2, US9255129B2, US9301993B2 : également.

Ainsi, Moderna avait développé la séquence de gènes de 19 nucléotides contenant le site de clivage de la furine qui donne à Covid19 son infectivité pour l’homme grâce à une recherche brevetée sur le gain de fonction dès 2013, 6 ans avant l’épidémie de Wuhan. Pas 3 comme rapporté dans le Mail et viralement ailleurs.. 

Alors maintenant, nous examinons les chances que cela se produise naturellement. L’article calcule la probabilité que cette séquence particulière de 19 nucléotides se produise de manière aléatoire dans un virus de 30 000 nucléotides comme

(30 000-18) × (1/4) 19   = 1,09 × 10 -7

Ce qui est correct car il y a 30 000 à 18 places pour commencer la séquence étant donné qu’il faut encore 18 lettres supplémentaires pour la compléter. Mais il y a en fait 29 904 nucléotides dans Wuhan HU1 (alpha). Un calcul plus précis serait donc

(29 904-18) × (1/4) 19   = 1,087 × 10 -7

Ensuite, ils calculent les chances que la séquence de 19 nucléotides se produise dans la bibliothèque brevetée de 24 712 séquences d’une longueur moyenne de 3 300 nucléotides. Mais ce calcul n’est pas pertinent car la séquence n’est pas apparue au hasard dans 5 demandes de brevet Moderna. La séquence était connue pour coder pour un site de clivage de la furine, qui est connu pour fournir un gain de fonction aux coronavirus.

Il y a été mis délibérément et breveté en raison de son pouvoir infectieux chez l’homme, que nous verrons plus loin dans l’article, résulte du remplacement du codon viral normal de l’arginine (R) AGA (utilisé dans 45 % des codons viraux de l’arginine) par le le codon de l’arginine humaine CGG (utilisé dans 0 % des codons de l’arginine virale) dans le site de clivage de la furine.

Tout ce que nous essayons de déterminer ici, c’est quelles sont les chances qu’une séquence de 19 nucléotides brevetée par Moderna apparaisse dans Covid-19 par des causes naturelles, les mutations naturelles du Bat Coronavirus RaTG13 ou d’un autre virus.

Les nucléotides forment des codons qui sont des triplets. Il y a donc 64 triplets possibles des 4 nucléotides d’ADN ACGT (4x4x4 = 64). Mais tous les triplés se produisent. 61 codent pour 20 acides aminés de manière redondante et 3 sont des codons stop qui indiquent au ribosome d’arrêter de fabriquer la protéine.

Mais les choses ne sont pas aussi simples car le site de clivage Furin apparaît dans la protéine de pointe là où il doit être et la protéine de pointe n’a que 1273 × 3 = 3819 nucléotides. Les chances que la séquence de 19 nucléotides Furin Cleavage apparaisse dans la protéine de pointe sont 

(3 819-18) × (1/4) 19   = 1,389 × 10 -8

Soit 1 sur 72 millions. Ce seraient donc les chances qu’une variante particulière, disons la première variante de Covid-19, ait la séquence de 19 nucléotides au bon endroit (le pic). Et il l’a fait. Donc, certainement selon la prépondérance des probabilités, et certainement au-delà de tout doute raisonnable (1 sur 72 millions étant un doute déraisonnable), Moderna a créé Covid-19. 

Preuve 100% biochimique que Covid19 a été créé par l’homme

Le double codon CGG utilisé dans le site de clivage spécifique de la furine Moderna ne se produit dans aucun autre site de clivage de la furine dans aucun autre virus dans la nature. Les sites de clivage de la furine se produisent dans d’autres virus mais PAS du tout dans d’autres bétacoronavirus comme Covid-19 et PAS du tout avec le double codon CGG.

L’arginine (R), peut être codée par l’un des 6 triplets : AGG, AGA, CGA, CGC, CGG, CGT. Dans le Covid-19, le site de la furine (PRRA), compte 12 nucléotides (3 x 4). Dans le Covid-19, le doublet RR du site de la furine est codé par CGG-CGG.  

Antonio R. Romeu

Deux biochimistes, le professeur Antonio R. Romeu et le professeur assistant Enric Ollé, ont analysé le doublet RR à partir d’un large échantillon de sites de clivage de la furine de plusieurs types de virus . Ils ont découvert qu’il n’y avait aucun doublet RR codé par les codons CGG-CGG dans aucun virus dans la nature. Ils ont observé que le triplet AGA était le codon majoritaire impliqué dans ces doublets RR viraux.

Dans toute recombinaison génétique (où une partie d’un génome fusionne avec un autre génome), le code donneur est transmis à l’accepteur. Mais il n’y a tout simplement AUCUN VIRUS CONNU avec un site de clivage de la furine spécifique de Moderna (ayant la paire de codons CGG-CGG) qui existe pour donner un site de clivage de la furine spécifique de Moderna à Covid19. Donc, la seule façon dont cette séquence pourrait entrer dans Covid-19 est de Moderna. Moderna était le donateur. La nature ne l’était pas. CQFD. Affaire classée..  

Mais ça empire.

Les professeurs espagnols ont décidé d’analyser l’utilisation du codon de l’arginine dans chaque protéine de Covid-19. Le constat suivant…
AGG (13%)
AGA (45%)
CGA (5%)
CGC (10%)
CGG (3%)
CGT (24%). 

Ainsi, le triplet de codons AGA était majoritaire et, fait intéressant, CGG était le codon minoritaire de l’arginine dans le virus. 

Mais c’est encore pire.

Dans le cas particulier de la protéine S, sur les 42 Arginines (R) dont elle dispose, 20 sont codées par AGA, et seulement 2 par CGG. Ces 2 bien sûr, sont les deux dans le site de clivage Moderna Specific Furin.

Ainsi, la seule arginine dans la protéine de pointe qui est codée à la Moderna se trouve sur le site Furin Cleavage. Les 40 autres instances n’utilisent pas du tout CGG. 

Ils poursuivent ensuite en commentant que chaque espèce individuelle dans la nature a ses propres préférences de codons. De toute évidence, les virus aiment AGA, et n’aiment pas du tout CGG, dans la nature.

Mais devinez quelle espèce utilise CGG pour l’arginine plus que les 5 autres codons concurrents – oui, son vieil homo sapiens. Nos préférences de codage pour l’arginine sont

AGG (20 %)
AGA (20 %)
CGA (11 %)
CGC (19 %)
CGG (21 %)
CGT (9 %).

Ainsi, le codon CGG dans le site de clivage de la furine SERA issu de la recherche sur le gain de fonction chimère (combinaison homme-animal). 

Quelqu’un d’autre que Moderna aurait-il pu créer le Covid-19 en utilisant le site de clivage de la furine spécifique de Moderna ?

« De nouveaux documents montrent que 18 mois seulement avant l’apparition des premiers cas de Covid-19, les chercheurs avaient soumis des plans pour libérer des nanoparticules et des aérosols pénétrant dans la peau contenant de « nouvelles protéines de pointe  » de coronavirus de chauve-souris  des cavernes du Yunnan, en Chine. Ils prévoyaient également de créer des virus chimériques, génétiquement améliorés pour infecter plus facilement les humains, et ont demandé 14 millions de dollars à la Defense Advanced Research Projects Agency (Darpa) pour financer les travaux.

Des articles, confirmés comme authentiques par un ancien membre de l’administration Trump, montrent qu’ils espéraient introduire des «sites de clivage spécifiques à l’homme» pour les coronavirus de chauve-souris, ce qui faciliterait l’entrée du virus dans les cellules humaines.
Lorsque Covid-19 a été séquencé génétiquement pour la première fois, les scientifiques étaient perplexes quant à la façon dont le virus avait développé une telle adaptation spécifique à l’homme au site de clivage de la protéine de pointe, raison pour laquelle il est si infectieux. – le Telegraph

Je peux voir tous les grands journalistes du Daily Mail et du Telegraph (sans parler des scientifiques du monde entier) faire toutes ces recherches sur Covid19 et arriver à la conclusion logique inévitable qu’il y a eu une fuite accidentelle ou délibérée d’un laboratoire et doivent ensuite formuler leurs conclusions de manière à étiqueter cette forte probabilité comme une possibilité faible. 

Mais ci-dessus, nous l’avons prouvé comme un fait (puisque le codon CGG de la séquence de clivage spécifique de la furine de Moderna n’apparaît dans aucun site de clivage de la furine dans aucun virus naturel et, par conséquent, il ne peut pas avoir été le résultat d’une recombinaison génétique naturelle. Il doit donc être le résultat d’une insertion génétique faite par l’homme. 

En théorie, une autre partie impliquée avec le NAIAD ou le NIH aurait pu utiliser le site de clivage de la furine breveté par Moderna et fabriquer Covid19 eux-mêmes. Cela n’aurait brisé aucun brevet de Moderna. Le site de clivage Furin lui-même n’est pas brevetable étant connu depuis au moins 2004

US7223390B2 : Insertion de sites de clivage de la furine protéase dans les protéines membranaires 
et leurs
utilisations

Bien que Moderna ait en fait pu breveter le codage Moderna Specific (CGG pour AGA) du site de clivage de la furine qui n’était pas connu dans la nature même aujourd’hui (si nous acceptons que Covid-19 soit créé par l’homme).

Mais étant donné que la fuite de laboratoire (délibérée ou accidentelle) est venue de Wuhan, et compte tenu de la dissimulation chinoise et des démentis de Fauci exposés par le sénateur Rand Paul, et étant donné les dissimulations du NIH, du NIAID et des services de renseignement américains, quand leur Un rapport de 3 mois sur l’origine de Covid-19 commandé par l’imitateur présidentiel Biden n’a rien donné, et compte tenu des relations entre le NIAID, le NIH, le WIV, l’EcoHealth Alliance, l’Université de Caroline du Nord et Moderna, je ne vois aucune pièce pour quelqu’un d’autre.

De plus, toute la cabale impie des mauvais acteurs a commencé à développer le vaccin Moderna avant que la pandémie ne frappe – https://www.infowars.com/posts/must-watch-nih-claimed-joint-ownership-of-moderna-mrna-vaccine- a commencé-le-développement-des-semaines-avant-la-pandémie/ 

Mais les choses ne sont pas aussi simples que cela parce que la nature a certainement eu 100 000 ans pour fabriquer des virus humains et elle n’a jamais mis une seule fois un site de clivage de furine spécifique à Moderna (CGG pour AGA) dans quoi que ce soit, ni mis la séquence de 19 nucléotides dans quoi que ce soit auparavant.

Pourtant, dans les 6 ans suivant le brevetage de Moderna, nous le trouvons dans Covid-19 dans des circonstances où Moderna travaille avec ce virus. Donc juste là, la probabilité n’est pas de 100 000 contre 6 ou 16 666 contre 1 que Moderna soit responsable plutôt que la nature. Non c’est à 100% car la nature ne l’a pas fait. Il ne l’a jamais fait et rien ne prouve qu’il le fera un jour.

C’est l’homme qui mélange les codons humains et viraux de l’arginine, pas la nature. 

Le prof. Luc Montagnier a passé les dernières années de sa vie à prouver que le COVID-19 était créé par l’homme et qu’il contenait une grande partie du code génétique du VIH1

Le professeur Luc Montagnier, avant de mourir le 8 février 2022, a totalement détruit le concept selon lequel Covid-19 a évolué naturellement en montrant qu’il avait une équivalence massive avec VIH. Le diagramme ci-dessous montre une région de 275 nucléotides de Covid-19 qui contient 200 nucléotides du VIH/SIV (Simian ImmunoVirus). Et rappelez-vous qu’il y a 61 codons spécifiant 20 acides aminés. On peut donc dire la même chose en moyenne de 3 manières différentes avec des codons.

Vous pouvez télécharger un pdf de son étude ici et les documents supplémentaires ici . C’est très technique. Mais il a remporté le prix Nobel pour avoir découvert le virus VIH. Donc, si quelqu’un savait si Covid avait été boosté par le VIH, ce serait lui. Il a souligné que Covid-19 avait été créé par l’homme au début de la pandémie et qu’il avait lui-même été stipendié par la presse et les « vérificateurs des faits » pour avoir dit la vérité scientifique. Tous les « vérificateurs de faits » qui l’ont attaqué avaient tort.

Aucune de leurs vérifications des faits n’avait de fondement scientifique. Ces gens ne sont pas du tout des vérificateurs de faits bien sûr. Ce sont des agences de désinformation mondialistes, des fils de Goebbels, des fact chuckers et des négateurs de la science. Ils sont à peu près aussi dignes de confiance qu’une élection américaine. Je peux vérifier un fait par moi-même merci beaucoup. Je n’ai pas besoin qu’un taliban soumis au lavage de cerveau me dise son opinion sur un sujet qu’il n’a jamais étudié à l’université.

Puisque nous avons prouvé au-delà de tout doute raisonnable (au-delà d’un doute sur 1 sur 72 millions de manière statistique et avec 100% de certitude biochimique à partir du site de clivage de la furine spécifique de Moderna) que Moderna a fabriqué Covid-19. Et puisque Moderna et Fauci n’ont pas admis l’avoir fait et ont en fait dissimulé des preuves à cet effet, il se peut qu’ils cachent également autre chose.

Maintenant, les deux seules théories qui restent sont la théorie des fuites accidentelles de laboratoire et la théorie des fuites délibérées de laboratoire. Nous savons que la grande majorité des fuites politiques ne sont pas des accidents. Ce sont des stratégies délibérées pour procurer un avantage au bailleur ou au payeur. Il est bien connu dans l’industrie informatique que les virus apparaissent lorsque des ventes d’antivirus sont nécessaires. Pourquoi les choses seraient-elles différentes avec les virus humains, maintenant qu’ils peuvent aussi être créés par l’homme ? Surtout si l’on considère le rôle massif de Bill Gates et de sa fondation et de GAVI et GVAP dans le secteur mondial de la vaccination.

La seule raison pour laquelle Moderna créerait Covid-19 est de le lancer sur le marché. Sinon, tout l’exercice serait financièrement futile, commercialement inutile.

La raison invoquée par Fauci pour faire de la recherche sur le gain de fonction est que l’homme doit être en avance sur la nature ou les mauvais acteurs afin d’avoir un vaccin en temps utile si une maladie mute ou est génétiquement modifiée par « les Chinois ou les Russes » pour être mortelle !!

Mais pour croire cela, il faut croire que Moderna s’intéresse à sauver la vie des gens. Je m’excuse. Toutes leurs actions me montrent qu’ils sont intéressés à vacciner les gens sachant à quel point cela risque de leur coûter la vie.

Ils sont intéressés par le profit, le profit qui découle d’une pandémie. Ils ne sont pas des sauveurs de l’humanité comme ils le représentent. Ce sont nos exploiteurs et nos agresseurs.

Ils ont produit le virus pour le faire fuiter, pour se faire passer pour nos sauveurs de leur propre fuite. Ce ne sont pas les activités d’une figure de sauveur. Luc Montagnier essayait d’être notre sauveur d’eux et il a été assassiné (professionnellement) par leurs groupies. [La fiotte Macron a snobé le décès du Savant]
Moderna effectuait des recherches sur le gain de fonction afin de libérer le virus et de forcer un vaccin contre celui-ci d’une manière qui maximiserait ses profits. Ce n’est pas une théorie du complot. C’est ce qui s’est passé précisément. Le cours de leur action a été multiplié par 20. 

Ils l’ont sorti pour vendre leurs vaccins et détruire le système immunitaire de leurs clients car notre système immunitaire réduit leurs profits. C’est le business de Big Pharma. 

La raison pour laquelle l’écrivain est si confiant que Moderna ou leurs agents ont fabriqué et divulgué Covid-19 et la raison pour laquelle je l’ai appelé ainsi au début de la pandémie pour presque autant de ridicule que le professeur Montagnier a reçu (que Dieu le bénisse) est que le les Écritures disent dans Matthieu27, Marc15 et Jean19 : 

29 Et ils (les soldats du gouverneur du verset 27) placèrent une couronne d’épines et la mirent sur sa tête, et un roseau dans sa main droite ; et ils s’agenouillèrent devant lui, et se moquèrent de lui, disant : Salut, roi des Juifs !
30 Et ils crachèrent contre lui, prirent le roseau et le frappèrent sur la tête. (Matthieu 27 ASV)

Puis-je donc demander votre indulgence pendant que j’interprète ces mots : 

Le département américain de la défense a financé l’épissage génétique du coronavirus des protéines de pointe (Covid-19) par l’intermédiaire du NIH, du NIAID et de la DARPA, qui a d’abord infecté Jésus, par l’intermédiaire de son fiancé, les saints de la Nouvelle Alliance, juste après qu’il soit devenu le roi séculier, César à ces saints, les Juifs antitypiques, ceux qui se sont engagés à être des fils angéliques de Jacob, les nés de nouveau angéliquement.

Nous avons calculé que la malédiction qui a empêché Jésus de devenir César des saints s’est terminée en 2019Tishri15 (17/18 octobre). Glenn Beck a réalisé un documentaire montrant que 10 hôpitaux de Wuhan ont pris en charge des cas présentant des symptômes de Covid19 en octobre 2019. Oui les gens. Le Covid-19 est une preuve que Jésus est désormais le Roi séculier sur les saints, les Juifs antitypiques, les Juifs par l’alliance angélique du salut, au moins.

Mais ensuite, les soldats ont craché sur lui. Car c’est ainsi que Covid19 est transféré, à travers de petites gouttelettes d’aérosol expirées par la bouche. Les soldats lui ont délibérément craché dessus. Ce n’était pas une FUITE DE SALIVE ! Ils ont frappé Jésus sur la tête parce que les saints sont à la tête de l’église et ils ont attrapé Covid19 non pas par une infection fortuite au hasard mais par un coup délibéré avec une lecture, une arme biologique, une attaque armée délibérée. Pour en savoir plus, voir ici .

Alors ce que le Pr Montagnier a vu avec son expertise en virologie, je l’ai vu avec mon expertise théologique. Montrer que si les vérificateurs de faits et la science s’excluent mutuellement, la science et la théologie sont en fait d’accord, lorsqu’elles sont bien comprises (et c’est une grande mise en garde). Le Pr M nous a appris que les vaccins provoquent les variants. En effet, la virologie de base interdit la vaccination de masse pendant une pandémie pour cette raison même. Il a dit que la courbe des décès suit la courbe des vaccinations. Remarquez, paradoxalement, si les vaccins ont causé Omicron, alors ils nous ont sauvés d’eux-mêmes !

Le temps est venu de demander des comptes aux personnes et aux organisations

Les fabricants de Covid19, les fabricants de vaccins génétiques. leurs bailleurs de fonds et leurs promoteurs, qui comprennent presque tous les gouvernements, secteurs publics et services de santé dans le monde, sont donc coupables de génocide et de crimes contre l’humanité. Ils ont poussé le viol génétique, la maladie et la mort sur la moitié de la population mondiale afin d’enrichir les poches des sociétés pharmaceutiques. Les gouvernements et les secteurs publics du monde entier ont abandonné leur réglementation des services de santé aux milliardaires et aux entreprises sans cœur

Au Royaume-Uni, tout l’impôt sur le revenu que nous payons va au service de santé et tous ses protocoles sont déterminés par ses régulateurs et tous ses régulateurs sont contrôlés et financés par Big Pharma qui cherchent à nuire puis à gérer notre santé à leur profit.

Ainsi, chaque cent que nous dépensons en impôt sur le revenu nous rapproche un peu plus de la maladie, de la mort et de la toxicomanie.

Le professeur Luc Montagnier,en 2008.

Alors pourquoi le professeur Montagnier a-t-il choisi de passer les dernières années de sa vie à prouver que le Covid-19 était une création humaine et que les protéines de pointe, et donc les vaccins, étaient une menace existentielle pour l’espèce ? Que lui restait-il à prouver à lui-même ou à qui que ce soit d’autre à 87-89 ? Il ne l’a certainement pas fait pour accroître sa réputation dans la profession.

Non, il était animé par la même passion qui l’a poussé à découvrir le VIH. Une passion pour SAUVER l’humanité des virus et de ceux qui voudraient les concevoir pour nous nuire. Et pourquoi a-t-il rendu l’âme en février 2022 ? Parce qu’il savait qu’Omicron avait battu les vaccins. Son travail a été fait par un plus grand virologue que lui. Il a donc pu reposer en paix et aller voir des gens qui ont compris l’ampleur de sa contribution.

Covid-19 n’a pas été fabriqué en 2019. Il a été fabriqué à partir du site de clivage de la furine chimérique spécifique de Moderna (CGG pour AGA) à 19 nucléotides qui n’existe nulle part dans la nature.
Et chaque décès de Covid et chaque décès par vaccin Covid est carrément garé à la porte de ModeRNA en attente de justice.

Mais nous n’exécuterons pas cette justice assez vite. Et donc le fléau final sur l’humanité d’Apocalypse 6: 8, livré par le 4e cavalier de l’apocalypse, que Bill Gates lui-même a prophétisé, arrivera plus tard cette année (après la guerre et après la famine, les 2e et 3e cavaliers).

Source: BREAKING: Official Biochemical and Statistical Evidence 100% confirms Moderna created Covid-19

 


N’hésitez pas à visiter notre boutique en ligne:vous trouverez plein de cadeaux pour vos proches

Sur ce lien:Vintage par Michel