La Criminelle Arnaque du COVID-19:Des preuves biochimiques et statistiques officielles confirment à 100 % que Moderna a créé le Covid-19

1) Lorsque  Kadhafi avait annoncé dans les années 60, en parlant des Américains, « ils fabriqueront des médicaments, et pour vous les fourguer, ils fabriqueront les maladies qui vont avec »; les « experts » l’avaient traité de « fou ». Les mêmes qui traitent aujourd’hui Poutine de fou.
2) Les Big Pharma (Pfizer, Moderna, J&J, etc.) ont sorti leur vaccin Covid en quelques mois, alors qu’habituellement il faut au moins 10 ans, prouve qu’ils étaient tous « au parfum »  de l’arnaque covid qui se préparait chez Moderna.
3) Dès le début de cette pseudo pandémie, nous avons été parmi les premiers à dénoncer cette arnaque et à affirmer que cette « maladie » est artificielle et qu’elle était conçue dans les labos de l’Oncle Sam.  H. Genséric

Des preuves sont apparues prouvant au-delà de tout doute raisonnable que le géant pharmaceutique Moderna, la société qui a gagné des milliards grâce à la vente d’une injection expérimentale appelée vaccin de Covid-19, a en fait créé le virus Covid-19.

Le 23 février, le Daily Mail a publié un article montrant que Moderna avait breveté la séquence de 19 lettres de base (nucléotides) qui code pour le site Furin Cleavage dans Covid-19. 

Il a cité un article rédigé par des scientifiques en Inde, en Suisse, en Italie et aux États-Unis ( avec prudence intitulé : MSH3 Homology and Potential Recombination Link to SARS-CoV-2 Furin Cleavage Site ) dans lequel ils ont calculé que les chances d’une séquence de 19 nucléotides, brevetée par Moderna, apparaissant au hasard dans Covid-19 , dans des circonstances où il n’apparaît nulle part ailleurs dans la nature sont de 1 sur 3 milliards [1].

Mais ils n’ont pas réussi à en tirer la déduction évidente. S’ils avaient fait cette déduction évidente, je crains que cela n’ait été la dernière déduction scientifique qu’ils aient jamais publiée !

Ils ont décidé d’enquêter sur la séquence d’ARN du site de clivage de la furine dans la protéine de pointe Covid-19 pour voir si cela se produisait ailleurs dans la nature. .

Heureusement, le NCBI/NIH a produit la merveilleuse base de données BLAST qui répertorie toutes les séquences de gènes dans la nature connues de l’homme et toutes les séquences de gènes synthétiques brevetées connues de l’office des brevets.

Les chercheurs ont choisi la séquence Furin Cleavage car il s’agit de la seule séquence continue de lettres de gène (séquence de nucléotides) dans Covid-19 avec plus de 3 nucléotides, qui diffère des lettres respectives dans son parent naturel le plus proche, le Bat Coronavirus RaTG13 (toutes les autres différences sont 3 lettres ou moins). C’était donc de loin le meilleur candidat pour déterminer si le Covid-19 était ou non créé par l’homme.

 

De plus, le site de clivage de la furine est la clé de la pathogénicité de Covid-19 . Donc, s’il devait y avoir un gain de fonction créé par l’homme inclus dans le virus, c’est là que l’on pourrait s’attendre à le trouver.

La séquence d’acides aminés du site de clivage de la furine est PRRA (Proline Argenine Argenine Alanine). Chaque acide aminé est codé par un codon composé de 3 nucléotides (lettres de séquence génétique). Ainsi, toutes les différences dans le code génétique entre Covid-19 et RaTG13 sont au plus long d’un codon, d’un acide aminé, autre que la séquence de clivage de la furine, qui est…

CCT CGG CGG GCA

La séquence complémentaire (le brin d’ADN opposé de la double hélice est (GGAGCCGCCCGT) car C se lie à G et A se lie à T

Le compliment inverse (la même chose écrite à l’envers) est donc TGCCCGCCGAGG

Les chercheurs ont effectué une recherche d’alignement BLAST (Basic Local Alignment Search Tool) (ce qui signifie qu’ils recherchent la séquence du gène, la séquence du gène inverse, la séquence du gène complémentaire et la séquence du gène complémentaire inverse) à travers chaque séquence de gènes dans la nature connue de l’homme depuis CTCCTCGGCGGGCACGTAG qui est la séquence de 19 nucléotides contenant la séquence de clivage de la furine, qui apparaît également dans Covid-19, et qui se trouve en fait sous la forme de complément inverse CTACGTGCCCCGCCGAGGAG brevetée par Moderna.

Leurs résultats de recherche peuvent être trouvés ici . 

Le tableau 1 montre qu’il existe bien dans les 5 brevets américains cités ci-dessous…

US9149506B2 : Polynucléotides modifiés codant pour la septine-4 – https://patents.google.com/patent/US9149506B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618953P
2013-12-16 Demande déposée par Moderna Therapeutics Inc
2014-05-22 Publication de US20140141067A1
2015-10-06 Publication de US9149506B2
2015-10-06 Demande accordée
2020-01-10 Premier litige familial mondial déposé

US9216205B2 : Polynucléotides modifiés codant pour la granulysine – https:// patents.google.com/patent/US9216205B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618873P
2013-12-16 Demande déposée par Moderna Therapeutics Inc
2014-04-24 Publication de US20140113960A1 2015-12-22
Publication de US9216205B2 2015-12-22
Demande accordée

SIAH encodant la polynucléotide E3subitine modifiée protéine ligase 1 – https://patents.google.com/patent/US9255129B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618868P
2013-12-16 Demande déposée par Moderna Therapeutics Inc
2014-05-22 Publication de US20140141068A1
2016-02-09 Demande accordée
2016-02-09 Publication de US9255129B2

US9301993B2 : Modified polynucleotides coding apoptosis inducing factor 1 – https://patents.google.com/patent/US9301993B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Mandataire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618957P
2013-12- 16 Demande déposée par Moderna Therapeutics Inc
2014-04-17 Publication de US20140107189A1
2016-04-05 Demande accordée
2016-04-05 Publication de US9301993B2
2020-01-10 Premier litige familial mondial déposé

US9587003B2 : Polynucléotides modifiés pour la production de protéines et de peptides liés à l’oncologie – https://patents.google.com/patent/US9587003B2/en 

Inventeur : Stephane Bancel, Tirtha Chakraborty, Antonin de Fougerolles, Sayda M. Elbashir, Matthias John, Atanu Roy, Susan Whoriskey, Kristy M. Wood, Paul Hatala, Jason P. Schrum, Kenechi Ejebe, Jeff Lynn Ellsworth, Justin Guild

Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618868P
2016-02-04 Demande déposée par ModernaTx Inc
2016-06-02 Publication de US20160152678A1
2017-03-07 Publication de US9587003B2
2017-03-07 Demande accordée

Ainsi, Moderna a déposé une première demande de brevet pour la séquence de 19 nucléotides en 2013 le 16 décembre. Peut-être que le 25 décembre aurait été plus approprié puisqu’il était destiné à devenir la couronne d’épines de Mathew27, Mark15 et John19.

Tableau 2 : montre que la séquence se produit dans Covid-19 du nucléotide 23601 à 23619.

Tableau 3 : montre que cette séquence de gène n’existe pas dans la nature (mais 14 parties nucléotidiques de celle-ci existent). 

J’ai décidé de vérifier leur travail. Oui. Je les ai effectivement vérifiés (j’enverrai une facture aux mondialistes). Cela s’est avéré être un voyage un peu épique. La page de brevet Google pour US9587003B2 ne contient pas la séquence du gène. Le pdf du brevet ne contient pas la séquence du gène et n’est pas consultable à partir des pages 101-304. Mais il a un lien vers une longue section « Liste des séquences » que l’on ne peut pas copier. Je l’ai donc transcrit manuellement de ma main juste –  http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US09587003B2 

À partir de cette page, vous pouvez entrer l’ID de séquence cité dans l’article sous la forme 11652 et accéder à https://seqdata.uspto.gov/?pageRequest=viewSequence&DocID=US09587003B2&seqID=11652 qui a ce qui suit aux nucléotides 2751-2733 en lisant à l’envers…

gccctgatca ccatcatggc ccagatcggc ag ctacgtgc ccgccgagga g gccaccatc 2760

CTACGTGCCCCGCCGAGGAG breveté par Moderna est le complément inverse de CTCCTCGGCGGGCACGTAG, la séquence de 19 nucléotides qui apparaît dans l’ADN de Covid-19 à partir du nucléotide 23601-23619 (qui serait donc couvert par leur brevet).

De même, vous pouvez rechercher la séquence dans US9149506B2 en allant sur https://seqdata.uspto.gov/?pageRequest=viewSequence&DocID=US09149506B2&seqID=11652 , après quoi vous retrouverez la même chose

gccctgatca ccatcatggc ccagatcggc ag ctacgtgc ccgccgagga g gccaccatc 2760

J’ai ensuite recherché la séquence génétique de Wuhan Hu1 (alpha) sur https://www.ncbi.nlm.nih.gov/nuccore/NC_045512 et j’ai trouvé 

23581 ttatcagact cagactaatt ct cctcggcg ggcacgtag t gtagctagtc aatccatcat de https://www.ncbi.nlm.nih.gov/nuccore/NC_045512 

Qui a la séquence de 19 nucléotides CTCCTCGGCGGGCACGTAG de 23601-23619 comme décrit dans le tableau 3. 

J’ai ensuite effectué ma propre recherche par explosion non alignée de toutes les séquences de gènes brevetées pour le compliment inverse directement (ou peut-être pour un compliment inversé) et j’ai obtenu les mêmes résultats que les chercheurs. 

Et pareil pour les 3 autres brevets américains.

Je peux donc confirmer, et le lecteur peut confirmer en utilisant les liens ci-dessus, que Moderna a demandé un brevet non seulement sur le complément inverse du site de clivage de la furine à 12 nucléotides dans Covid-19, mais en fait sur la séquence de 19 nucléotides le contenant comme décrit au dessus.

De plus, ils n’ont pas simplement déposé une demande de brevet le 4 février 2016 avec US9587003B2 : comme le rapporte le Daily Mail. Ils ont effectivement déposé le 16 décembre 2013 pour 4 brevets avec US9149506B2, US9216205B2, US9255129B2, US9301993B2 : également.

Ainsi, Moderna avait développé la séquence de gènes de 19 nucléotides contenant le site de clivage de la furine qui donne à Covid19 son infectivité pour l’homme grâce à une recherche brevetée sur le gain de fonction dès 2013, 6 ans avant l’épidémie de Wuhan. Pas 3 comme rapporté dans le Mail et viralement ailleurs.. 

Alors maintenant, nous examinons les chances que cela se produise naturellement. L’article calcule la probabilité que cette séquence particulière de 19 nucléotides se produise de manière aléatoire dans un virus de 30 000 nucléotides comme

(30 000-18) × (1/4) 19   = 1,09 × 10 -7

Ce qui est correct car il y a 30 000 à 18 places pour commencer la séquence étant donné qu’il faut encore 18 lettres supplémentaires pour la compléter. Mais il y a en fait 29 904 nucléotides dans Wuhan HU1 (alpha). Un calcul plus précis serait donc

(29 904-18) × (1/4) 19   = 1,087 × 10 -7

Ensuite, ils calculent les chances que la séquence de 19 nucléotides se produise dans la bibliothèque brevetée de 24 712 séquences d’une longueur moyenne de 3 300 nucléotides. Mais ce calcul n’est pas pertinent car la séquence n’est pas apparue au hasard dans 5 demandes de brevet Moderna. La séquence était connue pour coder pour un site de clivage de la furine, qui est connu pour fournir un gain de fonction aux coronavirus.

Il y a été mis délibérément et breveté en raison de son pouvoir infectieux chez l’homme, que nous verrons plus loin dans l’article, résulte du remplacement du codon viral normal de l’arginine (R) AGA (utilisé dans 45 % des codons viraux de l’arginine) par le le codon de l’arginine humaine CGG (utilisé dans 0 % des codons de l’arginine virale) dans le site de clivage de la furine.

Tout ce que nous essayons de déterminer ici, c’est quelles sont les chances qu’une séquence de 19 nucléotides brevetée par Moderna apparaisse dans Covid-19 par des causes naturelles, les mutations naturelles du Bat Coronavirus RaTG13 ou d’un autre virus.

Les nucléotides forment des codons qui sont des triplets. Il y a donc 64 triplets possibles des 4 nucléotides d’ADN ACGT (4x4x4 = 64). Mais tous les triplés se produisent. 61 codent pour 20 acides aminés de manière redondante et 3 sont des codons stop qui indiquent au ribosome d’arrêter de fabriquer la protéine.

Mais les choses ne sont pas aussi simples car le site de clivage Furin apparaît dans la protéine de pointe là où il doit être et la protéine de pointe n’a que 1273 × 3 = 3819 nucléotides. Les chances que la séquence de 19 nucléotides Furin Cleavage apparaisse dans la protéine de pointe sont 

(3 819-18) × (1/4) 19   = 1,389 × 10 -8

Soit 1 sur 72 millions. Ce seraient donc les chances qu’une variante particulière, disons la première variante de Covid-19, ait la séquence de 19 nucléotides au bon endroit (le pic). Et il l’a fait. Donc, certainement selon la prépondérance des probabilités, et certainement au-delà de tout doute raisonnable (1 sur 72 millions étant un doute déraisonnable), Moderna a créé Covid-19. 

Preuve 100% biochimique que Covid19 a été créé par l’homme

Le double codon CGG utilisé dans le site de clivage spécifique de la furine Moderna ne se produit dans aucun autre site de clivage de la furine dans aucun autre virus dans la nature. Les sites de clivage de la furine se produisent dans d’autres virus mais PAS du tout dans d’autres bétacoronavirus comme Covid-19 et PAS du tout avec le double codon CGG.

L’arginine (R), peut être codée par l’un des 6 triplets : AGG, AGA, CGA, CGC, CGG, CGT. Dans le Covid-19, le site de la furine (PRRA), compte 12 nucléotides (3 x 4). Dans le Covid-19, le doublet RR du site de la furine est codé par CGG-CGG.  

Antonio R. Romeu

Deux biochimistes, le professeur Antonio R. Romeu et le professeur assistant Enric Ollé, ont analysé le doublet RR à partir d’un large échantillon de sites de clivage de la furine de plusieurs types de virus . Ils ont découvert qu’il n’y avait aucun doublet RR codé par les codons CGG-CGG dans aucun virus dans la nature. Ils ont observé que le triplet AGA était le codon majoritaire impliqué dans ces doublets RR viraux.

Dans toute recombinaison génétique (où une partie d’un génome fusionne avec un autre génome), le code donneur est transmis à l’accepteur. Mais il n’y a tout simplement AUCUN VIRUS CONNU avec un site de clivage de la furine spécifique de Moderna (ayant la paire de codons CGG-CGG) qui existe pour donner un site de clivage de la furine spécifique de Moderna à Covid19. Donc, la seule façon dont cette séquence pourrait entrer dans Covid-19 est de Moderna. Moderna était le donateur. La nature ne l’était pas. CQFD. Affaire classée..  

Mais ça empire.

Les professeurs espagnols ont décidé d’analyser l’utilisation du codon de l’arginine dans chaque protéine de Covid-19. Le constat suivant…
AGG (13%)
AGA (45%)
CGA (5%)
CGC (10%)
CGG (3%)
CGT (24%). 

Ainsi, le triplet de codons AGA était majoritaire et, fait intéressant, CGG était le codon minoritaire de l’arginine dans le virus. 

Mais c’est encore pire.

Dans le cas particulier de la protéine S, sur les 42 Arginines (R) dont elle dispose, 20 sont codées par AGA, et seulement 2 par CGG. Ces 2 bien sûr, sont les deux dans le site de clivage Moderna Specific Furin.

Ainsi, la seule arginine dans la protéine de pointe qui est codée à la Moderna se trouve sur le site Furin Cleavage. Les 40 autres instances n’utilisent pas du tout CGG. 

Ils poursuivent ensuite en commentant que chaque espèce individuelle dans la nature a ses propres préférences de codons. De toute évidence, les virus aiment AGA, et n’aiment pas du tout CGG, dans la nature.

Mais devinez quelle espèce utilise CGG pour l’arginine plus que les 5 autres codons concurrents – oui, son vieil homo sapiens. Nos préférences de codage pour l’arginine sont

AGG (20 %)
AGA (20 %)
CGA (11 %)
CGC (19 %)
CGG (21 %)
CGT (9 %).

Ainsi, le codon CGG dans le site de clivage de la furine SERA issu de la recherche sur le gain de fonction chimère (combinaison homme-animal). 

Quelqu’un d’autre que Moderna aurait-il pu créer le Covid-19 en utilisant le site de clivage de la furine spécifique de Moderna ?

« De nouveaux documents montrent que 18 mois seulement avant l’apparition des premiers cas de Covid-19, les chercheurs avaient soumis des plans pour libérer des nanoparticules et des aérosols pénétrant dans la peau contenant de « nouvelles protéines de pointe  » de coronavirus de chauve-souris  des cavernes du Yunnan, en Chine. Ils prévoyaient également de créer des virus chimériques, génétiquement améliorés pour infecter plus facilement les humains, et ont demandé 14 millions de dollars à la Defense Advanced Research Projects Agency (Darpa) pour financer les travaux.

Des articles, confirmés comme authentiques par un ancien membre de l’administration Trump, montrent qu’ils espéraient introduire des «sites de clivage spécifiques à l’homme» pour les coronavirus de chauve-souris, ce qui faciliterait l’entrée du virus dans les cellules humaines.
Lorsque Covid-19 a été séquencé génétiquement pour la première fois, les scientifiques étaient perplexes quant à la façon dont le virus avait développé une telle adaptation spécifique à l’homme au site de clivage de la protéine de pointe, raison pour laquelle il est si infectieux. – le Telegraph

Je peux voir tous les grands journalistes du Daily Mail et du Telegraph (sans parler des scientifiques du monde entier) faire toutes ces recherches sur Covid19 et arriver à la conclusion logique inévitable qu’il y a eu une fuite accidentelle ou délibérée d’un laboratoire et doivent ensuite formuler leurs conclusions de manière à étiqueter cette forte probabilité comme une possibilité faible. 

Mais ci-dessus, nous l’avons prouvé comme un fait (puisque le codon CGG de la séquence de clivage spécifique de la furine de Moderna n’apparaît dans aucun site de clivage de la furine dans aucun virus naturel et, par conséquent, il ne peut pas avoir été le résultat d’une recombinaison génétique naturelle. Il doit donc être le résultat d’une insertion génétique faite par l’homme. 

En théorie, une autre partie impliquée avec le NAIAD ou le NIH aurait pu utiliser le site de clivage de la furine breveté par Moderna et fabriquer Covid19 eux-mêmes. Cela n’aurait brisé aucun brevet de Moderna. Le site de clivage Furin lui-même n’est pas brevetable étant connu depuis au moins 2004

US7223390B2 : Insertion de sites de clivage de la furine protéase dans les protéines membranaires 
et leurs
utilisations

Bien que Moderna ait en fait pu breveter le codage Moderna Specific (CGG pour AGA) du site de clivage de la furine qui n’était pas connu dans la nature même aujourd’hui (si nous acceptons que Covid-19 soit créé par l’homme).

Mais étant donné que la fuite de laboratoire (délibérée ou accidentelle) est venue de Wuhan, et compte tenu de la dissimulation chinoise et des démentis de Fauci exposés par le sénateur Rand Paul, et étant donné les dissimulations du NIH, du NIAID et des services de renseignement américains, quand leur Un rapport de 3 mois sur l’origine de Covid-19 commandé par l’imitateur présidentiel Biden n’a rien donné, et compte tenu des relations entre le NIAID, le NIH, le WIV, l’EcoHealth Alliance, l’Université de Caroline du Nord et Moderna, je ne vois aucune pièce pour quelqu’un d’autre.

De plus, toute la cabale impie des mauvais acteurs a commencé à développer le vaccin Moderna avant que la pandémie ne frappe – https://www.infowars.com/posts/must-watch-nih-claimed-joint-ownership-of-moderna-mrna-vaccine- a commencé-le-développement-des-semaines-avant-la-pandémie/ 

Mais les choses ne sont pas aussi simples que cela parce que la nature a certainement eu 100 000 ans pour fabriquer des virus humains et elle n’a jamais mis une seule fois un site de clivage de furine spécifique à Moderna (CGG pour AGA) dans quoi que ce soit, ni mis la séquence de 19 nucléotides dans quoi que ce soit auparavant.

Pourtant, dans les 6 ans suivant le brevetage de Moderna, nous le trouvons dans Covid-19 dans des circonstances où Moderna travaille avec ce virus. Donc juste là, la probabilité n’est pas de 100 000 contre 6 ou 16 666 contre 1 que Moderna soit responsable plutôt que la nature. Non c’est à 100% car la nature ne l’a pas fait. Il ne l’a jamais fait et rien ne prouve qu’il le fera un jour.

C’est l’homme qui mélange les codons humains et viraux de l’arginine, pas la nature. 

Le prof. Luc Montagnier a passé les dernières années de sa vie à prouver que le COVID-19 était créé par l’homme et qu’il contenait une grande partie du code génétique du VIH1

Le professeur Luc Montagnier, avant de mourir le 8 février 2022, a totalement détruit le concept selon lequel Covid-19 a évolué naturellement en montrant qu’il avait une équivalence massive avec VIH. Le diagramme ci-dessous montre une région de 275 nucléotides de Covid-19 qui contient 200 nucléotides du VIH/SIV (Simian ImmunoVirus). Et rappelez-vous qu’il y a 61 codons spécifiant 20 acides aminés. On peut donc dire la même chose en moyenne de 3 manières différentes avec des codons.

Vous pouvez télécharger un pdf de son étude ici et les documents supplémentaires ici . C’est très technique. Mais il a remporté le prix Nobel pour avoir découvert le virus VIH. Donc, si quelqu’un savait si Covid avait été boosté par le VIH, ce serait lui. Il a souligné que Covid-19 avait été créé par l’homme au début de la pandémie et qu’il avait lui-même été stipendié par la presse et les « vérificateurs des faits » pour avoir dit la vérité scientifique. Tous les « vérificateurs de faits » qui l’ont attaqué avaient tort.

Aucune de leurs vérifications des faits n’avait de fondement scientifique. Ces gens ne sont pas du tout des vérificateurs de faits bien sûr. Ce sont des agences de désinformation mondialistes, des fils de Goebbels, des fact chuckers et des négateurs de la science. Ils sont à peu près aussi dignes de confiance qu’une élection américaine. Je peux vérifier un fait par moi-même merci beaucoup. Je n’ai pas besoin qu’un taliban soumis au lavage de cerveau me dise son opinion sur un sujet qu’il n’a jamais étudié à l’université.

Puisque nous avons prouvé au-delà de tout doute raisonnable (au-delà d’un doute sur 1 sur 72 millions de manière statistique et avec 100% de certitude biochimique à partir du site de clivage de la furine spécifique de Moderna) que Moderna a fabriqué Covid-19. Et puisque Moderna et Fauci n’ont pas admis l’avoir fait et ont en fait dissimulé des preuves à cet effet, il se peut qu’ils cachent également autre chose.

Maintenant, les deux seules théories qui restent sont la théorie des fuites accidentelles de laboratoire et la théorie des fuites délibérées de laboratoire. Nous savons que la grande majorité des fuites politiques ne sont pas des accidents. Ce sont des stratégies délibérées pour procurer un avantage au bailleur ou au payeur. Il est bien connu dans l’industrie informatique que les virus apparaissent lorsque des ventes d’antivirus sont nécessaires. Pourquoi les choses seraient-elles différentes avec les virus humains, maintenant qu’ils peuvent aussi être créés par l’homme ? Surtout si l’on considère le rôle massif de Bill Gates et de sa fondation et de GAVI et GVAP dans le secteur mondial de la vaccination.

La seule raison pour laquelle Moderna créerait Covid-19 est de le lancer sur le marché. Sinon, tout l’exercice serait financièrement futile, commercialement inutile.

La raison invoquée par Fauci pour faire de la recherche sur le gain de fonction est que l’homme doit être en avance sur la nature ou les mauvais acteurs afin d’avoir un vaccin en temps utile si une maladie mute ou est génétiquement modifiée par « les Chinois ou les Russes » pour être mortelle !!

Mais pour croire cela, il faut croire que Moderna s’intéresse à sauver la vie des gens. Je m’excuse. Toutes leurs actions me montrent qu’ils sont intéressés à vacciner les gens sachant à quel point cela risque de leur coûter la vie.

Ils sont intéressés par le profit, le profit qui découle d’une pandémie. Ils ne sont pas des sauveurs de l’humanité comme ils le représentent. Ce sont nos exploiteurs et nos agresseurs.

Ils ont produit le virus pour le faire fuiter, pour se faire passer pour nos sauveurs de leur propre fuite. Ce ne sont pas les activités d’une figure de sauveur. Luc Montagnier essayait d’être notre sauveur d’eux et il a été assassiné (professionnellement) par leurs groupies. [La fiotte Macron a snobé le décès du Savant]
Moderna effectuait des recherches sur le gain de fonction afin de libérer le virus et de forcer un vaccin contre celui-ci d’une manière qui maximiserait ses profits. Ce n’est pas une théorie du complot. C’est ce qui s’est passé précisément. Le cours de leur action a été multiplié par 20. 

Ils l’ont sorti pour vendre leurs vaccins et détruire le système immunitaire de leurs clients car notre système immunitaire réduit leurs profits. C’est le business de Big Pharma. 

La raison pour laquelle l’écrivain est si confiant que Moderna ou leurs agents ont fabriqué et divulgué Covid-19 et la raison pour laquelle je l’ai appelé ainsi au début de la pandémie pour presque autant de ridicule que le professeur Montagnier a reçu (que Dieu le bénisse) est que le les Écritures disent dans Matthieu27, Marc15 et Jean19 : 

29 Et ils (les soldats du gouverneur du verset 27) placèrent une couronne d’épines et la mirent sur sa tête, et un roseau dans sa main droite ; et ils s’agenouillèrent devant lui, et se moquèrent de lui, disant : Salut, roi des Juifs !
30 Et ils crachèrent contre lui, prirent le roseau et le frappèrent sur la tête. (Matthieu 27 ASV)

Puis-je donc demander votre indulgence pendant que j’interprète ces mots : 

Le département américain de la défense a financé l’épissage génétique du coronavirus des protéines de pointe (Covid-19) par l’intermédiaire du NIH, du NIAID et de la DARPA, qui a d’abord infecté Jésus, par l’intermédiaire de son fiancé, les saints de la Nouvelle Alliance, juste après qu’il soit devenu le roi séculier, César à ces saints, les Juifs antitypiques, ceux qui se sont engagés à être des fils angéliques de Jacob, les nés de nouveau angéliquement.

Nous avons calculé que la malédiction qui a empêché Jésus de devenir César des saints s’est terminée en 2019Tishri15 (17/18 octobre). Glenn Beck a réalisé un documentaire montrant que 10 hôpitaux de Wuhan ont pris en charge des cas présentant des symptômes de Covid19 en octobre 2019. Oui les gens. Le Covid-19 est une preuve que Jésus est désormais le Roi séculier sur les saints, les Juifs antitypiques, les Juifs par l’alliance angélique du salut, au moins.

Mais ensuite, les soldats ont craché sur lui. Car c’est ainsi que Covid19 est transféré, à travers de petites gouttelettes d’aérosol expirées par la bouche. Les soldats lui ont délibérément craché dessus. Ce n’était pas une FUITE DE SALIVE ! Ils ont frappé Jésus sur la tête parce que les saints sont à la tête de l’église et ils ont attrapé Covid19 non pas par une infection fortuite au hasard mais par un coup délibéré avec une lecture, une arme biologique, une attaque armée délibérée. Pour en savoir plus, voir ici .

Alors ce que le Pr Montagnier a vu avec son expertise en virologie, je l’ai vu avec mon expertise théologique. Montrer que si les vérificateurs de faits et la science s’excluent mutuellement, la science et la théologie sont en fait d’accord, lorsqu’elles sont bien comprises (et c’est une grande mise en garde). Le Pr M nous a appris que les vaccins provoquent les variants. En effet, la virologie de base interdit la vaccination de masse pendant une pandémie pour cette raison même. Il a dit que la courbe des décès suit la courbe des vaccinations. Remarquez, paradoxalement, si les vaccins ont causé Omicron, alors ils nous ont sauvés d’eux-mêmes !

Le temps est venu de demander des comptes aux personnes et aux organisations

Les fabricants de Covid19, les fabricants de vaccins génétiques. leurs bailleurs de fonds et leurs promoteurs, qui comprennent presque tous les gouvernements, secteurs publics et services de santé dans le monde, sont donc coupables de génocide et de crimes contre l’humanité. Ils ont poussé le viol génétique, la maladie et la mort sur la moitié de la population mondiale afin d’enrichir les poches des sociétés pharmaceutiques. Les gouvernements et les secteurs publics du monde entier ont abandonné leur réglementation des services de santé aux milliardaires et aux entreprises sans cœur

Au Royaume-Uni, tout l’impôt sur le revenu que nous payons va au service de santé et tous ses protocoles sont déterminés par ses régulateurs et tous ses régulateurs sont contrôlés et financés par Big Pharma qui cherchent à nuire puis à gérer notre santé à leur profit.

Ainsi, chaque cent que nous dépensons en impôt sur le revenu nous rapproche un peu plus de la maladie, de la mort et de la toxicomanie.

Le professeur Luc Montagnier,en 2008.

Alors pourquoi le professeur Montagnier a-t-il choisi de passer les dernières années de sa vie à prouver que le Covid-19 était une création humaine et que les protéines de pointe, et donc les vaccins, étaient une menace existentielle pour l’espèce ? Que lui restait-il à prouver à lui-même ou à qui que ce soit d’autre à 87-89 ? Il ne l’a certainement pas fait pour accroître sa réputation dans la profession.

Non, il était animé par la même passion qui l’a poussé à découvrir le VIH. Une passion pour SAUVER l’humanité des virus et de ceux qui voudraient les concevoir pour nous nuire. Et pourquoi a-t-il rendu l’âme en février 2022 ? Parce qu’il savait qu’Omicron avait battu les vaccins. Son travail a été fait par un plus grand virologue que lui. Il a donc pu reposer en paix et aller voir des gens qui ont compris l’ampleur de sa contribution.

Covid-19 n’a pas été fabriqué en 2019. Il a été fabriqué à partir du site de clivage de la furine chimérique spécifique de Moderna (CGG pour AGA) à 19 nucléotides qui n’existe nulle part dans la nature.
Et chaque décès de Covid et chaque décès par vaccin Covid est carrément garé à la porte de ModeRNA en attente de justice.

Mais nous n’exécuterons pas cette justice assez vite. Et donc le fléau final sur l’humanité d’Apocalypse 6: 8, livré par le 4e cavalier de l’apocalypse, que Bill Gates lui-même a prophétisé, arrivera plus tard cette année (après la guerre et après la famine, les 2e et 3e cavaliers).

Source: BREAKING: Official Biochemical and Statistical Evidence 100% confirms Moderna created Covid-19

 


N’hésitez pas à visiter notre boutique en ligne:vous trouverez plein de cadeaux pour vos proches

Sur ce lien:Vintage par Michel

 

Troisième Guerre Mondiale en développement rapide:Les manigances de l’état profond

L’Ukraine en quelques chiffres
Barack Hussein Obama et Georges Soros.
George SOROS contrôlait l’Ukraine depuis 2012 et a été inséré par le GROUPE DAVOS et soutenu par OBAMA, l’ONU, la CIA, le MOSSAD et  l’OTAN ( les mêmes entités de l’arnaque Pandémique).
Ils ont fait leur coup d’état (révolution colorée) en Ukraine en 2014 et ont utilisé des étudiants et des organisations nazies et ashkénazies ( Zelensky) dans le coup d’État.
Depuis lors, l’ÉTAT PROFOND prive l’UKRAINE de ses produits et de toutes les ressources naturelles… Voici une liste de ce que l’ONU et les filiales du groupe Davos/ Clinton/ Biden ont volé à l’UKRAINE et blanchi plus de 7 BILLIONS DE DOLLARS par l’intermédiaire du gouvernement UKRAINE].
– C’est le deuxième plus grand pays d’Europe par superficie et compte plus de 43 millions d’habitants
L’Ukraine se classe :
1er en Europe dans les réserves récupérables prouvées de minerais d’uranium ;
2e place en Europe et 10e place au monde en termes de réserves de minerai de titane ;
2e place au monde en termes de réserves explorées de minerais de manganèse (2,3 milliards de tonnes, soit 12 % des réserves mondiales) ;
2e plus grande réserve de minerai de fer au monde (30 milliards de tonnes) ;
2e place en Europe en termes de réserves de minerai de mercure ;
3e place en Europe (13e place au monde) dans les réserves de gaz de schiste (22 billions de mètres cubes)
4e au monde par la valeur totale des ressources naturelles ;
7e place au monde dans les réserves de charbon (33,9 milliards de tonnes)
L’Ukraine est un pays agricole important :
1er en Europe en termes de superficie en terres arables ;
3e place au monde par la superficie du sol noir (25 % du volume mondial) ;
1ère place au monde dans les exportations d’huile de tournesol et de tournesol ;
2e place au monde dans la production d’orge et 4e place dans les exportations d’orge ;
3e producteur et 4e exportateur de maïs au monde ;
4e producteur mondial de pommes de terre ;
5e plus grand producteur de seigle au monde ;
5e place au monde dans la production apicole (75 000 tonnes) ;
8e place au monde dans les exportations de blé ;
9e place au monde dans la production d’œufs de poule ;
16e place au monde dans les exportations de fromage.
L’Ukraine peut répondre aux besoins alimentaires de 600 millions de personnes.
L’Ukraine est un pays industrialisé important :
1er en Europe dans la production d’ammoniac ;
Le 2e et le 4e plus grand réseau de gazoducs d’Europe au monde ;
3e plus grand d’Europe et 8e plus grand au monde en termes de capacité installée des centrales nucléaires ;
3e place en Europe et 11e au monde en termes de longueur du réseau ferroviaire (21 700 km) ;
3e place au monde (après les États-Unis et la France) dans la production de localisateurs et d’équipements de localisation ;
3e plus grand exportateur de fer au monde
4e exportateur mondial de turbines pour centrales nucléaires ;
4e plus grand fabricant mondial de lance-roquettes ;
4e place au monde dans les exportations d’argile
4e place au monde dans les exportations de titane
8e place au monde en matière d’exportations de minerais et de concentrés ;
9e place au monde dans les exportations de produits de l’industrie de la défense ;
10e plus grand producteur d’acier au monde (32,4 millions de tonnes).
L’UKRAINE est le premier réseau de blanchiment d’argent en Europe créé par les Clinton et Obama. L’ONU.
En connexion avec Israël, l’Ukraine est le plus grand exportateur de femmes goyim  (traite des êtres humains) d’Europe… Mais toutes les données sont supprimées et les enquêtes sont arrêtées en temps de conflit (d’où la GUERRE par procuration de 8 ans dans le Donbass).
Moscou a annoncé une opération militaire spéciale en Ukraine le 24 février 2022, dans le but de défendre les habitants du Donbass contre l’agression de Kiev. La Russie a également déclaré que le but de son opération spéciale était de démilitariser et de « dénazifier » l’Ukraine, et que seules les infrastructures militaires étaient visées.
Lors d’une conversation téléphonique avec Recep Tayyip Erdogan,le dimanche suivant, le président russe Vladimir Poutine a assuré à son homologue turc que l’opération se déroulait comme prévu .
Pendant ce temps, le Kremlin a également souligné la « cruauté et le cynisme particuliers » des formations nationalistes et néonazies ukrainiennes qui continuent d’attaquer le Donbass et d’utiliser des civils, y compris des étrangers retenus en otage dans les villes ukrainiennes, comme boucliers humains.
La Russie et ses alliés de la République populaire de Donetsk et de Lougansk ont ​​lancé une opération militaire en Ukraine fin février après des semaines d’attaques croissantes de bombardements, de tireurs d’élite et de sabotage par les forces de Kiev. La crise sécuritaire est le point culminant d’une calamité qui a commencé en 2014, lorsque les forces soutenues par l’Occident ont renversé le gouvernement ukrainien lors d’un coup d’État.
La situation dans le Donbass est comparable à celle de la Yougoslavie lors des bombardements de l’OTAN en 1999, et la République populaire de Donetsk est prête et ne serait pas surprise par toutes sortes de crimes de guerre commis par les bataillons ultra-nationalistes ukrainiens contre la population civile alors qu’ils se retirent. , a déclaré le chef du DPR, Denis Pushilin.
«Depuis huit ans que nous avons affronté l’agression armée ukrainienne, nous savons tout attendre des bataillons nationalistes. Le régime de Kiev intensifie son terrorisme. Aujourd’hui, à Marioupol et dans d’autres villes, nous voyons l’image réelle de leurs atrocités. Pendant toutes les années de conflit, la même chose s’est produite sur notre terre », a déclaré Pouchiline dans une interview  , commentant les récents rapports sur l’utilisation par les combattants d’Azov de civils comme boucliers humains dans la ville assiégée.
« Ils ont organisé le chaos en toute impunité, se cachant derrière la population civile. Maintenant, ils ne permettent pas à la population civile de quitter les villes. Faisant fi de la vie des gens, ils transforment des maisons, des appartements, des écoles et des jardins d’enfants en postes de tir. Le 5 mars, [ils] ont attaqué des civils quittant Volnovakha. Ils ont ouvert le feu sur des femmes et des enfants. Le colonel Vladimir Zhoga, nom de guerre Vokha, commandant du bataillon de reconnaissance de Sparte, a été mortellement blessé lors de cette attaque », a déclaré Pouchiline.
Les soldats du bataillon Azov prêtent serment à Kiev avant d'être envoyés dans le Donbass - Sputnik International, 1920, 05.03.2022Selon le chef de la DPR : Jusqu’à 200 personnes enterrées sous les décombres alors que les militants d’Azov font exploser un bâtiment à Marioupol,le 5 mars 2022
Les civils vivant sous contrôle ukrainien au cours des huit dernières années ont beaucoup souffert, a déclaré le chef de la RPD.

« Lorsque nous libérons des colonies, nous voyons que les gens là-bas ont vécu une catastrophe humanitaire. Malheureusement, la situation dans le Donbass a beaucoup en commun avec celle de la Serbie lorsqu’elle était bombardée par l’OTAN. Et les mêmes parties intéressées se tiennent derrière ces crimes. C’est le même scénario », a suggéré Pushilin.

« Aujourd’hui, les formations ukrainiennes laissent la destruction et la peur dans leur sillage alors qu’elles se retirent de leurs positions, ne laissant aucune électricité, aucune eau, aucune communication [infrastructure] intacte. Les maisons et les infrastructures sont détruites. Les gens jubilent lorsqu’ils rencontrent la RPD et les forces russes. Nous commençons immédiatement la reconstruction. Les gens ont l’espoir d’une paix rapide et d’un retour à une vie normale », a-t-il déclaré.
L’opération militaire dirigée par la Russie n’est pas venue de nulle part
Les responsables et les médias occidentaux ont passé plus d’une semaine à accuser la Russie et ses alliés du Donbass d’un acte «d’agression» non provoqué et inattendu contre l’Ukraine, suggérant que rien ne justifiait l’opération militaire qui a débuté le 24 février. Pushilin ne partage pas ce point de vue, soulignant la campagne de plusieurs mois pour pomper Kiev avec des armes, des semaines d’escalade militaire et les préparatifs d’un nouvel acte d’agression contre le Donbass.
« À la fin de l’année dernière et au début de cette année, l’Ukraine concentrait ses forces le long de la ligne de contact, tandis que des livraisons massives étaient effectuées à Kiev depuis les États-Unis et les pays de l’OTAN. Bayraktar [drones], missiles antichars Javelin, MANPAD Stinger – la liste est longue. Des tonnes d’armes ont été acheminées vers l’Ukraine et transférées d’urgence dans le Donbass », a déclaré Pushilin.
Cela a été suivi par « des bombardements, une vague d’alertes à la bombe, des provocations, des menaces d’attaques chimiques, ainsi qu’une accumulation d’informations » sur la situation, a-t-il dit, ajoutant que les renseignements de la DPR montraient que Kiev avait fait tous les préparatifs nécessaires pour une Offensive militaire totale dans le Donbass.
Avions de chasse ukrainiens Su-27 (nom OTAN : Flanker-B) - Spoutnik International, 1920, 05.03.2022
Pouchiline a révélé qu’en l’espace de 16 jours d’escalade en février, avant que les forces dirigées par la Russie ne commencent leur opération militaire pour démilitariser l’Ukraine, Kiev a mené près de 800 attaques contre des villes du Donbass, en utilisant tous les calibres d’armes, y compris les armes tactiques Tochka-U. missiles et fusées d’artillerie BM-21 Grad. Ces attaques ont tué 26 civils et blessé 109 autres, dont 7 enfants. 514 maisons et immeubles d’appartements ont été endommagés, ainsi que 198 éléments d’infrastructure civile, dont des hôpitaux, des écoles et des infrastructures essentielles, allant des stations d’électricité et d’eau au gaz, a déclaré Pushilin.
« Dans le même temps, Kiev a délibérément mené le processus de négociation basé sur la plate-forme de Minsk dans une impasse. Cela nous a obligés à prendre des mesures pour protéger la population civile. Avec le chef de la République populaire de Lougansk, Leonid Pasechnik, nous nous sommes tournés vers la Russie pour demander au président Vladimir Poutine de reconnaître les républiques du Donbass et de conclure avec nous des traités d’amitié et de coopération, y compris une coopération dans le domaine de la défense », a-t-il déclaré.
La reconnaissance de Moscou est devenue un point de départ pour des changements que le Donbass attendait « depuis huit longues années », a souligné Pouchiline, ajoutant que les habitants de la RPD et de la RPL « éprouvaient des sentiments de joie et de gratitude » face à la décision de la Russie.
Pouchiline dit que 39 colonies ont été libérées des forces de Kiev au cours de l’opération militaire qui a commencé le 24 février. « Nous devons repousser l’armée ukrainienne et ses armes meurtrières loin de nos villes, afin que les gens puissent enfin vivre dans la paix et le calme », ​​a déclaré le chef de la RPD (République Populaire  du Donesk).

Voir ma dernière vidéo sur Odysee:


Je vous invite à visiter  notre boutique en ligne qui permet de maintenir ce site bien en vie:
Sur ce lien: Vintage par Michel

Troisième Guerre Mondiale en évolution:7 histoires de FAKE NEWS en provenance d’Ukraine

Nous n’en sommes qu’à quelques jours du début de l’opération militaire russe en Ukraine, et pourtant les rouages ​​de la propagande tournent à la vitesse de l’éclair, produisant des « nouvelles », des opinions et du contenu pour le moulin des médias.
Au cours des dernières 48 heures seulement, des dizaines d’histoires, d’images, de récits et de vidéos ont circulé comme étant tirés des combats en Ukraine, dont un pourcentage énorme sont faux.
Maintenant, certaines d’entre elles pourraient être attribuées à des malentendus, à une erreur d’identité, à une mauvaise attribution… mais beaucoup et la plupart sont probablement des tromperies délibérées conçues pour provoquer une réponse. Plongeons dedans.

 

 

1. « LE FANTÔME DE KIEV »

Tôt vendredi matin, il a été signalé qu’un seul avion ukrainien, un MiG-29, patrouillait dans le ciel au-dessus de Kiev. La presse anglophone a appelé le pilote sans nom « The Ghost of Kiev », et a affirmé qu’il avait abattu 6 avions russes en combat air-air en moins de 2 jours, faisant de lui un Fighter Ace officiel, et probablement l’un des plus rapides à jamais gagner ce titre.

Le problème est qu’il n’y a presque aucune preuve que cela s’est produit. Pour citer Newsweek :

Il n’y a aucune preuve que le « fantôme de Kiev » existe ».

Aucune des deux parties ne peut confirmer que la Russie a perdu six avions au total, et encore moins un homme en une seule journée. Et une vidéo supposée être « le fantôme » au combat – partagée par les forces armées ukrainiennes – est confirmée comme étant en fait une séquence tirée d’un jeu vidéo .

Néanmoins, il a déjà sa propre page Wikipédia. Un témoignage de la vitesse à laquelle un mensonge peut se déplacer alors que la vérité met ses bottes.

2. « AVIONS RUSSES SURVOLANT KIEV »

De nombreuses personnes ont partagé une courte vidéo d’avions russes volant à basse altitude au-dessus de la ville de Kiev . Le Times en a utilisé une image dans son article « Les sanctions arrêteront-elles un obus russe ? :

Le problème avec ça, c’est que ce n’est pas Kiev, c’est Moscou. Et ce n’est pas aujourd’hui, c’est il ya deux ans. Il s’agit d’images de ce qui est probablement une répétition pour le survol du défilé du jour de la victoire 2020.

3. « ZELENSKIY VISITE LES TROUPES »

Il est possible qu’aucun politicien de l’histoire n’ait eu une cure de jouvence aussi rapide que Vlodomyr Zelenskiy. La semaine dernière, c’était juste un type, cette semaine, c’est un héros de guerre, on parle de construire des statues de l’homme. Un appel téléphonique (pas du tout mis en scène) « fuité » lui a fait refuser l’offre américaine d’un pont aérien vers la sécurité.

Twitter est parsemé de personnes partageant des photos de lui en tenue de combat, le comparant favorablement à Trump et Trudeau et demandant « quels autres dirigeants combattraient aux côtés de leurs troupes ? »

Mais le problème avec ça, c’est que les photos datent toutes de presque un an, prises lors de sa visite aux troupes en avril dernier :

4. « EXPLOSION DE LA CENTRALE ÉLECTRIQUE DE LOUHANSK »

Au début de la confrontation, cette vidéo a commencé à faire le tour des réseaux sociaux :

La vidéo est devenue virale, recevant 100 000 vues . Des centaines de comptes l’ont partagé, même les principaux réseaux d’information l’ont utilisé, affirmant tous qu’il montre une centrale électrique à Lougansk explosant après avoir été touchée par des missiles russes.

Ce n’est pas le cas, c’est une usine chimique qui explose à Tianjin, en Chine, en 2015 .

5. JEUX VIDÉO. DE NOUVEAU.

Ces images, prétendant montrer les forces terrestres ukrainiennes en train d’abattre des avions russes, sont également devenues virales récemment, apparaissant même aux informations télévisées espagnoles :

…C’est tiré du jeu vidéo ARMA 3 .

6. « VAISSEAU DE GUERRE RUSSE ALLEZ VOUS FAIRE BAISER »

Il s’agissait du premier grand récit de propagande après l’avancée de la Russie sur le territoire ukrainien. Un audio prétendument présenté montrait des gardes-frontières ukrainiens sur la petite île aux serpents dans la mer Noire communiquant avec un navire de guerre russe. Lorsqu’on leur a dit de se rendre, les gardes ont dit « Le navire de guerre russe va te faire foutre » .

La presse occidentale a rapporté que les 13 hommes ont été tués et le gouvernement ukrainien a publié une déclaration disant qu’ils recevront tous des honneurs posthumes.

Cependant, alors que les héros prétendument tombés étaient canonisés dans tout le monde occidental, la Russie rapportait qu’ils n’avaient pas du tout été tués, mais ramenés vivants et sains et saufs sur le continent.

Une histoire que la presse et le gouvernement ukrainien ont depuis admis à contrecœur est probablement vrai.

7. VIDÉOS DE DRONE SYRIEN

Une autre vidéo faisant le tour, et à nouveau partagée par les comptes officiels ukrainiens , était des images de drones montrant soi-disant la destruction d’une colonne de véhicules russes.

Il s’agit en fait d’images d’une frappe de drone turc en Syrie à partir de 2020.

Pendant ce temps, d’autres comptes partageaient des images de combats en Libye ou des bombardements provoqués de Gaza sous le hashtag #StandWithUkraine. Middle East Eye a compilé une liste.

C’est une assez belle ironie que tant de clips provoquent l’indignation des libéraux subis en fait de guerres déclenchées par leurs gouvernements.

*

Voilà, sept histoires sur la guerre en Ukraine qui sont manifestement fausses, et ce n’est que la pointe de l’iceberg.

Il existe des tonnes d’autres contrefaçons, sans parler des contrefaçons conçues pour discréditer les sceptiques ou simplement semer le chaos.

En fin de compte, tout cela est un rappel opportun que la propagande est à son plus puissant à des moments où les nouvelles vont vite et où les gens se sentent émotifs.

C’est POURQUOI les médias attisent la peur, l’anxiété et la haine, parce que les personnes dans cet état émotionnel sont moins susceptibles de penser de manière critique.

Il va sans dire que cela est également vrai des deux côtés. Nous ne pouvons pas accepter aveuglément les revendications de la partie russe, simplement parce que nous connaissons les mensonges de l’OTAN. Les deux côtés font de la propagande, et le scepticisme borgne n’est qu’un autre type de parti pris.

En bref, si vous voyez quelque chose conçu pour provoquer une réaction émotionnelle, ne le laissez pas faire. Ne vous laissez jamais emporter par le récit, retenez-vous toujours, restez calme et posez des questions rationnelles.

Ne croyez pas, exigez des faits. C’est le seul moyen de garder l’esprit libre.

Ou, pour citer HL Mencken :

Ne croyez jamais ce que vous entendez, et seulement la moitié de ce que vous voyez.

Source :  Algora Blog | February 27, 2022

 

 

 

 

 

 

 

 

 

 

 


JE VOUS INVITE À NOUS SOUTENIR EN VISITANT NOTRE BOUTIQUE EN LIGNE

Sur ce lien: VintageparMichel