La Criminelle Arnaque du COVID 19:Suite à la découverte d’un insecte dans un flacon, Moderna retire près de 800 000 doses de vaccin

Un moustique a été découvert à l’intérieur d’un flacon dans un centre de vaccination de Malaga, en Espagne. Invoquant la « présence d’un corps étranger », l’Agence espagnole des médicaments et des produits de santé (AEMPS) a annoncé le retrait, le 8 avril, de lots du vaccin Moderna, rapporte le quotidien El Pais. Le laboratoire Moderna a dû procéder au rappel de 764 900 doses de vaccin.

Le lot dont était issu le flacon avait été produit dans une usine située à San Sebastian de los Reyes, près de Madrid, où sont réalisés le remplissage des flacons et leur conditionnement. Le contenant est, lui, produit en Suisse.

Moderna fait face à un autre problème : depuis la mi-janvier 2022, les fioles ont été distribuées dans plusieurs pays en dehors de l’Espagne : la Norvège, la Suède, la Pologne et le Portugal. Tous sont concernés par le rappel annoncé par le laboratoire. Les autorités norvégiennes sont d’ailleurs à l’origine du dévoilement de la raison de ce retrait.

Pour autant, le laboratoire a voulu se montrer rassurant en publiant un communiqué commun avec l’entreprise responsable de la fabrication (Rovi) : « Le flacon impacté […] n’a pas été administré », assurent-ils, ajoutant qu’une enquête est en cours. Moderna soutient par ailleurs qu’« aucun problème de sécurité n’a été signalé chez les personnes ayant reçu un vaccin […] de ce lot », faisant valoir les 900 millions de doses de leur vaccin injectées à travers le monde.


EN COMPLÉMENTAIRE

Au Japon,en 2021, Moderna était contraint de retirer 1,63 million de doses de vaccins

Août 2021-Le Japon a retiré du marché 1,63 million de doses du vaccin Moderna après qu’une alerte venue de plusieurs centres de vaccination a signalé des lots contenant des impuretés. Après consultation avec le ministère de la Santé japonais, le groupe pharmaceutique nippon Takeda qui distribue le vaccin au Japon a décidé de suspendre l’utilisation des doses et demandé à Moderna de mener l’enquête.

La production du vaccin Moderna s’inscrit dans une longue chaîne de fabrication, une chose qui ne lui est pas propre puisque tous les fabricants de vaccins ont fait appel à des sous-traitants pour produire en quantité et répondre le plus rapidement possible à une demande mondiale très élevée.

Concernant le vaccin Moderna et les lots défectueux japonais, le principe actif composé d’ARN messager est fabriqué en Suisse tandis que son conditionnement est sous-traité en Espagne, près de Madrid par la société Rovi. Le problème viendrait du conditionnement et la société Rovi aurait, selon le quotidien El Pais « reconnu dans une lettre que le problème a pu survenir dans une de ses lignes de production et qu’il ne concerne qu’un lot, bien que les autres lots soient analysés à titre préventif ».

Ce problème sanitaire vient s’ajouter à une situation sanitaire déjà critique dans un pays, qui malgré le programme de vaccination de masse mis en place depuis mai, connaît un taux d’infections record depuis l’arrivée du variant Delta, plus contagieux.


une plainte pour crime d’empoisonnement déposée au Tribunal judiciaire de Paris

 

Une plainte criminelle contre X pour crime contre l’humanité, empoisonnement et tentative d’empoisonnement, rédigée par un collectif de juristes et d’avocats, est envoyée cette semaine au Tribunal judiciaire de Paris par l’association BonSens.org, l’Association internationale pour une médecine scientifique indépendante et bienveillante (AIMSIB) et des citoyens victimes d’effets secondaires des vaccins contre le Covid-19.

Au cours des dernières semaines, la campagne présidentielle et la guerre en Ukraine ont subitement puis totalement pris le pas sur la politique sanitaire du gouvernement, qui avait envahi nuit et jour l’espace médiatique au cours des deux dernières années. Marquée par l’obligation indirecte de prendre un vaccin à l’efficacité contestée et aux effets secondaires de plus en plus avérés (Voir : Le Sénat à l’écoute des victimes présumées d’effets secondaires graves du vaccin et « Il y a une volonté de ne pas savoir » : le collectif « Où est mon cycle » au Parlement européen), la crise du Covid-19 a jeté le doute sinon franchement mis en cause dans les esprits des Français, la probité de l’action du gouvernement et de son chef. Dernièrement, les affaires McKinsey et du Rothschild Gate sont venus renforcer au sein de la population ce sentiment de dichotomie entre l’intérêt général et les intérêts privés de la caste dirigeante. C’est pourquoi des associations poursuivent, malgré les embûches, la bataille judiciaire en vue d’obtenir au pénal réparation pour les victimes des conséquences de la politique vaccinale. C’est dans ce cadre que nous avons interviewé Maître Jean-Pierre Joseph, avocat au barreau de Grenoble, qui représente les plaignants.

Pourraient être impliqués, et par la suite, mis en examen : Jean Castex, Premier ministre ; Edouard Philippe, ancien Premier ministre ; Olivier Véran, ministre des Solidarités et de la Santé ; Frédérique Vidal, ministre déléguée à l’Enseignement supérieur et à la Recherche et membre de la « task force » vaccin ; Agnès Pannier-Runacher, ministre déléguée à l’Industrie, responsable de la « task force » vaccin ; Jérôme Salomon, directeur général de la santé ; Alain Fischer, coordonnateur de la stratégie vaccinale de l’État ; Louis-Charles Viossat, ancien responsable de la « task force » interministérielle vaccination Covid-19  ; Laetitia Buffet, responsable de la « task force » interministérielle vaccination covid-19  ; Bernard Celli, responsable de la « task force » interministérielle vaccination Covid-19  ; Patrick Bouet, président du Conseil national de l’Ordre des médecins.

close
volume_off

Les membres du conseil scientifique constitué à titre de l’urgence sanitaire en application de la loi n°2020-290 du 23 mars 2020 d’urgence pour faire face à l’épidémie de Covid-19 (ci-après conseil scientifique, créé par le décret du 3 avril 2020) : Jean-François Delfraissy, président du Conseil scientifique Covid-19 ; Laetitia Atlani-Duault, anthropologue ; Daniel Benamouzig, sociologue ; Lila Bouadma, réanimatrice ; Simon Cauchemez, modélisateur ; Catherine Chirouze, infectiologue ; Angèle Consoli, pédopsychiatre ; Pierre Louis Druais, médecine de ville ; Arnaud Fontanet, épidémiologiste ; Marie-Aleth Grard, milieu associatif ; Olivier Guérin, gériatre ; Aymeril Hoang, spécialiste des nouvelles technologies ; Bruno Lina, virologue ; Denis Malvy, infectiologue ; Yazdan Yazdanpanah, infectiologue ; la Haute Autorité de santé (HAS) ; Dominique Le Guludec, directrice générale de la HAS ; l’Agence nationale de sécurité du médicament (ANSM) ; Christelle Ratignier-Carbonneil, directrice générale de l’ANSM ; l’Agence européenne du médicament ; Emer Cooke, directrice de l’Agence européenne du médicament ; la Commission européenne ; Ursula van der Leyen, présidente de la Commission européenne ; la société Pfizer SAS ; Henriette Rosenquist, présidente de la société Pfizer SAS ; Franck Le Breguero, pharmacien responsable et directeur général de la société Pfizer SAS ; la société Pfizer Holding ; Florence Petelet, gérante de la société Pfizer Holding ; Marie-Gabrielle Laborde-Rayna, pharmacien responsable et gérante non-associée de la société Pfizer Holding ; la société Pfizer inc. ; Albert Bourla, PDG de la société Pfizer inc. ; la société BioNtech AG ; Helmut Jeggle, président de la société BioNtech AG.

Et toutes autres personnes à déterminer.

FranceSoir : Me Joseph, quel est l’intérêt de cette plainte pour les victimes des conséquences des injections ?

Me Joseph : Pour les victimes et les proches de victimes, l’intérêt est double. D’une part, il est de se voir reconnues comme victimes d’un acte que le juge qualifiera, mais qui, selon les plaignants, réunit les conditions du crime d’empoisonnement.

Ainsi, les fabricants doivent répondre des substances qu’ils ont conçues et mises sur le marché, nous y reviendrons. Les ministres en charge et les différentes agences et commissions qui sont intervenues pour administrer ces substances aux Français (HAS, ANSM, Conseil scientifique) engagent également leur responsabilité. Tout comme la Commission européenne, sa présidente et l’Agence européenne du médicament, ils ne pouvaient ignorer que tout indiquait, avant leur mise sur le marché, qu’elles étaient mal évaluées, donc potentiellement dangereuses. Ceci, d’autant plus que depuis près d’un an, de nombreux scientifiques les en informent et que de nombreux citoyens ont attiré leur attention sur une des dispositions du contrat signé entre la Commission européenne et Pfizer, précisant (p. 48 et 49) que les parties au contrat reconnaissent ignorer l’efficacité et les effets indésirables du « vaccin » et trouvent étranges que ces « vaccins » ne protègent soi-disant que pendant 4 mois, n’empêchent pas de contracter la maladie et rendent les « vaccinés » potentiellement contagieux, ce qui a justifié que l’on oblige pendant plusieurs mois, les « vaccinés » à porter le masque, qui reste obligatoire, même pour eux, dans les transports.

J’ajouterai qu’à un tel niveau de responsabilité, il est impossible de se prévaloir de son ignorance, surtout si, au lieu de vérifier ce que leur expliquaient de nombreux médecins, biologistes, virologues, statisticiens de renommée internationale, ils ont dénigré ces derniers, se campant dans une certitude méprisante et suffisante, les qualifiant de « complotistes », plutôt que de « lanceurs d’alerte ». Dans ce cas, les responsables publics sont tenus de s’informer de la façon la plus précise, surtout s’agissant de la santé de la population. Si, malgré tout, on ne sait pas, le simple bon sens ou même l’application du principe de précaution doivent conduire à ne pas faire prendre un risque aussi inconsidéré aux Français, femmes enceintes et enfants compris, pour une maladie dont on sait qu’elle tue peu, qu’elle tue essentiellement les personnes les plus âgées et, surtout, que de nombreux traitements existent pour la combattre. Malheureusement, tous les traitements prescrits par des médecins, faisaient l’objet de poursuites de la part du Conseil de l’Ordre pour qui « Il n’y avait pas de traitement… »

D’autre part, les victimes, fortes de la faute pénale ainsi reconnue pourront se tourner vers les responsables et, singulièrement les fabricants, pour voir les préjudices qu’ils ont subis indemnisés. Ces derniers espéraient probablement, de ce que l’on sait des contrats d’achat avec la Commission européenne, échapper à leur responsabilité civile en incluant dans ces contrats des clauses exonératoires. En d’autres termes, les fabricants et la Commission européenne, représentée par sa présidente, Ursula von der Leyen, auraient convenu que ni la Commission ni les États membres ne pourraient se retourner contre les fabricants.

La loi du 25 juillet 2021 sur la gestion de la crise sanitaire a d’ailleurs choisi d’intégrer la vaccination contre le Covid-19 au dispositif de l’Office national d’indemnisation des accidents médicaux, des affections iatrogènes et des infections nosocomiales (ONIAM), qui propose une indemnisation amiable des victimes d’accidents médicaux et se charge, le cas échéant, de poursuivre le responsable en remboursement. Mais cela signifie aussi que, s’agissant d’une procédure amiable, l’intégralité des préjudices ne sera pas réparée. Et, surtout, l’indemnisation des victimes relèvera de la Solidarité nationale. Si ce financement est, en soi, défendable, il l’est moins dans le contexte actuel.

En effet, le contribuable qui aura financé la recherche, avec les fonds d’urgences attribués par la Commission européenne aux fabricants, puis l’achat de ces substances doit maintenant assumer l’indemnisation des conséquences des injections… Pendant le même temps, le groupe Pfizer, par exemple, annonce un chiffre d’affaires, pour 2021, de 81,3 milliards de dollars, en augmentation de 95% par rapport à l’année précédente et un bénéfice record de 22 milliards de dollars.

Toutefois, on peut penser que la reconnaissance par la justice de la faute pénale des fabricants permettra, ensuite, aux victimes de se retourner directement contre eux pour obtenir l’indemnisation de leur préjudice, puisque la voie de l’ONIAM n’est qu’optionnelle et ne ferme pas la voie juridictionnelle aux victimes.

Cette plainte peut être téléchargée en fin d’article afin d’être communiquée par les victimes à leurs avocats.

FS : En quoi consiste l’empoisonnement qui fait l’objet de cette plainte ?

JPJ : Dans cette affaire, l’empoisonnement, qui est un crime consistant à donner la mort par administration d’une substance mortelle, prend plusieurs formes.

D’abord, le professeur Jean-Michel Claverie, professeur émérite de médecine, PU-PH de l’université d’Aix-Marseille, a récemment évalué la quantité d’ARNm de la protéine Spike qui pénètre le corps humain à chaque injection de l’une des substances géniques expérimentales, abusivement nommées « vaccin ». Il est parvenu à la conclusion suivante :

– Une dose du produit Pfizer délivre autant d’ARNm de la protéine Spike que ce qui est contenu dans 6,75 m³ de fluide nasal infecté par le virus.
– Le même constat peut être fait à propos du produit Moderna, qui délivre autant d’ARNm de la protéine Spike que ce qui est contenu dans 23 m³ de fluide nasal infecté par le virus.

Le professeur Claverie évoque une quantité « véritablement astronomique » d’ARNm de la protéine Spike ainsi injectée dans le corps humain.

Une de ses conclusions est que « l’injection de ces vaccins ne mime absolument pas le processus d’infection naturel par le SARS-CoV2, mais constitue une modification locale de la concentration en ARNm totalement non-physiologique pour les cellules qui l’incorporent. Même au cours d’une infection virale très virulente, on estime que le nombre de molécules d’ARN messager ne dépasse pas une centaine d’exemplaires par cellule infectée, pour les gènes viraux les plus fortement exprimés ».

L’inquiétude augmente encore lorsqu’on lit, toujours d’après le professeur Claverie, que ces produits contiennent des « impuretés totalement inattendues ».

Ainsi, « une publication récente, par le laboratoire Moderna lui-même, décrit la présence d’impuretés totalement inattendues dans le principe actif même du vaccin, dans lequel une partie de l’ARNm injecté est modifiée par une réaction chimique avec l’enveloppe lipidique des nanoparticules chargées de le véhiculer à l’intérieur des cellules. S’agissant d’une modification chimique inconnue à ce jour, dont la toxicité éventuelle n’a pas été évaluée, cette découverte aurait dû poser la question de la suspension éventuelle de l’autorisation conditionnelle de mise sur le marché, ce qui n’a pas été fait. La même modification chimique a probablement lieu également dans le vaccin BNT-162b2 de BioNTech/Pfizer (dont la composition est proche de celle de la préparation de Moderna), mais à ma connaissance, aucune vérification n’a été publiée ».

Le rapport du professeur Claverie est en téléchargement avec la plainte, au pied de l’article.

Ensuite, et c’est une information particulièrement inquiétante révélée par des travaux de recherche de mai 2021, confirmés en février 2022 : les cellules humaines auraient la capacité de transformer l’ARNm des substances géniques expérimentales en ADN et, donc, de l’intégrer à leur propre génome, entraînant des modifications du génome humain. Bien entendu, les conséquences de telles modifications, qui auront nécessairement des effets sur la descendance des personnes concernées, sont à ce jour totalement imprévisibles.

Cette découverte est d’autant plus choquante que le mécanisme de la transcriptase inverse (qui permet la transformation d’un ARNm en ADN) au sein des cellules humaines est connu depuis 1970. Les derniers travaux de 2021 et de 2022 ne font que confirmer la possibilité d’intégration de l’information délivrée par l’ARNm vaccinal injecté, dans le génome humain. Il n’y a donc plus de doute possible : les substances géniques expérimentales peuvent modifier, voire endommager le génome humain.

Que doit-on penser, lorsque le professeur Claverie ajoute que « la possibilité d’une intégration génomique, longtemps considérée comme improbable vient d’être démontrée (…) avec des quantités expérimentales d’ARNm largement inférieures à celles (…) découvertes dans les injections ARNm » ? On ne peut qu’en déduire que le risque de modification du génome est d’autant plus considérable, vu les quantités injectées aux Français.

Enfin, les travaux de Christine Cotton, biostatisticienne pour l’industrie pharmaceutique pendant 23 ans, ont révélé un autre fait scandaleux. Les essais cliniques préalables comportent d’importants biais méthodologiques, rendant peu fiables les conclusions d’efficacité. Il apparaît également que la baisse de l’immunité et les effets secondaires potentiellement dangereux pouvaient être anticipés. Ces faits étaient connus des fabricants, tout comme les autorités européennes et françaises au moment de l’autorisation en vie réelle.

Malheureusement, les chiffres vertigineux des décès et des blessures consécutifs à l’injection provenant des organismes de pharmacovigilance des pays concernés sont la preuve de cette désinvolture criminelle.

Par ailleurs, avec maintenant une année de recul, les chercheurs observent, dans tous les pays qui ont eu recours aux injections, une surmortalité inexpliquée, spécialement marquée chez les personnes de 15 à 44 ans. Or, la courbe de la surmortalité épouse parfaitement celle des campagnes vaccinales. La corrélation est telle que l’hypothèse d’une surmortalité de la population due à la vaccination est désormais avancée.

Ces éléments sont d’une extrême gravité, puisqu’ils touchent à la santé des Français, mais aussi à celle des enfants à naître, pour les femmes enceintes qui auraient reçu l’injection, et à l’espèce humaine, elle-même, dont le génome pourrait être modifié de façon aléatoire, inconnue et incontrôlée. Or, les autorités françaises ne peuvent ignorer les informations que je viens d’exposer et qui sont consignées dans la plainte.

Pourtant, les campagnes de vaccination se poursuivent aveuglément. Le chantage à l’emploi continue, la ségrégation et la discrimination sont toujours d’actualité (on rappellera qu’un passe sanitaire est toujours exigé pour entrer à l’hôpital), les menaces et les insultes ne sont qu’en sourdine. Doit-on rappeler que de nombreux responsables publics et personnalités médiatiques n’ont pas été en reste pour proférer insultes et menaces publiques contre les personnes non-injectées. Ainsi, Laurent Alexandre ou Gilbert Deray voient en elles « des criminels », à qui, renchérissent Christian Estrosi ou François Sauvadet, il faut supprimer chômage et aides sociales. Olivier Véran impute lui, sans autre procès, la responsabilité du Covid dans un Ehpad à une soignante non-injectée. Emmanuel Lechypre déclare vouloir les faire « emmener de force par des policiers », tandis que Gabriel Attal n’y voit qu’une « frange capricieuse », à qui le gouvernement promet une « vie de merde ». Dans cette ambiance délétère, CNews a dû trouver vendeur de titrer « Antivax : comment s’en débarrasser ? »

C’est pourquoi, face à des constats aussi alarmants, BonSens.org, l’AIMSIB et les autres plaignants ont décidé de déposer une plainte criminelle pour les chefs d’accusation d’empoisonnement, de complicité d’empoisonnement et de crime contre l’humanité contre tous ceux qui ont incité ou forcé, selon les cas, les Français à se faire injecter une substance, toujours au stade de l’essai clinique, mal évaluée, dont la dangerosité pouvait être anticipée et qui continue à tuer et à blesser chaque jour. Il s’agit donc d’actes criminels.

FS : Pensez-vous que les faits soient suffisamment graves pour que l’on puisse parler de crime contre l’humanité ?

JPJ : Oui. Le crime contre l’humanité est rarement invoqué devant les juridictions françaises. Il l’a été pour des crimes commis sous l’occupation nazie (Touvier, Barbie) ou pour des crimes commis à l’étranger pour lesquels la juridiction française est compétente (par exemple, le juge pénal peut poursuivre les crimes commis au Rwanda et en ex-Yougoslavie, si les responsables vivent en France).

Cependant, les faits sont là et les qualifications pénales également. Or, il ne fait pas de doute que la campagne de vaccination que nous subissons, relève de la définition du crime contre l’humanité, spécialement maintenant qu’on en mesure mieux les conséquences psychologiques, sociales, économiques et en termes de santé.

Ce qu’il importe de comprendre, c’est que le crime contre l’humanité, ce ne sont pas seulement des actes criminels isolés (forcer les Français à se faire injecter une substance potentiellement mortelle). Ce sont des actes criminels, commis de façon coordonnée par un groupe criminel, contre une population ou un groupe de population, inscrits dans un plan exécuté au nom d’un « État pratiquant une politique d’hégémonie idéologique », pour reprendre les termes de la Cour de cassation.

Ces actes, et c’est ce qui caractérise un crime aussi terrible que le crime contre l’humanité, dépassent la simple intention de tuer. Ils visent à déshumaniser les victimes, à nier leur nature humaine, à les rejeter en dehors de la communauté des Hommes, ceci, pour des motifs purement idéologiques.

Or, nous sommes bien, avec « l’idéologie vaccinale » actuelle, dans le cadre d’une politique d’hégémonie idéologique. En effet, la finalité des politiques discriminatoires, de ségrégation, de persécution et, finalement, d’empoisonnement, pratiquées depuis plus de deux ans est bien de dénier leur humanité aux personnes réfractaires. Elle a, d’ailleurs, trouvé sa synthèse dans les propos du président de la République, selon lequel, un « irresponsable », ce terme désignant une personne non-injectée, « n’est plus un citoyen ».

Comment mieux dire qu’il s’agit de retirer à cette partie de la population ce qui est le plus intimement attaché à sa personne, au sens juridique comme au sens politique : sa citoyenneté, son appartenance à la nation française, laquelle constitue son identité et, non, un artefact dont on pourrait se débarrasser. Porter atteinte à la qualité de citoyen revient ainsi à porter atteinte à la personne même, dans son identité et dans sa dignité. On rappellera, à cet égard, dans un domaine très proche, que la perte de nationalité est une sanction infamante, réservée à certaines infractions particulièrement graves.

Il y a pire encore. Nous savons désormais que les substances géniques expérimentales pourront avoir des effets sur la descendance des personnes injectées dont l’ADN aura été endommagé. En d’autres termes, les faits que dénoncent les plaignants sont, non seulement une attaque généralisée et systématique contre une population, pour reprendre les termes du code pénal, mais ils constituent également une attaque contre l’espèce humaine, elle-même, dès lors qu’existe la possibilité de modification du génome humain.

FS : Cette plainte intervient dans un contexte particulier ?

JPJ : En effet. La question des effets indésirables de ces substances a, enfin, été saisie par le Parlement, dont l’Office parlementaire d’évaluation des choix scientifiques et technologiques (Opecst) a été chargé, selon son vice-président, Gérard Longuet, de « rassembl(er) les éléments techniques et scientifiques sur les effets du vaccin ».

On remarquera d’emblée que la création de cette commission d’enquête est due à l’initiative des citoyens et non à celle des parlementaires ou d’autres responsables publics. C’est ainsi une pétition citoyenne, déposée par le docteur Devilleger, cardiologue, sur le site du Sénat qui, ayant recueilli plus de 33 600 signatures en quelques semaines, a incité les sénateurs à saisir l’Opecst. Ainsi, « constatant la forte dynamique des signatures », le Sénat « a décidé d’y donner suite sans attendre » pour « répondre aux inquiétudes qui s’expriment ». Le cycle d’auditions, qui a débuté le 28 mars, est prévu pour durer trois mois. Souhaitons que, comme l’annonce Gérard Longuet, les parlementaires « prendront (leurs) responsabilités » sur une question aussi importante pour les Français.

Par ailleurs, un colloque scientifique international s’est tenu à l’Institut hospitalo-universitaire Méditerranée, dirigé par le Pr Didier Raoult, les 30 et le 31 mars dernier et à Massy, les 1er et 2 avril, l’International Covid Summit (ICS), intitulé « Covid-19, premier bilan des connaissances et controverses scientifiques », qui a réuni de nombreux experts du monde entier. La science progresse donc, envers et contre tout a-t-on envie de dire, sur la maladie, son traitement et sur les effets des « vaccins ».

Dans ce sens, on ne peut qu’espérer que l’épisode dramatique que nous vivons nous ramènera à ce qu’est la science : le doute, la controverse, la remise en question. Lorsqu’on entre dans le monde des certitudes, comme nous l’observons avec le tout vaccinal que l’on tente d’imposer aux Français, on est dans l’idéologie, plus dans la science. Malmener la science, l’instrumentaliser ne peut, l’histoire nous l’avait pourtant déjà enseigné, que mener à des catastrophes, telle celle que nous expérimentons. Et, face à l’incurie, pour le moins, de nos responsables politiques, sourds aux souffrances que leurs politiques ont créées, la seule arme qui reste au citoyen pour mettre un terme à cette situation et pour rendre justice aux victimes, est la juridiction pénale. Nous ne doutons pas de la diligence du juge pénal, car, dans le droit humaniste qui était le nôtre avant la crise sanitaire, de tels actes sont des crimes.

La plainte avec ses pièces peut être téléchargée sur ce lien :
Télécharger la plainte

Télécharger les annexes


VISITEZ NOS BOUTIQUES EN LIGNE POUR DE MAGNIFIQUES CADEAUX:

Sur ces liens: Vintage par Michel sur Etsy

                          Vintage par Michel sur E Bay

 

La Criminelle Arnaque du COVID-19:Des preuves biochimiques et statistiques officielles confirment à 100 % que Moderna a créé le Covid-19

1) Lorsque  Kadhafi avait annoncé dans les années 60, en parlant des Américains, « ils fabriqueront des médicaments, et pour vous les fourguer, ils fabriqueront les maladies qui vont avec »; les « experts » l’avaient traité de « fou ». Les mêmes qui traitent aujourd’hui Poutine de fou.
2) Les Big Pharma (Pfizer, Moderna, J&J, etc.) ont sorti leur vaccin Covid en quelques mois, alors qu’habituellement il faut au moins 10 ans, prouve qu’ils étaient tous « au parfum »  de l’arnaque covid qui se préparait chez Moderna.
3) Dès le début de cette pseudo pandémie, nous avons été parmi les premiers à dénoncer cette arnaque et à affirmer que cette « maladie » est artificielle et qu’elle était conçue dans les labos de l’Oncle Sam.  H. Genséric

Des preuves sont apparues prouvant au-delà de tout doute raisonnable que le géant pharmaceutique Moderna, la société qui a gagné des milliards grâce à la vente d’une injection expérimentale appelée vaccin de Covid-19, a en fait créé le virus Covid-19.

Le 23 février, le Daily Mail a publié un article montrant que Moderna avait breveté la séquence de 19 lettres de base (nucléotides) qui code pour le site Furin Cleavage dans Covid-19. 

Il a cité un article rédigé par des scientifiques en Inde, en Suisse, en Italie et aux États-Unis ( avec prudence intitulé : MSH3 Homology and Potential Recombination Link to SARS-CoV-2 Furin Cleavage Site ) dans lequel ils ont calculé que les chances d’une séquence de 19 nucléotides, brevetée par Moderna, apparaissant au hasard dans Covid-19 , dans des circonstances où il n’apparaît nulle part ailleurs dans la nature sont de 1 sur 3 milliards [1].

Mais ils n’ont pas réussi à en tirer la déduction évidente. S’ils avaient fait cette déduction évidente, je crains que cela n’ait été la dernière déduction scientifique qu’ils aient jamais publiée !

Ils ont décidé d’enquêter sur la séquence d’ARN du site de clivage de la furine dans la protéine de pointe Covid-19 pour voir si cela se produisait ailleurs dans la nature. .

Heureusement, le NCBI/NIH a produit la merveilleuse base de données BLAST qui répertorie toutes les séquences de gènes dans la nature connues de l’homme et toutes les séquences de gènes synthétiques brevetées connues de l’office des brevets.

Les chercheurs ont choisi la séquence Furin Cleavage car il s’agit de la seule séquence continue de lettres de gène (séquence de nucléotides) dans Covid-19 avec plus de 3 nucléotides, qui diffère des lettres respectives dans son parent naturel le plus proche, le Bat Coronavirus RaTG13 (toutes les autres différences sont 3 lettres ou moins). C’était donc de loin le meilleur candidat pour déterminer si le Covid-19 était ou non créé par l’homme.

 

De plus, le site de clivage de la furine est la clé de la pathogénicité de Covid-19 . Donc, s’il devait y avoir un gain de fonction créé par l’homme inclus dans le virus, c’est là que l’on pourrait s’attendre à le trouver.

La séquence d’acides aminés du site de clivage de la furine est PRRA (Proline Argenine Argenine Alanine). Chaque acide aminé est codé par un codon composé de 3 nucléotides (lettres de séquence génétique). Ainsi, toutes les différences dans le code génétique entre Covid-19 et RaTG13 sont au plus long d’un codon, d’un acide aminé, autre que la séquence de clivage de la furine, qui est…

CCT CGG CGG GCA

La séquence complémentaire (le brin d’ADN opposé de la double hélice est (GGAGCCGCCCGT) car C se lie à G et A se lie à T

Le compliment inverse (la même chose écrite à l’envers) est donc TGCCCGCCGAGG

Les chercheurs ont effectué une recherche d’alignement BLAST (Basic Local Alignment Search Tool) (ce qui signifie qu’ils recherchent la séquence du gène, la séquence du gène inverse, la séquence du gène complémentaire et la séquence du gène complémentaire inverse) à travers chaque séquence de gènes dans la nature connue de l’homme depuis CTCCTCGGCGGGCACGTAG qui est la séquence de 19 nucléotides contenant la séquence de clivage de la furine, qui apparaît également dans Covid-19, et qui se trouve en fait sous la forme de complément inverse CTACGTGCCCCGCCGAGGAG brevetée par Moderna.

Leurs résultats de recherche peuvent être trouvés ici . 

Le tableau 1 montre qu’il existe bien dans les 5 brevets américains cités ci-dessous…

US9149506B2 : Polynucléotides modifiés codant pour la septine-4 – https://patents.google.com/patent/US9149506B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618953P
2013-12-16 Demande déposée par Moderna Therapeutics Inc
2014-05-22 Publication de US20140141067A1
2015-10-06 Publication de US9149506B2
2015-10-06 Demande accordée
2020-01-10 Premier litige familial mondial déposé

US9216205B2 : Polynucléotides modifiés codant pour la granulysine – https:// patents.google.com/patent/US9216205B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618873P
2013-12-16 Demande déposée par Moderna Therapeutics Inc
2014-04-24 Publication de US20140113960A1 2015-12-22
Publication de US9216205B2 2015-12-22
Demande accordée

SIAH encodant la polynucléotide E3subitine modifiée protéine ligase 1 – https://patents.google.com/patent/US9255129B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618868P
2013-12-16 Demande déposée par Moderna Therapeutics Inc
2014-05-22 Publication de US20140141068A1
2016-02-09 Demande accordée
2016-02-09 Publication de US9255129B2

US9301993B2 : Modified polynucleotides coding apoptosis inducing factor 1 – https://patents.google.com/patent/US9301993B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Mandataire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618957P
2013-12- 16 Demande déposée par Moderna Therapeutics Inc
2014-04-17 Publication de US20140107189A1
2016-04-05 Demande accordée
2016-04-05 Publication de US9301993B2
2020-01-10 Premier litige familial mondial déposé

US9587003B2 : Polynucléotides modifiés pour la production de protéines et de peptides liés à l’oncologie – https://patents.google.com/patent/US9587003B2/en 

Inventeur : Stephane Bancel, Tirtha Chakraborty, Antonin de Fougerolles, Sayda M. Elbashir, Matthias John, Atanu Roy, Susan Whoriskey, Kristy M. Wood, Paul Hatala, Jason P. Schrum, Kenechi Ejebe, Jeff Lynn Ellsworth, Justin Guild

Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618868P
2016-02-04 Demande déposée par ModernaTx Inc
2016-06-02 Publication de US20160152678A1
2017-03-07 Publication de US9587003B2
2017-03-07 Demande accordée

Ainsi, Moderna a déposé une première demande de brevet pour la séquence de 19 nucléotides en 2013 le 16 décembre. Peut-être que le 25 décembre aurait été plus approprié puisqu’il était destiné à devenir la couronne d’épines de Mathew27, Mark15 et John19.

Tableau 2 : montre que la séquence se produit dans Covid-19 du nucléotide 23601 à 23619.

Tableau 3 : montre que cette séquence de gène n’existe pas dans la nature (mais 14 parties nucléotidiques de celle-ci existent). 

J’ai décidé de vérifier leur travail. Oui. Je les ai effectivement vérifiés (j’enverrai une facture aux mondialistes). Cela s’est avéré être un voyage un peu épique. La page de brevet Google pour US9587003B2 ne contient pas la séquence du gène. Le pdf du brevet ne contient pas la séquence du gène et n’est pas consultable à partir des pages 101-304. Mais il a un lien vers une longue section « Liste des séquences » que l’on ne peut pas copier. Je l’ai donc transcrit manuellement de ma main juste –  http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US09587003B2 

À partir de cette page, vous pouvez entrer l’ID de séquence cité dans l’article sous la forme 11652 et accéder à https://seqdata.uspto.gov/?pageRequest=viewSequence&DocID=US09587003B2&seqID=11652 qui a ce qui suit aux nucléotides 2751-2733 en lisant à l’envers…

gccctgatca ccatcatggc ccagatcggc ag ctacgtgc ccgccgagga g gccaccatc 2760

CTACGTGCCCCGCCGAGGAG breveté par Moderna est le complément inverse de CTCCTCGGCGGGCACGTAG, la séquence de 19 nucléotides qui apparaît dans l’ADN de Covid-19 à partir du nucléotide 23601-23619 (qui serait donc couvert par leur brevet).

De même, vous pouvez rechercher la séquence dans US9149506B2 en allant sur https://seqdata.uspto.gov/?pageRequest=viewSequence&DocID=US09149506B2&seqID=11652 , après quoi vous retrouverez la même chose

gccctgatca ccatcatggc ccagatcggc ag ctacgtgc ccgccgagga g gccaccatc 2760

J’ai ensuite recherché la séquence génétique de Wuhan Hu1 (alpha) sur https://www.ncbi.nlm.nih.gov/nuccore/NC_045512 et j’ai trouvé 

23581 ttatcagact cagactaatt ct cctcggcg ggcacgtag t gtagctagtc aatccatcat de https://www.ncbi.nlm.nih.gov/nuccore/NC_045512 

Qui a la séquence de 19 nucléotides CTCCTCGGCGGGCACGTAG de 23601-23619 comme décrit dans le tableau 3. 

J’ai ensuite effectué ma propre recherche par explosion non alignée de toutes les séquences de gènes brevetées pour le compliment inverse directement (ou peut-être pour un compliment inversé) et j’ai obtenu les mêmes résultats que les chercheurs. 

Et pareil pour les 3 autres brevets américains.

Je peux donc confirmer, et le lecteur peut confirmer en utilisant les liens ci-dessus, que Moderna a demandé un brevet non seulement sur le complément inverse du site de clivage de la furine à 12 nucléotides dans Covid-19, mais en fait sur la séquence de 19 nucléotides le contenant comme décrit au dessus.

De plus, ils n’ont pas simplement déposé une demande de brevet le 4 février 2016 avec US9587003B2 : comme le rapporte le Daily Mail. Ils ont effectivement déposé le 16 décembre 2013 pour 4 brevets avec US9149506B2, US9216205B2, US9255129B2, US9301993B2 : également.

Ainsi, Moderna avait développé la séquence de gènes de 19 nucléotides contenant le site de clivage de la furine qui donne à Covid19 son infectivité pour l’homme grâce à une recherche brevetée sur le gain de fonction dès 2013, 6 ans avant l’épidémie de Wuhan. Pas 3 comme rapporté dans le Mail et viralement ailleurs.. 

Alors maintenant, nous examinons les chances que cela se produise naturellement. L’article calcule la probabilité que cette séquence particulière de 19 nucléotides se produise de manière aléatoire dans un virus de 30 000 nucléotides comme

(30 000-18) × (1/4) 19   = 1,09 × 10 -7

Ce qui est correct car il y a 30 000 à 18 places pour commencer la séquence étant donné qu’il faut encore 18 lettres supplémentaires pour la compléter. Mais il y a en fait 29 904 nucléotides dans Wuhan HU1 (alpha). Un calcul plus précis serait donc

(29 904-18) × (1/4) 19   = 1,087 × 10 -7

Ensuite, ils calculent les chances que la séquence de 19 nucléotides se produise dans la bibliothèque brevetée de 24 712 séquences d’une longueur moyenne de 3 300 nucléotides. Mais ce calcul n’est pas pertinent car la séquence n’est pas apparue au hasard dans 5 demandes de brevet Moderna. La séquence était connue pour coder pour un site de clivage de la furine, qui est connu pour fournir un gain de fonction aux coronavirus.

Il y a été mis délibérément et breveté en raison de son pouvoir infectieux chez l’homme, que nous verrons plus loin dans l’article, résulte du remplacement du codon viral normal de l’arginine (R) AGA (utilisé dans 45 % des codons viraux de l’arginine) par le le codon de l’arginine humaine CGG (utilisé dans 0 % des codons de l’arginine virale) dans le site de clivage de la furine.

Tout ce que nous essayons de déterminer ici, c’est quelles sont les chances qu’une séquence de 19 nucléotides brevetée par Moderna apparaisse dans Covid-19 par des causes naturelles, les mutations naturelles du Bat Coronavirus RaTG13 ou d’un autre virus.

Les nucléotides forment des codons qui sont des triplets. Il y a donc 64 triplets possibles des 4 nucléotides d’ADN ACGT (4x4x4 = 64). Mais tous les triplés se produisent. 61 codent pour 20 acides aminés de manière redondante et 3 sont des codons stop qui indiquent au ribosome d’arrêter de fabriquer la protéine.

Mais les choses ne sont pas aussi simples car le site de clivage Furin apparaît dans la protéine de pointe là où il doit être et la protéine de pointe n’a que 1273 × 3 = 3819 nucléotides. Les chances que la séquence de 19 nucléotides Furin Cleavage apparaisse dans la protéine de pointe sont 

(3 819-18) × (1/4) 19   = 1,389 × 10 -8

Soit 1 sur 72 millions. Ce seraient donc les chances qu’une variante particulière, disons la première variante de Covid-19, ait la séquence de 19 nucléotides au bon endroit (le pic). Et il l’a fait. Donc, certainement selon la prépondérance des probabilités, et certainement au-delà de tout doute raisonnable (1 sur 72 millions étant un doute déraisonnable), Moderna a créé Covid-19. 

Preuve 100% biochimique que Covid19 a été créé par l’homme

Le double codon CGG utilisé dans le site de clivage spécifique de la furine Moderna ne se produit dans aucun autre site de clivage de la furine dans aucun autre virus dans la nature. Les sites de clivage de la furine se produisent dans d’autres virus mais PAS du tout dans d’autres bétacoronavirus comme Covid-19 et PAS du tout avec le double codon CGG.

L’arginine (R), peut être codée par l’un des 6 triplets : AGG, AGA, CGA, CGC, CGG, CGT. Dans le Covid-19, le site de la furine (PRRA), compte 12 nucléotides (3 x 4). Dans le Covid-19, le doublet RR du site de la furine est codé par CGG-CGG.  

Antonio R. Romeu

Deux biochimistes, le professeur Antonio R. Romeu et le professeur assistant Enric Ollé, ont analysé le doublet RR à partir d’un large échantillon de sites de clivage de la furine de plusieurs types de virus . Ils ont découvert qu’il n’y avait aucun doublet RR codé par les codons CGG-CGG dans aucun virus dans la nature. Ils ont observé que le triplet AGA était le codon majoritaire impliqué dans ces doublets RR viraux.

Dans toute recombinaison génétique (où une partie d’un génome fusionne avec un autre génome), le code donneur est transmis à l’accepteur. Mais il n’y a tout simplement AUCUN VIRUS CONNU avec un site de clivage de la furine spécifique de Moderna (ayant la paire de codons CGG-CGG) qui existe pour donner un site de clivage de la furine spécifique de Moderna à Covid19. Donc, la seule façon dont cette séquence pourrait entrer dans Covid-19 est de Moderna. Moderna était le donateur. La nature ne l’était pas. CQFD. Affaire classée..  

Mais ça empire.

Les professeurs espagnols ont décidé d’analyser l’utilisation du codon de l’arginine dans chaque protéine de Covid-19. Le constat suivant…
AGG (13%)
AGA (45%)
CGA (5%)
CGC (10%)
CGG (3%)
CGT (24%). 

Ainsi, le triplet de codons AGA était majoritaire et, fait intéressant, CGG était le codon minoritaire de l’arginine dans le virus. 

Mais c’est encore pire.

Dans le cas particulier de la protéine S, sur les 42 Arginines (R) dont elle dispose, 20 sont codées par AGA, et seulement 2 par CGG. Ces 2 bien sûr, sont les deux dans le site de clivage Moderna Specific Furin.

Ainsi, la seule arginine dans la protéine de pointe qui est codée à la Moderna se trouve sur le site Furin Cleavage. Les 40 autres instances n’utilisent pas du tout CGG. 

Ils poursuivent ensuite en commentant que chaque espèce individuelle dans la nature a ses propres préférences de codons. De toute évidence, les virus aiment AGA, et n’aiment pas du tout CGG, dans la nature.

Mais devinez quelle espèce utilise CGG pour l’arginine plus que les 5 autres codons concurrents – oui, son vieil homo sapiens. Nos préférences de codage pour l’arginine sont

AGG (20 %)
AGA (20 %)
CGA (11 %)
CGC (19 %)
CGG (21 %)
CGT (9 %).

Ainsi, le codon CGG dans le site de clivage de la furine SERA issu de la recherche sur le gain de fonction chimère (combinaison homme-animal). 

Quelqu’un d’autre que Moderna aurait-il pu créer le Covid-19 en utilisant le site de clivage de la furine spécifique de Moderna ?

« De nouveaux documents montrent que 18 mois seulement avant l’apparition des premiers cas de Covid-19, les chercheurs avaient soumis des plans pour libérer des nanoparticules et des aérosols pénétrant dans la peau contenant de « nouvelles protéines de pointe  » de coronavirus de chauve-souris  des cavernes du Yunnan, en Chine. Ils prévoyaient également de créer des virus chimériques, génétiquement améliorés pour infecter plus facilement les humains, et ont demandé 14 millions de dollars à la Defense Advanced Research Projects Agency (Darpa) pour financer les travaux.

Des articles, confirmés comme authentiques par un ancien membre de l’administration Trump, montrent qu’ils espéraient introduire des «sites de clivage spécifiques à l’homme» pour les coronavirus de chauve-souris, ce qui faciliterait l’entrée du virus dans les cellules humaines.
Lorsque Covid-19 a été séquencé génétiquement pour la première fois, les scientifiques étaient perplexes quant à la façon dont le virus avait développé une telle adaptation spécifique à l’homme au site de clivage de la protéine de pointe, raison pour laquelle il est si infectieux. – le Telegraph

Je peux voir tous les grands journalistes du Daily Mail et du Telegraph (sans parler des scientifiques du monde entier) faire toutes ces recherches sur Covid19 et arriver à la conclusion logique inévitable qu’il y a eu une fuite accidentelle ou délibérée d’un laboratoire et doivent ensuite formuler leurs conclusions de manière à étiqueter cette forte probabilité comme une possibilité faible. 

Mais ci-dessus, nous l’avons prouvé comme un fait (puisque le codon CGG de la séquence de clivage spécifique de la furine de Moderna n’apparaît dans aucun site de clivage de la furine dans aucun virus naturel et, par conséquent, il ne peut pas avoir été le résultat d’une recombinaison génétique naturelle. Il doit donc être le résultat d’une insertion génétique faite par l’homme. 

En théorie, une autre partie impliquée avec le NAIAD ou le NIH aurait pu utiliser le site de clivage de la furine breveté par Moderna et fabriquer Covid19 eux-mêmes. Cela n’aurait brisé aucun brevet de Moderna. Le site de clivage Furin lui-même n’est pas brevetable étant connu depuis au moins 2004

US7223390B2 : Insertion de sites de clivage de la furine protéase dans les protéines membranaires 
et leurs
utilisations

Bien que Moderna ait en fait pu breveter le codage Moderna Specific (CGG pour AGA) du site de clivage de la furine qui n’était pas connu dans la nature même aujourd’hui (si nous acceptons que Covid-19 soit créé par l’homme).

Mais étant donné que la fuite de laboratoire (délibérée ou accidentelle) est venue de Wuhan, et compte tenu de la dissimulation chinoise et des démentis de Fauci exposés par le sénateur Rand Paul, et étant donné les dissimulations du NIH, du NIAID et des services de renseignement américains, quand leur Un rapport de 3 mois sur l’origine de Covid-19 commandé par l’imitateur présidentiel Biden n’a rien donné, et compte tenu des relations entre le NIAID, le NIH, le WIV, l’EcoHealth Alliance, l’Université de Caroline du Nord et Moderna, je ne vois aucune pièce pour quelqu’un d’autre.

De plus, toute la cabale impie des mauvais acteurs a commencé à développer le vaccin Moderna avant que la pandémie ne frappe – https://www.infowars.com/posts/must-watch-nih-claimed-joint-ownership-of-moderna-mrna-vaccine- a commencé-le-développement-des-semaines-avant-la-pandémie/ 

Mais les choses ne sont pas aussi simples que cela parce que la nature a certainement eu 100 000 ans pour fabriquer des virus humains et elle n’a jamais mis une seule fois un site de clivage de furine spécifique à Moderna (CGG pour AGA) dans quoi que ce soit, ni mis la séquence de 19 nucléotides dans quoi que ce soit auparavant.

Pourtant, dans les 6 ans suivant le brevetage de Moderna, nous le trouvons dans Covid-19 dans des circonstances où Moderna travaille avec ce virus. Donc juste là, la probabilité n’est pas de 100 000 contre 6 ou 16 666 contre 1 que Moderna soit responsable plutôt que la nature. Non c’est à 100% car la nature ne l’a pas fait. Il ne l’a jamais fait et rien ne prouve qu’il le fera un jour.

C’est l’homme qui mélange les codons humains et viraux de l’arginine, pas la nature. 

Le prof. Luc Montagnier a passé les dernières années de sa vie à prouver que le COVID-19 était créé par l’homme et qu’il contenait une grande partie du code génétique du VIH1

Le professeur Luc Montagnier, avant de mourir le 8 février 2022, a totalement détruit le concept selon lequel Covid-19 a évolué naturellement en montrant qu’il avait une équivalence massive avec VIH. Le diagramme ci-dessous montre une région de 275 nucléotides de Covid-19 qui contient 200 nucléotides du VIH/SIV (Simian ImmunoVirus). Et rappelez-vous qu’il y a 61 codons spécifiant 20 acides aminés. On peut donc dire la même chose en moyenne de 3 manières différentes avec des codons.

Vous pouvez télécharger un pdf de son étude ici et les documents supplémentaires ici . C’est très technique. Mais il a remporté le prix Nobel pour avoir découvert le virus VIH. Donc, si quelqu’un savait si Covid avait été boosté par le VIH, ce serait lui. Il a souligné que Covid-19 avait été créé par l’homme au début de la pandémie et qu’il avait lui-même été stipendié par la presse et les « vérificateurs des faits » pour avoir dit la vérité scientifique. Tous les « vérificateurs de faits » qui l’ont attaqué avaient tort.

Aucune de leurs vérifications des faits n’avait de fondement scientifique. Ces gens ne sont pas du tout des vérificateurs de faits bien sûr. Ce sont des agences de désinformation mondialistes, des fils de Goebbels, des fact chuckers et des négateurs de la science. Ils sont à peu près aussi dignes de confiance qu’une élection américaine. Je peux vérifier un fait par moi-même merci beaucoup. Je n’ai pas besoin qu’un taliban soumis au lavage de cerveau me dise son opinion sur un sujet qu’il n’a jamais étudié à l’université.

Puisque nous avons prouvé au-delà de tout doute raisonnable (au-delà d’un doute sur 1 sur 72 millions de manière statistique et avec 100% de certitude biochimique à partir du site de clivage de la furine spécifique de Moderna) que Moderna a fabriqué Covid-19. Et puisque Moderna et Fauci n’ont pas admis l’avoir fait et ont en fait dissimulé des preuves à cet effet, il se peut qu’ils cachent également autre chose.

Maintenant, les deux seules théories qui restent sont la théorie des fuites accidentelles de laboratoire et la théorie des fuites délibérées de laboratoire. Nous savons que la grande majorité des fuites politiques ne sont pas des accidents. Ce sont des stratégies délibérées pour procurer un avantage au bailleur ou au payeur. Il est bien connu dans l’industrie informatique que les virus apparaissent lorsque des ventes d’antivirus sont nécessaires. Pourquoi les choses seraient-elles différentes avec les virus humains, maintenant qu’ils peuvent aussi être créés par l’homme ? Surtout si l’on considère le rôle massif de Bill Gates et de sa fondation et de GAVI et GVAP dans le secteur mondial de la vaccination.

La seule raison pour laquelle Moderna créerait Covid-19 est de le lancer sur le marché. Sinon, tout l’exercice serait financièrement futile, commercialement inutile.

La raison invoquée par Fauci pour faire de la recherche sur le gain de fonction est que l’homme doit être en avance sur la nature ou les mauvais acteurs afin d’avoir un vaccin en temps utile si une maladie mute ou est génétiquement modifiée par « les Chinois ou les Russes » pour être mortelle !!

Mais pour croire cela, il faut croire que Moderna s’intéresse à sauver la vie des gens. Je m’excuse. Toutes leurs actions me montrent qu’ils sont intéressés à vacciner les gens sachant à quel point cela risque de leur coûter la vie.

Ils sont intéressés par le profit, le profit qui découle d’une pandémie. Ils ne sont pas des sauveurs de l’humanité comme ils le représentent. Ce sont nos exploiteurs et nos agresseurs.

Ils ont produit le virus pour le faire fuiter, pour se faire passer pour nos sauveurs de leur propre fuite. Ce ne sont pas les activités d’une figure de sauveur. Luc Montagnier essayait d’être notre sauveur d’eux et il a été assassiné (professionnellement) par leurs groupies. [La fiotte Macron a snobé le décès du Savant]
Moderna effectuait des recherches sur le gain de fonction afin de libérer le virus et de forcer un vaccin contre celui-ci d’une manière qui maximiserait ses profits. Ce n’est pas une théorie du complot. C’est ce qui s’est passé précisément. Le cours de leur action a été multiplié par 20. 

Ils l’ont sorti pour vendre leurs vaccins et détruire le système immunitaire de leurs clients car notre système immunitaire réduit leurs profits. C’est le business de Big Pharma. 

La raison pour laquelle l’écrivain est si confiant que Moderna ou leurs agents ont fabriqué et divulgué Covid-19 et la raison pour laquelle je l’ai appelé ainsi au début de la pandémie pour presque autant de ridicule que le professeur Montagnier a reçu (que Dieu le bénisse) est que le les Écritures disent dans Matthieu27, Marc15 et Jean19 : 

29 Et ils (les soldats du gouverneur du verset 27) placèrent une couronne d’épines et la mirent sur sa tête, et un roseau dans sa main droite ; et ils s’agenouillèrent devant lui, et se moquèrent de lui, disant : Salut, roi des Juifs !
30 Et ils crachèrent contre lui, prirent le roseau et le frappèrent sur la tête. (Matthieu 27 ASV)

Puis-je donc demander votre indulgence pendant que j’interprète ces mots : 

Le département américain de la défense a financé l’épissage génétique du coronavirus des protéines de pointe (Covid-19) par l’intermédiaire du NIH, du NIAID et de la DARPA, qui a d’abord infecté Jésus, par l’intermédiaire de son fiancé, les saints de la Nouvelle Alliance, juste après qu’il soit devenu le roi séculier, César à ces saints, les Juifs antitypiques, ceux qui se sont engagés à être des fils angéliques de Jacob, les nés de nouveau angéliquement.

Nous avons calculé que la malédiction qui a empêché Jésus de devenir César des saints s’est terminée en 2019Tishri15 (17/18 octobre). Glenn Beck a réalisé un documentaire montrant que 10 hôpitaux de Wuhan ont pris en charge des cas présentant des symptômes de Covid19 en octobre 2019. Oui les gens. Le Covid-19 est une preuve que Jésus est désormais le Roi séculier sur les saints, les Juifs antitypiques, les Juifs par l’alliance angélique du salut, au moins.

Mais ensuite, les soldats ont craché sur lui. Car c’est ainsi que Covid19 est transféré, à travers de petites gouttelettes d’aérosol expirées par la bouche. Les soldats lui ont délibérément craché dessus. Ce n’était pas une FUITE DE SALIVE ! Ils ont frappé Jésus sur la tête parce que les saints sont à la tête de l’église et ils ont attrapé Covid19 non pas par une infection fortuite au hasard mais par un coup délibéré avec une lecture, une arme biologique, une attaque armée délibérée. Pour en savoir plus, voir ici .

Alors ce que le Pr Montagnier a vu avec son expertise en virologie, je l’ai vu avec mon expertise théologique. Montrer que si les vérificateurs de faits et la science s’excluent mutuellement, la science et la théologie sont en fait d’accord, lorsqu’elles sont bien comprises (et c’est une grande mise en garde). Le Pr M nous a appris que les vaccins provoquent les variants. En effet, la virologie de base interdit la vaccination de masse pendant une pandémie pour cette raison même. Il a dit que la courbe des décès suit la courbe des vaccinations. Remarquez, paradoxalement, si les vaccins ont causé Omicron, alors ils nous ont sauvés d’eux-mêmes !

Le temps est venu de demander des comptes aux personnes et aux organisations

Les fabricants de Covid19, les fabricants de vaccins génétiques. leurs bailleurs de fonds et leurs promoteurs, qui comprennent presque tous les gouvernements, secteurs publics et services de santé dans le monde, sont donc coupables de génocide et de crimes contre l’humanité. Ils ont poussé le viol génétique, la maladie et la mort sur la moitié de la population mondiale afin d’enrichir les poches des sociétés pharmaceutiques. Les gouvernements et les secteurs publics du monde entier ont abandonné leur réglementation des services de santé aux milliardaires et aux entreprises sans cœur

Au Royaume-Uni, tout l’impôt sur le revenu que nous payons va au service de santé et tous ses protocoles sont déterminés par ses régulateurs et tous ses régulateurs sont contrôlés et financés par Big Pharma qui cherchent à nuire puis à gérer notre santé à leur profit.

Ainsi, chaque cent que nous dépensons en impôt sur le revenu nous rapproche un peu plus de la maladie, de la mort et de la toxicomanie.

Le professeur Luc Montagnier,en 2008.

Alors pourquoi le professeur Montagnier a-t-il choisi de passer les dernières années de sa vie à prouver que le Covid-19 était une création humaine et que les protéines de pointe, et donc les vaccins, étaient une menace existentielle pour l’espèce ? Que lui restait-il à prouver à lui-même ou à qui que ce soit d’autre à 87-89 ? Il ne l’a certainement pas fait pour accroître sa réputation dans la profession.

Non, il était animé par la même passion qui l’a poussé à découvrir le VIH. Une passion pour SAUVER l’humanité des virus et de ceux qui voudraient les concevoir pour nous nuire. Et pourquoi a-t-il rendu l’âme en février 2022 ? Parce qu’il savait qu’Omicron avait battu les vaccins. Son travail a été fait par un plus grand virologue que lui. Il a donc pu reposer en paix et aller voir des gens qui ont compris l’ampleur de sa contribution.

Covid-19 n’a pas été fabriqué en 2019. Il a été fabriqué à partir du site de clivage de la furine chimérique spécifique de Moderna (CGG pour AGA) à 19 nucléotides qui n’existe nulle part dans la nature.
Et chaque décès de Covid et chaque décès par vaccin Covid est carrément garé à la porte de ModeRNA en attente de justice.

Mais nous n’exécuterons pas cette justice assez vite. Et donc le fléau final sur l’humanité d’Apocalypse 6: 8, livré par le 4e cavalier de l’apocalypse, que Bill Gates lui-même a prophétisé, arrivera plus tard cette année (après la guerre et après la famine, les 2e et 3e cavaliers).

Source: BREAKING: Official Biochemical and Statistical Evidence 100% confirms Moderna created Covid-19

 


N’hésitez pas à visiter notre boutique en ligne:vous trouverez plein de cadeaux pour vos proches

Sur ce lien:Vintage par Michel

 

Rien ne va plus chez Facebook, « Meta » perd près de 200 milliards de dollars en Bourse

Les actions de Meta, la société mère de Facebook, ont chuté de plus de 25% jeudi,le 3 février 2022, anéantissant plus de 230 milliards de dollars de valeur marchande. Il y a quelques jours, la firme de Mark Zuckerberg jetait aussi l’éponge sur son projet de monnaie numérique, après des années de recherche et développement.

Meta perd près de 200 milliards de dollars en Bourse

A Wall Street, la réaction est forte, très forte. Dans les premières cotations, l’action de l’ex-Facebook plonge de plus de 25%. C’est plus de 230 milliards de dollars de capitalisation boursière qui s’envolent et la plus lourde sanction jamais accusée par le groupe de Mark Zuckerberg ou, plus largement par une société cotée à New York, souligne Bloomberg,

Le 03 février, à 15h15 GMT (16h15 en Suisse), le titre de Meta Platforms, maison mère de Facebook, dégringolait de 24% à 245 dollars, entraînant l’indice Nasdaq (-2,14%) dans sa chute.

La fortune du patron de Facebook, Mark Zuckerberg, estimée à 113 milliards de dollars à la clôture hier selon des documents de la SEC, subissait aussi une coupe sévère. Le co-fondateur du réseau social perdait virtuellement presque 28 milliards de dollars.

Les actions de Meta ont plongé à la suite d’un rapport sur les résultats trimestriels lamentable dans lequel la société a publié des prévisions de revenus plus faibles que prévu et a mis en garde contre plusieurs défis pour son activité cette année.

Les investisseurs ont abandonné les actions du géant de la technologie après avoir été alarmés à la fois par la baisse de la croissance des utilisateurs et la hausse des dépenses liées au projet de « métaverse » de la société. Facebook a dépensé plus de 10 milliards de dollars dans ce sens l’année dernière et s’attend à une “augmentation significative” des dépenses similaires pour 2022.

Le nombre d’utilisateurs, surtout, a déçu. Le revenu moyen par utilisateur (Arpu) est, certes, un peu plus élevé qu’attendu, à 11,57 dollars, contre 11,38 dollars visés par les analystes, mais ils sont moins nombreux : 1,93 milliard d’utilisateurs actifs quotidiens en décembre, contre 1,95 milliard anticipé, et 2,91 milliards d’actifs mensuels (2,95 milliards). C’est la première fois, dans l’histoire de l’entreprise, que le nombre d’utilisateurs actifs quotidiens s’inscrit en baisse par rapport au précédent.

 

Meta cède aussi sur la cryptomonnaie et abandonne le Diem

Février est décidément un mois compliqué pour Facebook, rebaptisé Meta. Après le projet avorté en 2019 du Libra, cette cryptomonnaie qui réunissait d’autres acteurs d’Internet et des paiements (PayPal, Visa, Mastercard) autour du réseau social, c’est au tour de son successeur, le Diem, d’être enterré.

Le diem n’aura pas réussi à faire oublier le « libra », nom du projet initial, qui avait, déjà, créé un véritable séisme dans la sphère bancaire mondiale il y a un peu plus de deux ans. Cette monnaie virtuelle décentralisée devait être lancée mi-2020, mais elle avait immédiatement déclenché une fronde internationale à son égard.

Le projet de monnaie numérique de Meta (Facebook), ne verra, donc, pas le jour. Elle a annoncé son démantèlement, ainsi que la vente des droits de propriété intellectuelle et d’autres actifs à la banque Silvergate Capital pour 182 millions de dollars.

Selon Bloomberg, le coup d’épée fatal a été porté par la Réserve fédérale des États-Unis qui aurait exercé sa pression sur le partenaire banquier du diem, Silvergate.

Le recul de Meta s’expliquerait par la dissuasion des autorités centrales qui n’entendent pas perdre aussi facilement le contrôle de la monnaie. Le pari était aussi prometteur puisqu’il surfait – comme les autres GAFA – sur l’explosion des cryptomonnaies, au nombre de 12.000 selon CoinGecko, et qui se sont bâties une véritable notoriété en pleine pandémie de Covid et face aux incertitudes liées à l’inflation sur les Bourses traditionnelles.

Amazon, Google, Apple, PayPal, mais aussi Tesla du côté des Américains… les géants de la Tech se penchent sur ces nouveaux moyens d’échanges, en dehors des circuits bancaires traditionnels, sur tous les continents. Mais dans les pays où un pouvoir central contrôle l’économie, comme en Chine ou en Inde, l’activité des cryptomonnaies est pratiquement bannie.

Le projet était d’autant plus stratégique qu’il promettait potentiellement d’échanger des biens et d’acheter des services dans le futur « métaverse » de la firme de Mark Zuckerberg

Avec ce projet de « monde virtuel » Zuckerberg révèle ainsi son objectif final, qui n’est pas seulement de dominer l’internet d’aujourd’hui, mais de contrôler et de définir l’internet que nous laisserons à nos enfants et aux enfants de nos enfants. Un internet de surveillance toujours plus invasif où la parole dissidente est bannie.

Source

Fb spie
Un document interne à Facebook révèle que le géant des médias sociaux surveille le comportement hors ligne de ses utilisateurs afin de déterminer si une personne doit être classée dans la catégorie «agent de la haine», comme l’a signalé le Washington Pundit .

 

 

 

 

 

 

 

 

 


N’OUBLIEZ PAS DE VISITEZ LA BOUTIQUE EN LIGNE DE VOTRE SITE WEB FAVORI ET DE PARTAGER SON LIEN:

Sur ce lien:Vintage par Michel

 

 

 

 

Nous sommes tous des Truckers canadiens,québécois et américains !

Chacun se souvient de ce qu’il faisait le jour où le Mur de Berlin est tombé. Alors que tout indiquait que le joug communiste ne prendrait jamais fin, lorsque le peuple a décidé qu’il en avait assez, le mur est subitement tombé. Tout simplement.
C’est ainsi, après deux années d’autoritarisme covidiste, qu’au Canada, le plus grand convoi de camions de toute l’histoire est venu fracasser le Mur de Berlin de la tyrannie. J’ai suivi cet événement car le Canada, que j’avais par le passé respecté comme refuge pour les Étasuniens opposés à la guerre au cours des années 1960, s’était transformé en l’un des pays les plus répressifs au monde. Je me suis interrogé : comment un peuple épris de liberté a-t-il pu se laisser faire par ces mini-Staline sans broncher.

 

Et puis, le Canada s’est levé, et a montré au reste du monde que la liberté peut triompher sur la tyrannie, si le peuple l’exige. Comme je l’ai dit, aucune armée ne peut arrêter une idée dont l’heure est arrivée.

Justin Trudeau, le premier ministre canadien, s’est vautré dans son pouvoir de terroriser la population, au nom du combat contre un virus. Il avait tellement confiance en son propre pouvoir, apparemment illimité, qu’il s’est cru en mesure de pouvoir tourner en ridicule tout canadien montrant des idées différentes. Le premier ministre a affirmé au cours d’une interview récente que les Canadiens non-vaccinés sont « des extrémistes »« des misogynes » et « des racistes. »

Lorsque les truckers canadiens se sont levés face à sa tyrannie, et ont entamé leur convoi historique vers Ottawa, il a pensé pouvoir continuer à tourner le peuple en ridicule. Les camionneurs et leurs soutiens n’étaient guère qu’une « petite minorité à la marge », qui entretenait « des idées inacceptables », a-t-il alors affirmé avec aplomb. Pour Trudeau, l’amour de la liberté n’est guère qu’une « idée inacceptable. »

Moins d’une semaine plus tard, alors que des dizaines de milliers de camions commençait à entrer dans Ottawa, la capitale du pays, avec derrière eux des millions de soutiens [et ce, par -25°C, NdSF], le « brave » premier ministre canadien a pris la poudre d’escampette, et s’est évaporé, destination inconnue.

Comme l’a tweeté Elon Musk, « Il semblerait que la ‘minorité à la marge’ soit en réalité le gouvernement. »

Les médias dominants canadiens se montrent évidement tout aussi obéissants à leur régime que les nôtres. Ils ont ignoré le Freedom Convoy aussi longtemps qu’ils l’ont pu. Il n’en a été fait mention quasiment nulle part. Puis, lorsqu’il est devenu impossible de l’ignorer, ils se sont mis à l’attaquer et à le tourner en ridicule, au lieu d’essayer d’en faire mention avec honnêteté. On a eu le dégoût, et cela a été presque comique, de voir un « reporter » de la Canadian Broadcasting Corporation suggérer que le Canadian Freedom Convoy était un coup de Poutine et des Russes !

Des milliers de truckers sont arrivés à Ottawa. Ils ont exigé la fin de la tyrannie du Covid. Ils sont soutenus par des millions de citoyens, qui ont bravé la nuit hivernale pour soutenir les routiers.

 

Cette manifestation est très importante, car elle ne se limite pas au Canada. Les truckers reçoivent du soutien depuis le monde entier, et un convoi semblable se prépare, depuis la Californie jusque Washington DC. Aux États-Unis, où les étals des supermarchés sont de moins en moins bien achalandés, les routiers ont plus de poids que les pouvoirs en place n’aimeraient le reconnaître.

Si j’étais le premier ministre des pays totalitaires que sont l’Australie et la Nouvelle-Zélande — ou de n’importe quel pays d’Europe — je commencerais à avoir des sueurs froides. Comme la tyrannie covidienne est descendue sur le globe d’une manière apparemment coordonnée, à présent que le Mur de Berlin des tyrans est percé, il suffit de laisser le temps passer et les ondes de choc vont se propager, loin et puissamment.

Nous devons faire preuve de gratitude envers les routiers canadiens. Faisons tout notre possible pour aider le mouvement de la liberté à se poursuivre !

Ron Paul

Note du Saker Francophone

En France, un convoi est en cours d’organisation, semble-t-il pour converger à Paris à partir du 12 février, puis à Bruxelles le 14 février en ralliant des convois d’autres pays. Les camionneurs français et européens ne sont en général pas propriétaires de leur propre camion, contrairement au Canada, si bien que la structure du mouvement en France et en Europe promet d’être assez différente, et d’impliquer des voitures particulières ainsi que des non-camionneurs. Le mouvement s’organise sur Telegram, avec le canal convoyFrance, et semble-t-il également sur Facebook. et Vkontakt.

 le Saker Francophone

 

 

———————————————————-

La vaccination COVID-19 de Justin Trudeau est bidon

Une infirmière diplômée formée à l’administration d’injections intramusculaires a créé une vidéo expliquant pourquoi elle pense que le premier ministre canadien Justin Trudeau et son épouse Sophie n’ont pas réellement reçu de vaccins contre la COVID-19. En fait, elle a dit qu’elle « pouvait repérer cela à un kilomètre de distance » simplement en regardant les images diffusées à la télévision en direct.

Le 23 avril, Trudeau et sa femme ont été enregistrés en train de recevoir leurs premières doses du vaccin AstraZeneca COVID-19 dans une pharmacie Rexall. Dans la vidéo, on peut voir Trudeau retrousser sa manche et tendre la main vers sa femme et lui demander de lui tenir la main avant qu’un pharmacien injecte la dose dans son bras gauche à l’endroit de son tatouage.

Dans la vidéo de l’infirmière, elle a partagé plusieurs raisons pour lesquelles elle pense que les coups étaient « évidemment faux ». Sa principale critique était le fait que le travailleur qui a administré les injections au couple n’utilisait qu’une seule main.

« Personne ne fait ça. Vous ne faites pas d’injections IM de cette façon », a-t-elle souligné, en utilisant l’abréviation IM pour « intramusculaire ».

La méthode traditionnelle d’administration des injections intramusculaires comme les vaccins COVID-19 consiste à utiliser une main pour localiser le muscle deltoïde tandis que l’autre main injecte le vaccin dans le muscle dans une procédure connue sous le nom de repère. Les directives du gouvernement canadien stipulent que la peau du bras « doit être étirée à plat (entre le pouce et l’index) au moment de l’administration ».

Pour les Trudeau, elle a déclaré: «L’injecteur s’est assis sur sa chaise et a jeté cette aiguille comme si c’était une fléchette, d’une main, ne les a même pas touchés de l’autre main, n’a pas touché l’aiguille de l’autre part, c’était très inhabituel.

Source

 

 

 

 

 

 

 

 

 

 


VISITEZ NOTRE  BOUTIQUE EN LIGNE  MES AMI(E)S;

Sur ce lien:Vintage par Michel

 

 

 

 

La Gigantesque Arnaque du COVID-19:Les laboratoires américains n’ont pas trouvé de Covid-19 dans 1.500 tests positifs analysés

Le CDC poursuivi pour fraude massive : des tests dans 7 universités de TOUTES les personnes examinées ont montré qu’elles n’avaient pas de Covid, mais seulement la grippe A ou B – Statistiques de l’UE : « Corona » a pratiquement disparu, même en cas de mortalité.

Un scientifique clinicien et immunologiste-virologue d’un laboratoire du sud de la Californie affirme que lui et ses collègues de 7 universités poursuivent le CDC pour fraude massive. La raison : pas un seul des 1.500 échantillons de personnes testées « positives » n’a pu trouver le Covid-19. Il a été découvert que TOUTES les personnes étaient simplement atteintes de la grippe A et, dans une moindre mesure, de la grippe B. Ceci est cohérent avec les découvertes précédentes d’autres scientifiques, dont nous avons fait état à plusieurs reprises. Dr Derek Knauss : « Lorsque mon équipe de laboratoire et moi avons soumis les 1.500 échantillons de Covid-19 supposés positifs aux postulats de Koch et les avons placés sous un SEM (microscope électronique), nous n’avons trouvé AUCUN Covid dans les 1.500 échantillons. Nous avons constaté que les 1.500 échantillons étaient principalement de la grippe A et de la grippe B, mais aucun cas de Covid. Nous n’avons pas utilisé le test PCR des taureaux***.

Dans 7 universités, pas une seule fois le COVID détecté

«Lorsque nous avons envoyé le reste des échantillons à Stanford, Cornell et quelques laboratoires de l’Université de Californie, ils sont arrivés au même résultat: PAS de COVID. Ils ont trouvé la grippe A et B. Ensuite, nous avons tous demandé au CDC des échantillons viables de Covid. Le CDC a dit qu’ils ne pouvaient pas les donner, car ils n’avaient pas ces échantillons. «Nous sommes donc arrivés à la dure conclusion de toutes nos recherches et travaux de laboratoire que Covid-19 était imaginaire et fictif. La grippe ne s’appelait que « Covid », et la plupart des 225.000 décès étaient dus à des comorbidités telles que les maladies cardiaques, le cancer, le diabète, l’emphysème pulmonaire, etc. Ils ont attrapé la grippe qui a encore affaibli leur système immunitaire, et ils sont morts. »

« Ce virus est fictif »

«Je dois encore trouver un échantillon viable avec Covid-19 avec lequel travailler. Nous qui avons effectué le test de laboratoire avec ces 1.500 échantillons dans les 7 universités poursuivons maintenant le CDC pour fraude au Covid-19. Le CDC ne nous a toujours pas envoyé d’échantillon viable, isolé et purifié de Covid-19. S’ils ne peuvent pas ou ne veulent pas, alors je dis qu’il n’y a pas de Covid-19. C’est fictif. «Les quatre articles de recherche décrivant les extraits du génome du virus Covid-19 n’ont jamais réussi à isoler et à purifier les échantillons. Les quatre articles ne décrivent que de petits morceaux d’ARN qui ne font que 37 à 40 paires de bases. Ce n’est PAS un VIRUS. Un génome viral compte normalement entre 30 000 et 40 000 paires de bases. «Maintenant que Covid-19 est censé être si mauvais partout, comment se fait-il qu’aucun laboratoire au monde n’ait complètement isolé et purifié ce virus? C’est parce qu’ils n’ont jamais vraiment trouvé le virus. Tout ce qu’ils ont découvert, ce sont de petits morceaux d’ARN qui n’ont de toute façon pas été identifiés comme étant le virus. Nous n’avons donc affaire qu’à une autre souche de grippe, comme chaque année. Le Covid-19 n’existe pas et est fictif .’ «Je crois que la Chine et les mondialistes ont mis en place ce canular Covid (la grippe déguisée en nouveau virus) pour établir une tyrannie mondiale et un État policier de contrôle totalitaire. Cette intrigue comprenait (également) une fraude électorale massive pour renverser Trump.

Le CDC lui-même admet n’avoir aucun virus identifiable

Profondément dissimulé dans un document officiel sur le Covid-19, le CDC admettait avec regret dès l’été 2020 qu’il n’avait pas de virus mesurable : ‘Comme aucun objet viral isolé quantifié (= mesuré) du 2019-nCoV n’est disponible à l’heure actuelle… ‘ (page 39 du ‘CDC 2019-Novel Coronavirus (2019-nCoV) Real-Time RT-PCR Diagnostic Panel’ (13 juillet) En d’autres termes, le CDC, en tant que l’une des principales autorités médicales au monde, ne pouvait pas , et ne peut toujours pas , démontrer un virus. À propos du test PCR à cette fin scientifiquement totalement démystifié, mais toujours abusé sans vergogne, le CDC a écrit sous la rubrique « limites » : « La détection de l’ARN viral ne peut pas démontrer la présence d’un virus infectieux, ni que le 2019-nCoV est l’agent causal. des symptômes cliniques. » Et en plus: « Ce test ne peut pas exclure d’autres maladies causées par d’autres pathogènes bactériens ou viraux. » En d’autres termes, nous ne pouvons pas prouver que les personnes qui tombent malades et sont hospitalisées, et meurent très occasionnellement, ont été rendues malades par un nouveau coronavirus appelé SARS-CoV-2, et nous ne pouvons pas non plus prouver qu’il les a amenées à développer une nouvelle maladie appelée « Covid19 ». Il pourrait tout aussi bien s’agir d’un virus différent et d’une maladie différente. (Et puisque tous les symptômes, y compris les pneumonies sévères, correspondent parfaitement à ce que la grippe peut provoquer historiquement chez les personnes vulnérables… « si ça ressemble à un canard et marche comme un canard, c’est un canard ».

Récompense de 1.800.000 $ pour avoir démontré le coronavirus

L’année dernière, l’équipe allemande de Samuel Eckert et le Isolate Truth Fund ont promis une récompense d’au moins 265.000 $ pour tout scientifique qui peut fournir une preuve irréfutable que le virus SARS-CoV-2 a été isolé et existe donc. Ils ont également souligné qu’aucun laboratoire au monde n’a encore été en mesure d’isoler ce virus corona. Ce montant est passé à 1.800.000 $ . Oui, les scientifiques des systèmes prétendent qu’ils l’ont fait, mais cet « isolement » ne consiste qu’en un échantillon du corps humain, qui est une « soupe » pleine de différents types de cellules, de restes de virus, de bactéries, etc. À l’aide de produits chimiques (toxiques), on recherche ensuite des particules (résiduelles) qui peuvent indiquer un virus qui a existé ou peut encore exister, après quoi cela est désigné comme «preuve».

L’équipe canadienne n’a également reçu aucune preuve malgré 40 demandes de loi sur l’accès public

Fin décembre 2020, il y avait une initiative similaire à celle en Allemagne. Une équipe autour de la journaliste d’investigation canadienne Christine Massey a soumis pas moins de 40 demandes de loi sur l’accès public aux autorités médicales du monde entier avec la simple demande de preuve que le virus SARS-CoV-2 a été isolé et que son existence peut donc être objectivement prouvée. Aucune des agences et autorités auxquelles nous avons écrit n’a été en mesure de fournir cette preuve.

« Impossible de démontrer que le SRAS-CoV-2 provoque une maladie appelée Covid-19 »

Le Dr Tom Cowan, le Dr Andrew Kaufman et Sally Fallon Morell ont récemment publié une déclaration sur « la controverse persistante sur la question de savoir si le virus SARS-CoV-2 est isolé ou purifié. Mais sur la base de la définition officielle d’ »isolement » d’Oxford (« le fait ou la condition d’être isolé ou isolé, une séparation d’avec d’autres choses ou personnes, debout seul »), le bon sens, les lois de la logique et les règles de la science dictent que toute personne impartiale doit arriver à la conclusion que le virus SARS-CoV-2 n’a jamais été isolé ou purifié. En conséquence, aucune confirmation de l’existence du virus ne peut être donnée. «Les implications logiques et scientifiques de ce fait sont que la structure et la composition de quelque chose dont l’existence ne peut être prouvée ne peuvent pas être connues, y compris la présence, la structure et la fonction d’un pic hypothétique ou d’autres protéines. La séquence génétique de quelque chose qui n’a jamais été trouvé ne peut pas être connue, ni les « variantes » (mutations) de quelque chose dont l’existence n’a pas été démontrée. Il est donc impossible de démontrer que le SRAS-CoV-2 provoque une maladie appelée Covid-19.’

Un test PCR combiné pour corona et grippe « parce qu’il n’y a pratiquement aucune différence »

Sans surprise, la plus grande société de biotechnologie au monde, la chinoise BGI, a récemment lancé un nouveau test PCR qui peut tester simultanément la grippe A, B et corona. Outre le fait avéré, reconnu par divers procès, qu’un test PCR ne peut pas prouver l’infection par quelque virus que ce soit, l’explication de BGI selon laquelle les deux maladies sont si difficiles à distinguer l’une de l’autre et qu’ils n’ont donc fait qu’un seul test, en dit plus que suffisant . Peut-être qu’il n’y a aucune différence, « Covid » n’est qu’un autre nom pour les virus de la grippe « vieux familiers », et c’est juste une autre astuce marketing intelligente ?

La plupart des gens ont été trompés par la propagande de la peur

Avec la propagande mondiale de la peur contrôlée par le gouvernement 24 heures sur 24, 7 jours sur 7, par les médias de masse, la plupart des gens en sont venus à croire qu’il existe en effet un virus potentiellement mortel qui rend les gens malades beaucoup plus rapidement et plus gravement que la grippe saisonnière. Cependant, même ce dernier n’est manifestement pas le cas. La grippe A est depuis des années la principale cause de décès par pneumonie dans le monde développé. Mais envoyez des personnes désignées comme des patients atteints de Covid sévères dans quelques unités de soins intensifs, mettez constamment des caméras dessus, dites à quelques médecins qu’ils ne doivent discuter que des pires cas, et vous avez votre « pandémie télévisée ». L’argument « nous le faisons parce que sinon les soins seront surchargés » a été sapé par les gouvernements eux-mêmes il y a quelque temps, en rejetant les offres de lits ou de personnel de soins intensifs supplémentaires, car « ce n’est pas nécessaire ». (Était-ce peut-être la première et la seule fois où la vérité était dite ?)

Chiffres officiels : rien d’inquiétant (mais ça ne revient jamais à la normale)

Maintenant que les chiffres officiels montrent également qu’après la saison normale de la grippe traditionnelle, tout va bien, et selon les statistiques de l’UE (EuroMOMO), il y a même une baisse significative de la mortalité, la société – s’il s’agissait vraiment d’un virus et de la santé publique – devrait revenir immédiatement à la normale pour commencer à réparer les énormes dégâts causés par les politiques gouvernementales. Cependant, comme vous le savez, cela ne se fera jamais, et c’est parce que ce canular pandémique soigneusement planifié poursuit un programme idéologique, le « Grand Reset », qui vise à démolir en grande partie la société et l’économie de l’Occident, puis à soumettre à une dictature technocratique communiste mondiale des vaccins climatiques, dans laquelle toutes nos libertés, droits civils et droits à l’autodétermination seront supprimés une fois pour toutes. C’était du moins leur plan.


EN COMPLÉMENTAIRE

 

Mais où est ce satané virus ? Personne ne l’a vu ou isolé !

L’appel à l’autorité est une erreur logique. Pourtant, au cours de cette longue simulation Covid-19 de l’autoritarisme mondial, on nous dit encore et encore de faire confiance au CDC, qui s’est trompé tout au long du chemin. La clé d’une république saine est de remettre continuellement en question l’autorité. Et la question la plus importante à poser à cette autorité autocratique est la suivante : le virus Sars-CoV-2 a-t-il déjà été vraiment isolé ? Et si oui, montrez-nous la preuve.

Les Centers for Disease Control (CDC) des États-Unis à Atlanta ont confirmé par écrit qu’ils n’avaient aucun échantillon réel, isolé et purifié du virus SARS-CoV-2 et ne pouvaient fournir aucun enregistrement sur ce virus, qui aurait causé COVID-19.
Au cours des derniers mois, des demandes de Freedom of Information Act (FOIA) ont été adressées aux Centers for Disease Control (CDC) pour demander des preuves que le CDC a isolé ou purifié le virus SARS-CoV-2.
Le 7 juin 2021, le CDC a confirmé (à nouveau) par écrit qu’il n’avait aucun dossier montrant qu’il avait déjà isolé ou purifié le virus qui serait à l’origine de la maladie appelée COVID-19.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Ces demandes écrites ont été faites par Mme Christine Massey au directeur général du CDC/ATSDR FOIA, M. Robert Andoh, pour localiser et fournir TOUS les enregistrements, recherches et/ou résultats pour TOUT isolement et purification « virale » (par quiconque, n’importe où, n’importe quand dans le Monde) à partir d’un échantillon de patient, par macération, filtration et/ou l’utilisation d’une ultracentrifugeuse . . . ce qu’on appelle le « Gold Standard » pour isoler et identifier un micro-organisme pathologique ou nana organisme.
Le « Gold Standard » pour l’isolement et l’identification des microbes sont appelés postulats de Koch et Rivers, qui ont été établis il y a de nombreuses années pour isoler les postulats de bactéries (Koch) ou de virus (Rivers).
Voici une comparaison côte à côte des postulats de Koch et des postulats de Rivers :

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Statement On Virus Isolation (SOVI)

Isolation: The action of isolating; the fact or condition of being isolated or standing alone; separation from other things or persons; solitariness.

– Oxford English Dictionary

La controverse sur la question de savoir si le virus du SRAS-CoV-2 a déjà été isolé ou purifié se poursuit. Cependant, en utilisant la définition ci-dessus, le bon sens, les lois de la logique et les préceptes de la science, toute personne impartiale doit arriver à la conclusion que le virus SARS-CoV-2 n’a jamais été isolé ou purifié. En conséquence, aucune confirmation de l’existence du virus ne peut être trouvée. Les conséquences logiques, de bon sens et scientifiques de ce fait sont :

  • la structure et la composition de quelque chose dont l’existence n’a pas été démontrée ne peuvent pas être connues, y compris la présence, la structure et la fonction de tout spike hypothétique ou d’autres protéines ;
  • la séquence génétique de quelque chose qui n’a jamais été trouvée ne peut pas être connue ;
  • les « variantes » de quelque chose dont l’existence n’a pas été démontrée ne peuvent pas être connues ;
  • il est impossible de démontrer que le SARS-CoV-2 provoque une maladie appelée Covid-19.

En termes aussi concis que possible, voici la bonne façon d’isoler, de caractériser et de démontrer un nouveau virus. Tout d’abord, on prélève des échantillons (sang, crachats, sécrétions) de nombreuses personnes (par exemple 500) présentant des symptômes suffisamment uniques et spécifiques pour caractériser une maladie. Sans mélanger ces échantillons avec AUCUN tissu ou produit contenant également du matériel génétique, le virologue macère, filtre et ultra-centrifuge, c’est-à-dire purifie l’échantillon. Cette technique de virologie courante, utilisée depuis des décennies pour isoler les bactériophages1 et les virus dits géants dans chaque laboratoire de virologie, permet ensuite au virologue de démontrer en microscopie électronique des milliers de particules de taille et de forme identiques. Ces particules sont le virus isolé et purifié.

L’uniformité de ces particules identiques est ensuite vérifiée par des techniques physiques et/ou microscopiques. Une fois la pureté déterminée, les particules peuvent être davantage caractérisées. Cela comprendrait l’examen de la structure, de la morphologie et de la composition chimique des particules. Ensuite, leur constitution génétique se caractérise par l’extraction du matériel génétique directement des particules purifiées et l’utilisation de techniques de séquençage génétique, telles que le séquençage de Sanger, qui existent également depuis des décennies. Ensuite, on fait une analyse pour confirmer que ces particules uniformes sont d’origine exogène (extérieure) conformément au concept de virus, et non les produits de dégradation normaux des tissus morts et mourants.2 (En mai 2020, nous savons que les virologues ont aucun moyen de déterminer si les particules qu’ils voient sont des virus ou simplement des produits de décomposition normaux de tissus morts et mourants.)3

Si nous sommes arrivés jusqu’ici, nous avons complètement isolé, caractérisé et séquencé génétiquement une particule virale exogène. Cependant, nous devons encore montrer qu’il est causalement lié à une maladie. Ceci est réalisé en exposant un groupe de sujets sains (des animaux sont généralement utilisés) à ce virus isolé et purifié de la manière dont la maladie est supposée se transmettre. Si les animaux tombent malades avec la même maladie, comme le confirment les résultats cliniques et d’autopsie, on a maintenant montré que le virus provoque en fait une maladie. Cela démontre l’infectiosité et la transmission d’un agent infectieux.

Aucune de ces étapes n’a même été tentée avec le virus SARS-CoV-2, et toutes ces étapes n’ont pas été non plus réalisées avec succès pour un virus dit pathogène. Notre recherche indique qu’aucune étude montrant ces étapes n’existe dans la littérature médicale.

Au lieu de cela, depuis 1954, les virologues ont prélevé des échantillons non purifiés sur un nombre relativement restreint de personnes, souvent moins de dix, atteintes d’une maladie similaire. Ils traitent ensuite cet échantillon de manière minimale et inoculent cet échantillon non purifié sur une culture tissulaire contenant généralement quatre à six autres types de matériel – qui contiennent tous un matériel génétique identique à ce qu’on appelle un « virus ». La culture tissulaire est affamée et empoisonnée et se désintègre naturellement en de nombreux types de particules, dont certaines contiennent du matériel génétique. Contre tout bon sens, logique, utilisation de la langue anglaise et intégrité scientifique, ce processus est appelé « isolement du virus ». Ce breuvage contenant des fragments de matériel génétique provenant de nombreuses sources est ensuite soumis à une analyse génétique, qui crée ensuite dans un processus de simulation informatique la séquence présumée du virus présumé, un soi-disant génome in silico. A aucun moment un virus réel n’est confirmé par microscopie électronique. A aucun moment un génome n’est extrait et séquencé d’un virus réel. C’est de la fraude scientifique.

L’observation que l’échantillon non purifié – inoculé sur une culture tissulaire avec des antibiotiques toxiques, du tissu fœtal bovin, du liquide amniotique et d’autres tissus – détruit le tissu rénal sur lequel il est inoculé est donnée comme preuve de l’existence et de la pathogénicité du virus. C’est de la fraude scientifique.

À partir de maintenant, lorsque quelqu’un vous remet un article suggérant que le virus SARS-CoV-2 a été isolé, veuillez consulter les sections méthodes. Si les chercheurs ont utilisé des cellules Vero ou toute autre méthode de culture, vous savez que leur processus n’était pas l’isolement. Vous entendrez les excuses suivantes pour lesquelles l’isolement réel n’est pas fait :

  1. Il n’y avait pas assez de particules virales trouvées dans les échantillons de patients pour être analysées.
  2. Les virus sont des parasites intracellulaires ; ils ne peuvent pas être trouvés en dehors de la cellule de cette manière.

Si le numéro 1 est vrai et que nous ne pouvons pas trouver le virus dans les crachats des personnes malades, alors sur quelles preuves pensons-nous que le virus est dangereux ou même mortel ? Si le numéro 2 est correct, alors comment le virus se transmet-il d’une personne à l’autre ? On nous dit qu’il sort de la cellule pour infecter les autres. Alors pourquoi n’est-il pas possible de le trouver?

Enfin, remettre en question ces techniques et conclusions de virologie n’est pas un problème de distraction ou de division. Faire la lumière sur cette vérité est essentiel pour arrêter cette terrible fraude à laquelle l’humanité est confrontée. Car, comme nous le savons maintenant, si le virus n’a jamais été isolé, séquencé ou montré comme provoquant une maladie, si le virus est imaginaire, alors pourquoi portons-nous des masques, prenons-nous des distances sociales et mettons-nous le monde entier en prison ?

Enfin, si les virus pathogènes n’existent pas, alors qu’est-ce qui se passe dans ces dispositifs injectables appelés à tort « vaccins », et à quoi servent-ils ? Cette question scientifique est la plus urgente et la plus pertinente de notre époque.

1 Isolement, caractérisation et analyse des bactériophages du lac halo-alcalin Elmenteita, KenyaJuliah Khayeli Akhwale et al, PLOS One, publié le 25 avril 2019. https://journals.plos.org/plosone/article?id=10.1371/journal. pone.0215734 — consulté le 15/02/21

2 « Vésicules extracellulaires dérivées de cellules apoptotiques : un lien essentiel entre la mort et la régénération », Maojiao Li1 et al, Frontiers in Cell and Developmental Biology, 2 octobre 2020. https://www.frontiersin.org/articles/10.3389/fcell. 2020.573511/complet — consulté le 15/02/21

3 « Le rôle des vésicules extracellulaires en tant qu’alliés des virus du VIH, du VHC et du SRAS », Flavia Giannessi, et al, Virus, 2020 mai

Source : Has the Sars-CoV-2 Virus Ever Really Been Isolated?


VENEZ VISITER NOTRE BOUTIQUE ENB LIGNE QUI ASSUME NOTRE EXISTENCE FINANCIÈRE ACTUELLE:

Sur ce lien:VintageparMichel

 

 

 

 

La Criminelle Arnaque du COVID-19:Les vaccins Covid-19 devraient causer 62,3 millions de décès cardiovasculaires en 2022 dans le monde

Une enquête sur les tendances actuelles a révélé que les vaccins Covid-19 devraient causer plus de 62,3 millions de décès cardiovasculaires dans le monde en 2022, après avoir déjà fait doubler les décès cardiovasculaires chez les athlètes professionnels tous les trois mois tout au long de 2021.

Le récent discours du Dr Steven Gundry à l’American Heart Association à Boston du 12 au 14 novembre a révélé que les vaccins à ARNm Covid-19 font plus que doubler vos chances de subir une crise cardiaque sur 5 ans, mesurées par divers  marqueurs à 2 mois après le 2e jab  (piqûre vax).

Nous avons également constaté que les incidences cardiaques mortelles des footballeurs sur le terrain ont doublé chaque trimestre en 2021 .

 

 

 

 

 

 

 

 

 

 

 

 

Soyons clairs sur ce que cela signifie. Ces footballeurs sont le canari dans la mine de charbon de la vaccination. Ne permettons pas que leur mort soit pour rien. Ils l’obtiennent en premier parce qu’ils poussent leur cœur le plus fort. C’était tellement émouvant pour moi de voir Sergio Aguero, le joueur de Manchester City totalement en forme, s’effondrer, puis lutter pour se relever en saisissant son cœur avec ses collègues autour de lui. Il a survécu, mais n’est plus en mesure de jouer au football professionnel. C’est totalement absurde pour un jeune homme aussi en forme. Il faut voir ces jeunes footballeurs morts (31 d’infarctus l’an dernier). Nous devons en tirer la leçon que la mine de charbon de la vaccination est pleine de poison et nous devons en sortir immédiatement.

 

 

 

 

 

 

 

 

 

 

Donc, assemblons le puzzle. Nous savons que le risque de crise cardiaque est doublé chez les personnes sédentaires, 2 mois et demi après le 2e jab, et nous savons que le risque de crise cardiaque lié au terrain chez les footballeurs professionnels était 4xfois supérieur à la normale en 2021 et que le mois de décembre 2021 tout seul, avec 7 décès, a presque égalé la moyenne des 12 années précédentes de 7,8 décès par an.

Nous pouvons en déduire que le risque pour les footballeurs est environ le double du risque pour les sédentaires (non sportifs). Mais le risque pour les footballeurs double chaque trimestre. par conséquent, le risque pour les sédentaires doublera également chaque trimestre car ils ont tous pris le même vaccin et ils contiennent tous les mêmes  protéines depointe.

C’est juste que les footballeurs poussent leur cœur plus fort que les « patates de canapé ». Nous prenons donc le risque du quatrième trimestre pour les personnes sédentaires comme étant 2xfois supérieur à la normale et extrapolons de manière exponentielle à partir de là en doublant le risque chaque trimestre. Cela donne des risques Q1/2/3/4 en 2022 de 4x/8x/16x/32x de la normale.

Il y a déjà eu 6 décès de footballeurs sur la première quinzaine de janvier 2022 parmi les joueurs du club lors de matchs ou d’entraînements.

  • 11 janv. 22 – Amir Abou Aiana – 18 ans – S’effondre au sol suite à un arrêt cardiaque sur le terrain de football de l’oratoire de via Cellini à Cesano Boscone (arrière-pays ouest de Milan). Une réanimation a été tentée et une ambulance a été appelée. Il est décédé peu de temps après son arrivée à l’hôpital.
  • 11 janv. 22 – Mateo Hernandez – 18 ans – Le gardien de Dimurol Salesianos Tenerife Football est décédé subitement et de façon inattendue.  Nouvelles histoires 
  • 11 janv. 22 – Isaías – 17 ans – Flamengo de Piauí Le footballeur de Teresina a dit à ses coéquipiers pendant qu’ils couraient qu’il ressentait une gêne. Il ralentit, puis se dirigea vers le banc, où il s’effondra. Les médecins ont tenté de le réanimer, mais il est décédé. C’était la troisième fois qu’il s’entraînait avec l’équipe.  Article d’actualité Article    d’actualité2
  • 10 janv. 22 – Filip Turk – 22 ans – Un autre jeune footballeur croate est décédé subitement, il n’avait que 22 ans   News Story   News Story2
  • 6 janvier 22 – Herbert Afayo – 21 ans – S’est effondré suite à un arrêt cardiaque sur le terrain du terrain de jeu Geregere Safi à Lugazi, district de Buikwe. Il a été réanimé et emmené à l’hôpital local mais est décédé avant d’atteindre l’hôpital. Une autopsie a conclu que la cause était un arrêt cardiaque.   Nouvelles histoires
  • 5 janvier 22 – Oisin Fields – 30 ans – S’est effondré et est décédé alors qu’il jouait au football avec ses amis et sa mort a envoyé des ondes de choc dans sa communauté locale.  Histoire de nouvelles .
  • 3 janvier 22 – Marcos Menaldo – 25 ans – Le défenseur central vedette guatémaltèque du Deportivo Marquense s’est effondré avec un arrêt cardiaque à l’entraînement au stade Marquesa de la Ensenada de San Marcos lundi peu après s’être plaint de difficultés respiratoires. Il  a été transféré à l’hôpital de Especialidades où il est décédé.  Nouvelles Story2

Les décès cardiovasculaires continueront d’augmenter de façon exponentielle si et seulement si la production de protéines de pointe se poursuit chez les patients complètement vaxxés. Nous ne savons pas si le système immunitaire finira par vaincre les vaccinations et éliminera avec succès chaque usine de protéines de pointe du corps.

Il semble , d’après les données sur le nombre de cas, que les personnes vaccinées une seule fois pourraient gagner cette bataille. À l’heure actuelle, nous n’avons aucune preuve que les personnes doublement vaccinées l’emporteront, car leur nombre de cas continue de s’aggraver par rapport aux personnes non vaccinées, et les personnes vaccinées ont moins de chances qu’elles.

 

 

 

 

 

 

 

 

 

Donc en supposant que la hausse exponentielle à laquelle nous avons assisté en 2021 se poursuivra tout au long de 2022. Voici l’avenir de la mortalité cardiaque.

Les derniers chiffres ourworldindata (John’s Hopkins University) pour les personnes entièrement vaccinées dans le monde sont de 51,6 % (22 janvier). Donc, pour simplifier, en supposant que personne n’est assez téméraire pour prendre une nouvelle vaccination après avoir lu cet article, nous supposerons un ratio de 50:50 non vaccinés à entièrement vaccinés tout au long de 2022.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

La plupart des gens ne sont pas des footballeurs professionnels et même les footballeurs eux-mêmes ne passent qu’une petite partie de leur vie à jouer sur le terrain. Ainsi, la projection des décès cardiaques en 2022 n’utilise que les chiffres des sédentaires entièrement vaxxés, en se rappelant que le taux de mortalité cardiaque normal dans le monde est de 8,9 millions par an ou 2,225 millions par trimestre.

Cela se traduit par 1,1125 million par trimestre pour les 50 % qui ne sont pas vaccinés et 2,225 par trimestre pour les 50 % qui sont entièrement vaccinés au quatrième trimestre 2021. Nous extrapolons ensuite de manière exponentielle à partir de là sur la base de l’augmentation exponentielle des décès de footballeurs observés et catalogués dans 2021 qui double chaque trimestre.

Ainsi, en 2022, plutôt que de voir les 8,9 millions de décès cardiovasculaires normaux , nous verrons 71,2 millions, soit une augmentation de 62,3 millions de décès.

À ce moment-là, les vaccins auront tué plus de personnes que le SIDA – simplement à cause de crises cardiaques. Cela exclut les décès dus au SIDAV et à la dégénérescence neurologique médiée par le vaccin . Nous sommes près de 8 milliards. Donc 62,3 millions, c’est moins de 1% de l’humanité. Mais ce sera le plus grand génocide jamais commis sur nous par nos propres gouvernements, si la production de protéines de pointe continue au rythme actuel chez les personnes entièrement vaccinées.

Source   sur   


EN COMPLÉMENTAIRE

En 2021, il y eu autant de décès de footballeurs FIFA que durant les 12 dernières années

 

Des recherches approfondies ont révélé que les décès de joueurs de football/football professionnels dus à des problèmes cardiovasculaires doublent tous les trois mois, le nombre de décès survenus en décembre 2021 étant égal à la moyenne annuelle des 12 années précédentes.

Au total, les décès parmi les footballeurs/footballeurs professionnels en 2021 étaient 4 fois supérieurs au taux moyen enregistré entre 2009 et 2020.

 

 

 

 

 

 

 

 

 

Les Exposéest maintenant fortement censuré par Google, Facebook, Twitter et PayPal. Ne perdons pas le contact, abonnez-vous aujourd’hui pour recevoir les dernières nouvelles de L’Exposé est votre boîte de réception…


Le tableau suivant montre le nombre total de décès lors de matchs de football de la Fifa répertoriés et de décès de matchs de football cardiovasculaires masculins survenus chaque année depuis 2009.

Les données du tableau ont été obtenues à partir des éléments suivants –

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Les données montrent que les joueurs de football/football professionnels sont décédés de problèmes cardiovasculaires pendant les matchs (match ou entraînement) à 4 fois le taux moyen enregistré entre 2009 et 2020.

Elles révèlent également qu’il y a eu plus de 15 fois plus de décès dus à des problèmes cardiovasculaires en 2021 qu’il n’y en avait en 2020.

Mais ce qui est le plus préoccupant, c’est qu’il y a eu 3,5 fois plus de décès en décembre 2021 qu’il n’y en a eu sur l’ensemble de 2020, et il y a eu presque autant de décès en décembre 2021 (7) que le taux annuel moyen sur les 12 dernières années (7,8 par an).

Et le vrai problème c’est ça…

 

 

 

 

 

 

 

 

 

 

 

 

 

Les décès cardiovasculaires chez les footballeurs professionnels doublent chaque trimestre. Ainsi, fin 2022, ils pourraient être passés à 320 par trimestre (40, 80, 160, 320). Le conseil donné aux footballeurs qui s’effondrent mais qui survivent est de cesser toute activité intense pendant 3 mois. Ces chiffres révèlent que tous les athlètes vaccinés contre le Covid-19 devraient faire la même chose.

 

 

 

 

 

 

 

 

 

Notre enquête sur les données disponibles montre que les décès cardiovasculaires liés aux matchs de football professionnel dans le monde en 2021 étaient 300 % plus élevés que la moyenne sur 12 ans, le nombre de décès survenus en décembre 2021 étant à lui seul égal à la moyenne de 2009-2020.

Les autorités compétentes enquêteront-elles également avant qu’il ne soit trop tard ?

Date Nom âge Club
07/01 Alex Apolinário 24 Alverca Le 3 janvier 2021, a fait un arrêt cardiaque à la 27e minute d’un match de championnat. Il a été réanimé après plusieurs tentatives et transporté à l’hôpital, où il a été plongé dans un coma artificiel et est décédé quatre jours plus tard. – Liste Wikipédia
08/03 Abdul Rahman Atef 23 Al-Qanayat Décédé lors d’un match de championnat contre El Rowad.- A avalé sa langue Liste Wikipedia (Exclu)
11/04 Dejan Oršuš 24 NK Otok S’est effondré lors d’un match de championnat contre Radnički après avoir subi un arrêt cardiaque, est décédé à l’hôpital plus tard le même jour. Liste Wikipédia
18/04 Tremaine Stewart 33 Portmore United Stewart s’est effondré en jouant au football le matin du 18 dans la ville espagnole, et bien qu’il ait été transporté d’urgence à l’hôpital, il est décédé plus tard dans la journée. Liste Wikipédia
01/06 Giuseppe Perrino 29 Parme Un footballeur italien meurt d’une crise cardiaque lors d’un match commémoratif pour son défunt frère
22/06 Viktor Marcell Hegedüs 18 Andrashida SC Effondré lors d’un échauffement d’entraînement. Un défibrillateur a été utilisé. Liste Wikipédia
16/07 Imad Bayoumi 45 Retraité A souffert d’un collapsus circulatoire lors d’un match amical Liste Wikipedia (Exclu)
23/07 Tim Braun 27 SV Hamberge (Schleswig-Holstein) S’est effondré et est mort après un tournoi de football. – https://www.sportbuzzer.de/artikel/deutschlandweiter-zuspruch-nach-der-tragodie-beim-sv-hamberge/
12/08 Lee Moïse 29 Palmerston North Marist FC Nouvelle-Zélande Il a souffert de douleurs à la poitrine lors d’un entraînement à la Central Energy Trust Arena de Nouvelle-Zélande et est décédé des suites d’une crise cardiaque inattendue, laissant derrière lui sa partenaire Tori Batley, 26 ans, et deux jeunes enfants. – https://www.stuff.co.nz/manawatu-standard/news/300387209/young-father-and-footballer-dies-of-heart-attack-during-training
16/08 Samuel Kalou 24 Bordeaux Un footballeur professionnel fait un arrêt cardiaque pendant un  match
28/08 Alexandre Chichmarev 23 Krasnaïa Zvezda Alexander Shishmarev, 23 ans, jouait en tant que gardien de but lors d’un match d’entraînement russe lorsqu’il est entré en collision avec un adversaire, a été soigné pendant « plus d’une heure » avant de décéder – Il a avalé sa langue et s’est étouffé – Liste Wikipedia (exclue)
2 /09 Dylan riche 17 Colts de West Bridgford Un jeune footballeur décédé après avoir subi un arrêt cardiaque présumé lors d’un match. Liste Wikipédia
4/09 Jens De Smet 27 FCC Filosoof Drame sur un terrain de football néerlandais, le joueur amateur Jens (27 ans) s’effondre et meurt. Liste Wikipédia
10/09 Frédéric Lartillot 25 Association des vétérans du football de Nurieux-Volognat. S’effondre dans les vestiaires, décède suite à une crise cardiaque après le match. https://www.leprogres.fr/culture-loisirs/2021/09/11/deces-d-un-joueur-de-foot-apres-un-match-ses-coequipiers-ont-tout-tente-pour- le-sauver
25/09 Guillermo Arias 31 Camaguán FC En quart de finale du tournoi de troisième division, Arias s’est effondré sur le terrain et est décédé d’un arrêt cardiaque. Liste Wikipédia
1/10 Bruno Stein 15 FC An der Fahner Höhe Le jeune gardien et pêcheur amateur Bruno Stein du FC An der Fahner Höhe est décédé à l’âge de 15 ans. Liste Wikipedia
03/10 Nils de loup 27 Club de football belge White Star Sombeke A subi une crise cardiaque après avoir joué contre le Verrebroek. A subi une RCR à l’aide d’un défibrillateur, mais est décédé à l’hôpital trois jours plus tard. – https://new.in-24.com/sport/soccer/215813.html
04/10 Alexandre Siegfried 42 VfB Moschendorf Allemagne S’effondre subitement et meurt. – https://www.anpfiff.info/sites/cms/artikel.aspx?SK=10&Btr=95991&Rub=390
08/10 Benoit Sabard 49 SC Massay A 20 minutes de la fin de la partie, Benoît s’effondre. Liste Wikipédia
09/10 Benjamin Taft 31 Capitaine du SC Großschwarzenlohe S’est effondré d’une crise cardiaque après un match et est décédé. https://www.sc-grossschwarzenlohe.de/wir-trauern-um-benjamin-taft/
15/10 Christophe Ramassamy 54 AS Saint-Yves Christophe Ramassamy, footballeur de 54 ans, a été victime d’une crise cardiaque mortelle. A peine après 20 minutes de jeu, il s’effondre sur le terrain. Les secours n’ont rien pu faire pour le ranimer, Liste Wikipédia
17/10 João Santos Alankar 38 FC Bruski Brésil Arrêt cardiaque soudain à Blumenau lors du championnat de Santa Catarina et mort. https://www.world-today-news.com/former-brusque-player-dies-after-suffering-a-heart-attack-during-game/
29/10 Mahomet Islam 30 Raqiz, Pakistan Raqiz jouait Millat dans le tournoi de la coupe du commissaire provincial du Balouchistan à Chaman. Il s’est effondré pendant le match en raison d’une crise cardiaque et est décédé sur le chemin de l’hôpital –  https://www.gurualpha.com/news/players-die-of-heart-attack-during-football-match/
07/11 Neslon Solano 21 1er mars Club St Antonio, Paraguay Club March1 dans le quartier Candida Achucarro de San Antonio au Paraguay. Solano a joué la première mi-temps puis a été retiré pour la 2e mais est sorti pour célébrer sur le terrain avec ses coéquipiers à la fin du match lorsqu’il s’est effondré. Il a été emmené à l’hôpital de Nemby où il est décédé – https://www.abc.com.py/nacionales/2021/11/07/joven-futbolista-fallece-de-un-infarto-despues-de-un-partido/
12/11 Jony Lopez 16 Sol del Este Paraguay A subi une crise cardiaque mortelle en jouant au football – Liste Wikipedia – https://radioconcierto.com.py/2021/11/12/futbolista-infarto-durante-practica/
17/11 Adonis Villanueva 27 Deportivo del Este Milieu de terrain – « Lors d’une séance d’entraînement au Club Deportivo del Este, Villanueva a reçu un impact au crâne. Il a pris sa retraite de l’entraînement, mais un peu plus tard, alors que le joueur déjeunait, il a subi une crise cardiaque pour laquelle il a été admis dans un centre médical voisin. Selon diverses sources, l’  incident du footballeur  n’était pas dû à un coup, mais à une crise cardiaque dans l’artère cérébrale moyenne gauche, quelque chose d’étrange chez un si jeune joueur ». https://lanoticia.digital/espana/muere-adonis-villanueva-futbolista-panama-27-anos-tras-recibir-golpe
17/11 Aleksandar Krsic 30 FK Radnicki Le joueur de football de Ratkov s’est effondré avec un arrêt cardiaque pendant l’entraînement Il est décédé dans l’ambulance en route vers le centre clinique de Novi Sad – https://www.b92.net/sport/fudbal/vesti.php?yyyy=2021&mm=11&dd=19&nav_id= 2059126
26/11 Guimbala Tounkara 34 Police de l’AS Nous avons commencé l’entraînement à 8h et avons fini à 10h à la fin de la séance d’entraînement il a dit : à demain coach. Il est mort une heure plus tard. Police du club AS – https://www.afribone.com/disparition-guimbala-tounkara-le-petit-grand-milieu-de-terrain-sen-est-alle/
17/12 Karol Setniewski 13 Znicz Pruszków Maux de tête et mort après le match – Liste Wikipedia – https://sport.interia.pl/pilka-nozna/news-zmarl-mlody-pilkarz-karol-setniewski,nId,5715824 seulement 13 ans (exclu)
22/12 Ahmed Amine 23 Al Rebat et Al Anwar SC Le gardien Ahmed Amin s’est effondré dans le vestiaire de l’équipe après avoir subi un arrêt cardiaque soudain après une séance d’entraînement. Immédiatement, les tentatives de réanimation du joueur ont échoué. Le joueur a ensuite été transporté d’urgence dans un hôpital à proximité, mais il est rapporté qu’il est décédé en cours de route – Liste Wikipedia –   https://afroballers.com/egyptian-player-dies-after-collapsing-in-dressing-room/amp/
22/12 Taufik Ramsyah 20 Tornado FC Pekanbaru Le gardien de but a subi une fracture du crâne après être entré en collision avec un joueur du Wahana FC lors d’un match de Liga3 Riau. Taufik a succombé à ses blessures après avoir été dans le coma pendant plusieurs jours et avoir subi une intervention chirurgicale pour sa fracture du crâne. Liste Wikipédia (exclue)
22/12 Adrien Sandjo 18 Piémont et Vallée d’Aoste Le footballeur U19 de l’équipe régionale du Piémont et du Val d’Aoste s’est effondré sur le terrain avec un arrêt cardiaque, déclaré en état de mort cérébrale après six heures d’observation à l’hôpital Molinette. – https://www.italy24news.com/sports/news/181944.html et https://tg24.sky.it/torino/2021/12/24/torino-malore-calciatore-ragazzo
23/12 Mukhaled Al-Raqadi 29 Club de Mascate Effondré pendant l’échauffement, pour le match contre Suwaiq Club dans la ligue Omantel – Liste Wikipedia . https://www.marca.com/en/football/2021/12/25/61c7671ce2704eac9d8b45c2.html
23/12 Marin Ćaćić 23 NK Nehaj Décédé à l’hôpital, après un arrêt cardiaque le 21 décembre 2021 lors d’un entraînement – Liste Wikipedia . https://g3.football/marin-cacic-dead-aged-23-croatian-defender-dies-in-hospital-just-days-after-collapsing-during-training-session/
25/12 Sofiane Loukar 30 MC Saïda Effondré au milieu d’un match et mort sur le coup – Liste Wikipedia – https://www.mirror.co.uk/sport/football/news/marcos-menaldo-dead-heart-attack-25850291.amp
30/12 Alioune Badara Wade 28 Club universitaire de Dakar Attaquant de football avec le club sénégalais de deuxième division Dakar University Club. Il s’est effondré pendant l’entraînement avec un arrêt cardiaque et n’a pas pu être réanimé.
https://twitter.com/Cinara_Brasil/status/1477874289823072256

EN CONCLUSION

Ces urgences sanitaires prouvent-elles que les vaccins obligatoires Covid sont à blâmer ? Absolument pas. En fait, de nombreux professionnels de la santé qui ont été cités dans les médias à propos de ces incidents sont enclins à mettre en cause la « coïncidence ». Le Daily Mail est allé jusqu’à dire que de nombreux scientifiques ont rejeté la suggestion selon laquelle les vaccins étaient suspects, « en particulier alors que le pays se prépare à une possible vague de nouveaux cas et décès dus au Covid après la découverte de la variante Omicron. »

La conclusion de Reuters, après consultation d’un certain nombre d’experts médicaux, était presque identique : « Aucune preuve que les vaccins COVID-19 soient liés aux athlètes qui s’effondrent ou meurent de myocardite. »

Néanmoins, la soudaine vague d’urgences sur le terrain soulève des questions chez plusieurs vétérans chevronnés du sport.

« Au cours de mes 19 années en tant que footballeur professionnel et de mes plus de 20 années d’observation et de commentaires, je n’ai jamais vu AUCUN joueur s’effondrer, s’évanouir, etc., que ce soit en direct ou au cours des milliers de séances d’entraînement et de matchs auxquels j’ai participé », a fait remarquer l’ancien footballeur professionnel Kevin Gage sur Twitter.

L’ancienne star anglaise Trevor Sinclair, parlant de l’incident impliquant Fleck sur la station de radio TalkSport, a commenté : « Je pense que tout le monde veut savoir s’il (Fleck) a reçu le vaccin Covid ».

 

 

Trevor Sinclair
@trevor8sinclair
Everyone I speak to about these heart problems suffered by footballers (which worryingly seem to be happening more regularly) are they linked to covid vaccines or not??
10,2 k
Voir les dernières informations sur le COVID-19 sur Twitter

 

Anecdotes mises à part, y a-t-il quelque chose dans la littérature médicale qui suggère qu’une cause et un effet sont en jeu ? La réponse est affirmative, car diverses études indiquent que les vaccins peuvent entraîner des problèmes de santé. Pourtant, ces risques, bien que rares, sont minimisés par les médias sociaux et grand public.

Au début du mois de novembre, l’American Heart Association, que l’on ne peut pas soupçonner d’être un groupe complotiste, a publié un rapport intitulé « Abstract 10712 : Les vaccins ARNm anti COVID augmentent de façon spectaculaire les marqueurs inflammatoires endothéliaux et le risque d’accidents cardio vasculaire mesuré par le test cardiaque PULS : un avertissement ».

La conclusion de l’AHA semble mériter une certaine attention : « Nous concluons que les vacs mRNA augmentent considérablement l’inflammation sur l’endothélium et l’infiltration des cellules T dans le muscle cardiaque et peuvent expliquer les observations de thrombose accrue, de cardiomyopathie et d’autres événements vasculaires après la vaccination. »

Malgré la réputation de l’AHA, Twitter a apposé un timbre d’avertissement sur le lien vers l’étude, affirmant qu’elle pourrait être « dangereuse ».

Pendant ce temps, le premier coup d’œil sur les données de l’essai du vaccin Covid-19 de Pfizer – qui sont publiées au rythme atrocement lent de 500 pages par mois, ce qui signifie que la divulgation complète n’aura pas lieu avant l’année 2076 – n’incite guère à la confiance.

Zerohedgecitant le journaliste Kyle Becker, rapporte qu’« il y a eu un total de 42.086 rapports de cas pour des effets indésirables (25.379 confirmés médicalement, 16.707 non confirmés médicalement), couvrant 158.893 événements au total.

Plus de 25.000 de ces événements ont été classés comme « troubles du système nerveux ».

Encore une fois, rien de tout cela ne prouve que les vaccins soient à blâmer pour l’augmentation apparente des évanouissements qui se produisent actuellement lors de divers événements sportifs. En effet, il a été suggéré que le vaccin Covid-19 lui-même pourrait être à l’origine de l’augmentation de la fréquence des arrêts cardiaques par le biais « d’une certaine réponse inflammatoire », a déclaré à WebMD le Dr Satjit Bhusri, cardiologue à l’hôpital Lenox Hill de New York.

Le fait est que nous ne savons tout simplement pas. Alors que le monde navigue péniblement à travers cette période d’obscurité, le long d’un littoral criblé de formations rocheuses dangereuses, il semblerait sage de n’écarter aucune possibilité, aussi troublante soit-elle. C’est la seule façon de permettre à la science de déterminer les faits, sans préjugés. En revanche, ignorer l’autre partie du débat en la qualifiant de « théorie du complot » empêchera la nécessaire discussion d’avoir lieu, ce qui pourrait bien être le but d’un tel jeu risqué.

–  Ian Matos: 32-year-old Olympic diver dead 19 weeks after COVID-19 “vaccine,” likely antibody dependent enhancement
–  Fabien Stocco: French man laments “all this for a vaccine I didn’t want” after developing life-altering pericarditis from Pfizer injection
–  Carlos Tejada: 49-year-old Wall Street Journal and New York Times writer posts booster shot photo on Instagram, dead hours later
–  Jayde Stapleton: Australia woman says “Pfizer vaccine ruined my life” after post-injection Guillain-Barré, dysautonomia diagnoses
–  Oscar Cabrera: Spain basketball player collapses on the court, while U.S. sports league suffer mass COVID-19 outbreaks among fully vaccinated players
–  Albert Owusu Sarpong: 20-year-old Ghana student’s post-injection death highlights the importance of diligent reporting

 


–  Ian Matos: un plongeur olympique de 32 ans est décédé 19 semaines après le «vaccin COVID-19», probablement une amélioration dépendante des anticorps

–  Fabien Stocco : un Français déplore « tout ça pour un vaccin dont je ne voulais pas » après avoir développé une péricardite qui a changé sa vie à cause d’une injection de Pfizer
–  Carlos Tejada: un écrivain du Wall Street Journal et du New York Times, âgé de 49 ans, publie une photo de rappel sur Instagram, mort quelques heures plus tard
–  Jayde Stapleton : une Australienne dit que « le vaccin Pfizer a ruiné ma vie » après l’injection de Guillain-Barré, diagnostic de dysautonomie
–  Oscar Cabrera: un basketteur espagnol s’effondre sur le terrain, tandis que la ligue sportive américaine subit des épidémies massives de COVID-19 parmi les joueurs entièrement vaccinés
–  Albert Owusu Sarpong : le décès post-injection d’un étudiant ghanéen de 20 ans souligne l’importance d’un reportage diligent

N’OUBLIEZ PAS DE FAIRE UN PETIT DÉTOUR SUR NOTRE BOUTIQUE EN LIGNE

Sur ce lien,mes ami(e)s,svp:VintageparMichel

 

 

 

Résistance au Nouvel Ordre Mondial:le « Convoi de la liberté » entame son siège à Ottawa pour faire plier Justin Trudeau

Accueillis en héros par les manifestants, mais camouflés par la majorité des médias, plusieurs milliers de camionneurs arrivent à Ottawa ce 28 janvier, après un long voyage de protestation. Ils rejoignent ainsi le « Freedom Convoy » (« convoi pour la liberté ») aux côtés d’une impressionnante foule de manifestants. Les participants au rassemblement arriveront entre aujourd’hui et demain et resteront pour une durée indéterminée. L’objectif est de siéger la capitale jusqu’à ce que Justin Trudeau lève la vaccination obligatoire, ainsi que le passeport vaccinal.

 

 

 

 

 

 

Ils sont partis des quatre coins du pays, sont rejoints par d’autres camionneurs étrangers, et ont levé plus de six millions de dollars en moins de deux semaines à travers la plateforme de dons GoFundMe. Alors qu’ils arrivent sur Ottawa, Justin Trudeau, de son côté, est déclaré cas contact et doit donc s’isoler chez lui.

Deux camps médiatiques très inégaux

À l’étranger, le mouvement est très majoritairement tu. Sur place, entre le Canada et les États-Unis, les médias s’écharpent entre eux et transmettent deux informations bien différentes.

D’un côté, le Journal de Montréal prévoit « 10 000 manifestants » et « 2 700 camions », relevant d’ores et déjà « une rhétorique complotiste », la présence de « groupes d’extrême droite », et une similitude avec l’invasion du Capitole aux États-Unis. Ils écrivent aussi que la sécurité « craint des débordements violents », notamment parce que Catherine McKenney, une conseillère municipale, leur a dit que les manifestants « ne sont pas là juste pour lever la voix contre les obligations vaccinales, mais pour nourrir la haine contre notre tissu social ». Une vision des choses qui est sans surprise partagée par le Premier ministre canadien, Justin Trudeau, qui n’a pas hésité à qualifier le mouvement de « frange minoritaire, qui ne représente pas le point de vue des Canadiens », s’appuyant sur les « 90 % de camionneurs vaccinés », tout en appelant à ce que « tout le monde se vaccine ».

De l’autre côté, la chaîne d’information américaine Fox News se met en branle pour mettre en avant le mouvement. Ils ont accordé une interview à Theo Fleury, double médaillé d’or aux Jeux Olympiques en hockey, pour qu’il donne son impression sur l’événement. Après s’être ouvertement moqué de Justin Trudeau, lui prêtant volontiers un « syndrome de dérangement vaccinal », il assure que « 50 000 camionneurs et 1,4 million de personnes se retrouveront devant le Parlement à Ottawa, et ils vont y rester jusqu’à ce que Trudeau démissionne ou qu’ils nous rendent toutes nos libertés et tous nos droits. » Des chiffres qui sont largement partagés par les soutiens du mouvement sur les réseaux sociaux.

Deux des plus gigantesques figures médiatiques se sont aussi exprimées en faveur du convoi : Joe Rogan, qui en a parlé dans son podcast (le plus écouté des États-Unis), et Elon Musk, qui s’est fendu d’un habile tweet, faussement mystérieux : « Les camionneurs canadiens règnent. » On ne sait donc pas s’il parle des 90 % défendus par Justin Trudeau, ou des 10 % qui semblent former le convoi. On peut toutefois deviner sa position en lisant son deuxième tweet, juste en dessous : « Les radios citoyennes sont libres de tout contrôle gouvernemental ou médiatique. »

Bientôt un convoi en Europe ?

L’ampleur du mouvement, si elle est étouffée par la plupart des médias, semble avoir insufflé un vent de révolte de l’autre côté de l’Atlantique. Idriss Aberkane s’est fait le relai d’un appel européen, qui voudrait voir un convoi se former de la même façon qu’au Canada pour rouler jusqu’à Bruxelles.

 

Au Canada, manifestants et camionneurs se préparent en fanfare pour le « convoi de la liberté »

 

 

 

 

 

 

Au Canada, des centaines de camionneurs opposés à l’obligation vaccinale se sont mis en route dimanche, partant de Vancouver, pour rouler jusqu’à Ottawa. L’arrivée est prévue pour le vendredi 28. Là-bas, ils doivent retrouver le « convoi pour la liberté », un rassemblement de manifestants opposés aux mesures sanitaires. Leur trajet, qu’ils ont voulu le plus lent possible, pour ralentir le trafic, ne se fait pas sans embûches.

Un mouvement qui se veut solidaire

Leur objectif : faire reculer le gouvernement concernant l’obligation vaccinale requise pour passer la frontière. Cela étant, les participants ne s’arrêtent pas là, et souhaitent que l’obligation vaccinale soit levée pour tous les corps de métiers : « Permettons à tout le monde de retourner au travail et mettons fin à cette rhétorique divisive et discriminatoire », a confié un camionneur au Vancouver Sun.

Cette solidarité n’est pas sans rappeler le mouvement des dockers de Trieste, en Italie, qui avaient vivement protesté en octobre dernier. Là aussi, la protestation semble être bien accueillie par les Canadiens.

Dans un article du Journal de Montréal, on lit aussi que « certains élus conservateurs ont publiquement affiché leur soutien ». Parmi eux, le politicien Andrew Scheer, qui s’est attaqué à la politique de Justin Trudeau sur Twitter en félicitant les camionneurs : « Merci aux camionneurs ! Trudeau s’attaque à la liberté individuelle et menace la capacité de tout le monde à faire son épicerie à cause de sa surenchère dans les mandats de vaccination. Il est la plus grande menace pour la liberté au Canada », a-t-il écrit.


Ce dont le Canada a besoin, c’est une « quarantaine politique » de Justin Trudeau

 

Un mouvement de masse contre le mandat Covid se déroule d’un océan à l’autre à travers le Canada en solidarité avec les camionneurs transfrontaliers. Des dizaines de milliers de personnes se joindront aux camionneurs à Ottawa. 

Selon Justin Trudeau, les camionneurs non vaccinés « peuvent présenter un risque de transmission de la COVID-19 au grand public ». Quelle absurdité. Les camionneurs restent pour la plupart du temps dans leur camion, ils effectuent des tâches administratives et supervisent le chargement et le déchargement. Ils livrent les marchandises et ont des contacts limités avec les grand public.

Tous les camionneurs transfrontaliers devront « être vaccinés afin d’éviter une quarantaine de 14 jours », précise Justin Trudeau.

 

Trudeau a-t-il été vacciné ?

Est-ce pertinent pour le Convoi de la liberté en solidarité avec les camionneurs ? Le Premier ministre exige que les camionneurs soient vaccinés. Justin a-t-il été vacciné ?

Vérifiez-le et décidez par vous-même : il y a des indications, encore à confirmer, que le premier ministre Trudeau n’a pas été vacciné.

Voir vidéo, témoignage et analyse de Registered Nurse ).

cliquez sur l’image ci-dessous

 

 

 

 

 

 

 

Le commerce entre les États-Unis et le Canada constitue la pièce angulaire de notre économie nationale

Les précédents gouvernements canadiens ont protégé les structures du commerce transfrontalier nord-américain. Et maintenant, Justin Trudeau nous a entraînés dans le plus grand gâchis économique de l’histoire de notre pays, tout en violant les droits fondamentaux des Canadiens.

Ce dont nous avons besoin ici au Canada, c’est d’une «quarantaine politique» indéfinie de notre non illustre premier ministre. 

Je peux dire en tant qu’économiste que cette décision irresponsable du gouvernement Trudeau (qui est en cours) aura des impacts dévastateurs sur les producteurs, les camionneurs, les compagnies de transport ainsi que sur tout le réseau du commerce de gros et de détail. Cela nous affectera tous.

Il est prouvé que le commerce transfrontalier est délibérément miné. Ce mandat politique crée déjà des pénuries de biens essentiels, notamment de la nourriture, du carburant et des produits pharmaceutiques. Cela affectera également la livraison de produits essentiels expédiés via les États-Unis depuis la Chine, l’Union européenne et l’Amérique latine.

Nous devons veiller à ce que le commerce transfrontalier entre les États-Unis, le Canada et le Mexique soit pleinement rétabli.

Tous les mandats covid-19 doivent être dûment suspendus.

Nous devons affronter et questionner la légitimité du gouvernement Trudeau.

Nous devons engager un dialogue impliquant les camionneurs, les propriétaires des sociétés de transport, les forces de l’ordre, les douaniers des deux côtés de la frontière, les producteurs, les grossistes, les détaillants.

Le gouvernement dira : Nous nous engageons à sauver des vies, à protéger les gens contre « V le virus ». Quelle absurdité. Ils manipulent le commerce transfrontalier. Ils détruisent la vie des gens.

Le gouvernement Trudeau est corrompu. Cette décision lourde de conséquences a été prise au nom de puissants intérêts financiers.  Son intention tacite est de déclencher une nouvelle vague de faillites.

Il est important que les mandats et les restrictions du gouvernement en matière de Covid-19 soient levés et que le commerce transfrontalier soit protégé et soutenu.

#Oui, c’est un vaccin tueur

Les différents mandats de Covid ont été utilisés pour mener la campagne de peur et encourager les Canadiens à prendre leur nouvelle dose de vaccin (booster).

Alors que les médias répètent sans cesse que le virus est plus dangereux que le vaccin, les effets dévastateurs du vaccin à ARNm sont maintenant confirmés de manière irréfutable.

Les chiffres officiels des décès liés au vaccin signalés sont régulièrement publiés par les États-Unis, le Royaume-Uni et l’UE. Ils ne sont pas publiés par Santé Canada. Voir la déclaration de Doctors for Covid Ethics .

Selon le dernier rapport du VAERS : 

« Il y a eu plus de décès, plus d’invalidités permanentes et plus d’hospitalisations à la suite des vaccins expérimentaux COVID-19 [aux États-Unis], qu’il n’y en a eu après tous les vaccins approuvés par la FDA au cours des 31 dernières années combinées. »

De plus, les effets dévastateurs du vaccin sont maintenant confirmés par un  rapport confidentiel de Pfizer publié en novembre dans le cadre d’une procédure d’accès à l’information (FOI) . Les données sur les décès et les événements indésirables enregistrés par Pfizer dans ce document confidentiel sont désormais dans le domaine public. Ils ne voulaient pas que nous le lisions :

Ce qui est contenu dans le rapport « confidentiel » de Pfizer est une preuve détaillée des impacts du « vaccin » sur la mortalité et la morbidité. Ces données qui émanent de la « bouche du cheval » peuvent maintenant être utilisées pour affronter ainsi que formuler des procédures judiciaires contre Big Pharma, les gouvernements, l’OMS et les médias.

Il s’agit de facto d’un Mea Culpa de la part de Pfizer. #Oui, c’est un vaccin tueur.

L’ initiative Convoi de la liberté  se concentre sur le contexte politique plus large, en vue de confronter le gouvernement Trudeau et d’abroger le récit de Covid-19 et ses divers mandats politiques, y compris le vaccin à ARNm.

Ce mouvement ne doit pas être détourné de son objectif. Il doit se concentrer sur l’abrogation immédiate du vaccin à ARNm, qui a entraîné une tendance à la hausse de la mortalité et de la morbidité.

Il est essentiel de dissiper les mensonges.

Le test Covid-19 est invalide. Les données utilisées pour justifier les mandats Covid-19 n’ont aucun sens

Le test RT-PCR qui est utilisé par les gouvernements pour justifier leurs mandats politiques a maintenant été déclaré invalide à la fois par l’OMS et le CDC (qui a demandé son retrait aux États-Unis à compter du 31 décembre 2021).

Toutes les données relatives aux soi-disant « Cas Covid confirmés » résultant du test PCR sont totalement invalides.

Les kits de test rapide Covid-19 à domicile

En novembre 2021, 94 millions de kits de test rapide à domicile (kits d’autotest et de test antigénique) ont été livrés et distribués aux provinces, et 140 millions de kits supplémentaires ont été commandés par le gouvernement fédéral au début janvier pour un coût de 1,7 milliard de dollars.

Tester Tester Tester : 

Le Canada compte 38,5 millions d’habitants et nous avons maintenant 234 millions de kits de test rapide qui ont contribué au cours des deux derniers mois à faire grimper les cas dits positifs du Covid-19.

Cela a créé la panique dans les familles partout au Canada. La campagne de peur est passée à la vitesse supérieure.

Ironiquement, les kits d’antigène et d’auto-test recommandés par Santé Canada sont classés comme moins fiables que le test PCR qui est maintenant reconnu comme «l’étalon-or» .  Le test PCR est totalement dysfonctionnel. Il ne Il ne permet pas de détecter et  d’identifier le SARS-CoV-2.

Tous ces chiffres sur les « cas confirmés de Covid-19 » n’ont aucun sens.

Les chiffres officiels (Royaume-Uni, États-Unis, UE) sur les décès et les effets indésirables liés au vaccin sont RÉELS.

Le convoi canadien pour la liberté :  première étape vers le développement d’un vaste mouvement de masse

Le mouvement Convoi de la liberté a l’appui de de plus de 65 pays. Les camionneurs australiens enverront un convoi à Canberra le 31 janvier.

Plus de 60 000 camionneurs des États-Unis dont 15 000 de la Californie traverseront la frontière et se retrouveront à Ottawa pour cet événement important.

Dans un sondage en ligne de CTV, 77 % des Canadiens ont voté en faveur du Convoi pour la liberté en appui aux  camionneurs. (sur 17 698 suffrages exprimés). 12.3o pm (27 janvier).

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Un nombre imposant de véhicules dans le secteur du parlement à Ottawa

 

Un nombre impressionnant de véhicules avait envahi le centre-ville d’Ottawa dans le secteur du parlement, vendredi soir.

La mobilisation des camionneurs a commencé à prendre forme dans l’après-midi devant le parlement. De nombreux manifestants provenant du Québec font partie des opposants contre la vaccination obligatoire des camionneurs transfrontaliers et autres mesures sanitaires.

Sur la rue Wellington devant le parlement, un Sherbrookois, assis sur la portière d’un véhicule en marche, anime la foule en jouant du tambour.  «Enough is enough man! on veut notre liberté!» lance le manifestant, tout sourire, au journaliste de La Presse Canadienne. 

Dans le véhicule qui le précède, le conducteur brandit une pancarte sur laquelle il est écrit «Nous sommes les marginaux!». 

«Trudeau nous traite de marginaux. Il verra samedi qu’est ce que des marginaux sont capables de faire», a prévenu le conducteur à La Presse Canadienne. 

En fin d’après-midi, ils étaient plusieurs centaines devant la colline du Parlement où beaucoup de drapeaux du Québec se mêlaient aux drapeaux patriotes, à ceux du Canada et aux pancartes affichant des slogans hostiles au premier ministre Justin Trudeau. 

 

 

 

 

 

 

 

 

 

Paul Poulin, un vétéran du Royal 22e Régiment, s’est déplacé au parlement dans le but de faire «tomber toutes les restrictions» et il promet de «rester le temps qu’il faudra». 

«Quand la vérité sortira, c’est triste à dire, mais il y a des gens qui devront passer au jugement», a expliqué l’homme vêtu d’un uniforme milliaire avant d’ajouter en désignant le parlement: «Si vous vous demandez si je suis un complotiste, moi je ne fais pas de complot, aller dans la grosse cabane derrière moi si vous voulez trouver des complots». 

Le camionneur André Landry a fait la route depuis Grand-Remous avec sa femme pour manifester. Les deux refusent de se faire vacciner. «Je suis assez raide que les aiguilles ont cassé quand ils ont essayé de me vacciner», a plaisanté le camionneur plutôt costaud qui ne croit pas en l’efficacité des vaccins. 

 

 

 

 

 

 

 

 

«Je ne peux plus aller aux États-Unis, mais c’est pas grave, dans mon boute j’ai de l’ouvrage en masse», a-t-il expliqué en disant qu’il manifeste par solidarité pour ses collègues, mais aussi pour que cessent «toutes, toutes, toutes les restrictions». 

Interrogé sur la possibilité que des groupes mal intentionnés se servent de la cause des camionneurs pour commettre des actes déplorables, André Landry a répondu «qu’icitte c’est toute du monde pacifique, à part si des antifas cherchent à faire du trouble». 

Quand le journaliste de La Presse Canadienne lui fait remarquer que quelques minutes plus tôt, trois hommes l’ont entouré en lui lançant des insultes et en criant «f… you! get away now!», le forçant ainsi à quitter les lieux en plein milieu d’une entrevue, le camionneur de Grand-Remous garde le sourire et explique que c’est parce «qu’il y a plein de monde comme vous autres qui content des menteries».

Selon lui, et plusieurs manifestants rencontrés devant le parlement, les journalistes, les médecins et les politiciens mentent à la population. 

Une grande mobilisation samedi

Pendant ce temps, plusieurs convois en provenance de plusieurs régions du pays se préparent à la grande mobilisation de samedi dans la capitale.

À Les Coteaux en Montérégie, Dominick Prud’homme en était aux derniers préparatifs vendredi après-midi d’un convoi qu’il organise dans sa région.

Il est doublement vacciné, sa femme, qui l’accompagnera dans la capitale samedi, l’est également.

«On est vacciné, on est quelques autos qui partons, tous des vaccinés ensemble», a mentionné M. Prud’homme.

«J’ai embarqué dans ce mouvement-là principalement parce que je suis contre le passeport vaccinal», a-t-il dit avant d’ajouter: «Je me demande jusqu’à quel point là on va continuer de viser les non-vaccinés et leur enlever des droits?».

Il a expliqué à La Presse Canadienne qu’il avait suivi la plupart des mesures sanitaires depuis le début de la pandémie, mais que maintenant, il en a «plein son truck».

«Je suis bien loin d’être un scientifique ou un expert dans le domaine, mais si on regarde ce qui se passe, on a à peu près les pires mesures, puis on a le pire bilan», a t-il mentionné pour expliquer son exaspération.

Plus la journée avançait vendredi,28 janvier 2022 et plus le centre-ville d’Ottawa se remplissait de camions et plus les klaxons se faisaient entendre près du parlement.

Vers 19h, une boule de feu, qui pourrait être un feu d’artifice, a été lancée dans les airs sur la rue Queen, non loin du parlement.

Le Service de police d’Ottawa a déclaré qu’il avait appelé des renforts pour aider au maintien de la paix alors que des milliers de véhicules, dont des camions lourds,  poursuivaient leur route vers la capitale nationale vendredi.


N’OUBLIEZ PAS DE VISITER NOTRE BOUTIQUE EN LIGNE

Sur ce lien:Vintage par Michel

 

La Gigantesque Arnaque du COVID-19:Les animaux malades de la peste / politique du bouc émissaire au Québec [et ailleurs]

Un mal qui répand la terreur,
Mal que le Ciel en sa fureur
Inventa pour punir les crimes de la terre,
La Peste (puisqu’il faut l’appeler par son nom),
Capable d’enrichir en un jour l’Achéron, [1]
Faisait aux animaux la guerre.
Ils ne mouraient pas tous, mais tous étaient frappés

– Jean de La Fontaine

 

Le covid 19 c’est, bel et bien, ce mal inventé par les marchés financiers afin de punir un prolétariat par trop populeux et qui ne sert plus à rien dans un contexte où l’économie réelle est moribonde en Occident. Tous frappés par ce fléau difficile à circonscrire, pas vraiment mortel en définitive, les anciens consommateurs sont pris d’un accès de panique et ne savent plus à quel saint se vouer. Joggant sur la voie publique tels des volatiles sans têtes, nos concitoyens réclament une voie de sortie qui, l’espèrent-ils, leur permettra de renouer avec leurs bonnes vieilles habitudes.

Mais, la peste de DAVOS est coriace et ses innombrables variants – véritables surgeons d’un mal qui sévit malgré les médecines de cheval qui nous sont administrées – font leur apparition le temps d’une saison, comme autant de modes éphémères qui dictent les tenues de circonstance. La muselière est de mise en toutes circonstances, que ce soit à l’intérieur ou à l’extérieur, par beau temps ou tempête de verglas, complément obligé d’une tenue élégante ou négligée. Et, le téléphone intelligent, accessoire indispensable, représente la laisse qui permet aux appariteurs sadiques de cette habile mise en scène de faire danser les consommateurs sur les musiques de l’heure.

 

Les maîtres chanteurs

Les marchés financiers qui façonnent de nouveaux produits spéculatifs représentent les maîtres chanteurs d’un système économique qui ne peut plus fonctionner qu’à partir de la coercition et de la terreur instillées par nos gouvernements qui n’en sont que les relais obligés. Les immenses fonds de pension à la BLACKROCK [2] – après avoir détourné le fruit du labeur de la génération du boom de l’après-guerre – ont décidé d’investir du côté de BIG PHARMA, dans un contexte où cette fausse pandémie représente une chance inespérée de faire d’une pierre, plusieurs coups … en effet, les gouvernements, tout en étant saignés à blanc par l’ARN MESSAGER, se disent qu’il faut bien que cette panacée serve à quelque chose. Alors, on vaticine et vaccine à tout va. Après que la Fondation Rockefeller a étudié divers scénarios de pandémies, après que le Seigneur de DAVOS a annoncé la venue d’une grande réinitialisation censée nous délivrer de nous-même, et que l’Organisation Mondiale de la Santé s’est perdue en conjectures à propos d’une flopée de variants préalablement baptisés par des gnostiques déjantés, le champ de bataille était libre pour une mise en quarantaine définitive de nos sociétés décadentes.

Sésame, ouvre-toi !

Le PASS SANITAIRE ou VACCINAL, véritable prélude à un contrôle biométrique complet du bétail humain, permet de faire en sorte que les brebis galeuses ne puissent pas être tentées de contaminer l’eau de la mangeoire commune. À l’instar de cette fable des Animaux malades de la peste, les consommateurs sevrés par cette crise sanitaire orchestrée sentent qu’il faudra bien sacrifier quelques-uns parmi les marginaux qui refusent de se conformer aux diktats de l’heure. C’est ici que la théorie du bouc émissaire, complément indispensable des stratégies de triangulation de l’ingénierie sociale, fait son entrée en scène de manière magistrale. Puisque dans une triangulation réussie il faut bien qu’une victime expiatoire tienne lieu de médiation entre les captifs et leurs bourreaux. Pétries d’un christianisme couvant sous les braises, bien que décharné, nos sociétés ont cherché à se délester de leurs responsabilités en sacrifiant des boucs émissaires.

Crier haro sur le baudet

Ainsi, incapables de justifier l’inoculation d’un poison qui ne protège pas vraiment des séquelles de cette flopées de variants créés en laboratoire, ne trouvant pas les mots afin d’expliquer pourquoi il faut imposer un nouveau couvre-feu à partir du temps des fêtes et en quoi la destruction de nos liens filiaux nous protègerait-elle contre ce prétendu fléau, nos bourreaux s’en remettent aux non-injectés et à tous ceux qui refusent de se plier aux injonctions de cette tyrannie techno-médicale.

Le Lion tint conseil, et dit : « Mes chers amis,
Je crois que le Ciel a permis
Pour nos péchés cette infortune ;
Que le plus coupable de nous
Se sacrifie aux traits du céleste courroux ;
Peut-être il obtiendra la guérison commune. »

 – Jean de La Fontaine

Ne plus couper les cheveux en quatre

Et, dans un contexte où les « non-vaccinés » pourraient bien représenter un groupe témoin gênant, il devient urgent de les isoler afin de les contraindre à se plier aux exigences du sacrifice collectif qui nous est proposé. Quitte à faire crever les plus irréductibles dans les meilleurs délais, puisqu’il y a péril en la demeure à l’heure où nos sadiques tortionnaires ambitionnent d’implémenter un système de contrôle biométrique sanitaire et sociétal de manière permanente. Il faut donc aller au plus pressant et cesser, séance tenante, de tergiverser sur une question qui a déjà été tranchée des lustres avant le signal de départ de ce véritable coup d’état néofasciste.

Les entités maléfiques qui ont pris le contrôle du Parlement du Québec (en France et ailleurs) ne coupent plus les cheveux en quatre puisque leurs commanditaires de l’industrie pharmaceutique et du Forum économique mondial de Davos réclament des mesures plus musclées et expéditives avant la venue du printemps. Le bon peuple étant manifestement excédé par tous ces excès de zèle, réalisant que l’économie est sur le point de rendre l’âme et que les effets secondaires de la potion magique épuisent une masse grandissante parmi les animaux conformes, [3] il faut faire vite avant que la coupe ne déborde.

Chez nous, au Québec, les responsables de ce carnage socioéconomique sont littéralement pris d’une rage indescriptible. Il faut faire vite et bien. Et, surtout pas dans la dentelle. Alors, les brebis galeuses, non-conformes, n’ayant plus accès à aucune forme de divertissement, ne pouvant plus entrer dans les musées et autres édifices publics, ne pouvant plus se restaurer ou festoyer avec les autres animaux, et, après s’être fait mettre à l’écart par les membres de leurs familles respectives, devront payer un pactole pour être admis à l’hôpital et la JUNTE aux manettes a même tenté, à l’instar de la province du Nouveau Brunswick, de les priver de nourriture en forçant les distributeurs alimentaires à imposer le sésame sanitaire. Heureusement, jusqu’à nouvel ordre, les petits commerçants et les grandes chaînes ont refusé d’obtempérer [4]. Et, alors que près d’un million de Québécois vivent comme des chiens, en ne sachant pas ce que DEMAIN leur réservera, une flopée de chroniqueurs stipendiés par le grand capital réclame que des sanctions à la hauteur du crime tombent. Il faut anéantir ceux et celles qui osent toujours défier les injonctions de nos maîtres véritables. Dans ces conditions, on comprend facilement l’empressement des psychopathes de service au Parlement de Québec. On ne sait jamais ce qui pourrait advenir si, d’office, une plainte pour CRIMES CONTRE L’HUMANITÉ, finissait par être traitée en bonne et due forme à la Cour internationale de Justice.

L’Âne vint à son tour, et dit : « J’ai souvenance
Qu’en un pré de moines passant,
La faim, l’occasion, l’herbe tendre, et je pense
Quelque diable aussi me poussant,
Je tondis de ce pré la largeur de ma langue.
Je n’en avais nul droit, puisqu’il faut parler net. »
À ces mots, on cria haro sur le baudet.

 – Jean de La Fontaine

Patrice-Hans Perrier
Source Le Saker Francophone


NOTES

1-Les charognards se gaventPfizer, BioNtech et Moderna réalisent un bénéfice de 1.000 dollars par seconde.

L’arnaque Covid a décidément fait beaucoup d’heureux aux côtés des centaines de milliers de morts et des millions d’éclopés, et cela ne pourra que s’accentuer, avec les booster 3, puis 4, puis ad vitam aeternam.

Selon People’s Vaccine Alliance, chaque seconde, Pfizer, BioNtech et Moderna réalisent un bénéfice de 1.000 dollars. Cette manne représente, pour l’année en cours, un bénéfice avant impôts estimé à 34 milliards de dollars, soit 65.000 par minute ou 93,5 millions de dollars par jour,. 

Comparons ce montant, gagné chaque seconde par les trois larrons pharmaceutiques,  au salaire moyen annuel en France, dans le monde, dans l’UE et en Afrique, on obtient :

  France Monde UE Afrique
Salaire annuel moyen en k$ 46,5 9,5 28,8 1,3
1,4 6,8 2,3 50,0

Cela veut dire que les trois mousquetaires de Big Pharma gagnent en une minute, 1,4 fois le salaire annuel d’un Français, 2,3 fois celui d’un Européen (UE) et 50 fois celui d’un Africain

Ces trois fabricants ont  aussi perçu plus de 8 milliards de dollars d’aides publiques américaines pour développer leurs vaccins tueurs et invalidants.

Par ailleurs, selon une étude commandée par le groupe de La Gauche au Parlement européen, la taxation des multinationales qui ont enregistré des bénéfices exceptionnels pendant la pandémie, pourrait rapporter 25 milliards d’euros à l’Union européenne, dont 5,6 milliards à la France. De quoi répondre aux besoins en hôpitaux ou en personnels de santé.

On n’est jamais mieux servi que par … les siens

Premier exemple
Ce mercredi 1er décembre, la présidente de la Commission européenne, Ursula von der Leyen, a déclaré en conférence de presse que le temps était venu de réfléchir à l’option d’une vaccination obligatoire.  Elle a donc déclaré qu’il était temps de créer des plans COVID destinés à obliger TOUS les états européens à vacciner (3 doses et plus) les 445 millions d’Européens.

Ursula von der Leyen est la femme du directeur d’un fabricant de vaccins Covid ARNm.  Son mari, Heiko von der Leyen est le directeur médical de Orgenesis, une société américaine de biotechnologie spécialisée dans les « vaccins à base de cellules » et de thérapies de géniques, qui se proclame fièrement « l’Uber de l’espace de thérapie cellulaire et génique« .

Il a occupé ce poste depuis le 20 septembre et a servi sur son comité consultatif scientifique depuis 2019.

Deuxième exemple. En Russie…aussi

Tatyana Golikova, commissaire de Covid de Russie a travaillé sans relâche pour imposer les passeports vaccinaux. Bien sûr, cela n’a rien à voir avec le fait que son beau-fils Vladimir Khristenko fabrique le vaccin Kovivak (approuvé pour une utilisation depuis le 2021).

La population de la Fédération de Russie est de 145,9 millions de personnes, il y a donc des milliards à glaner.

Le vaccin KoviVac est produit la société Nanolek. L’un des fondateurs, ainsi que le président de Nanolek, est le beau-fils Tatyana Golikova, cheffe du siège de la lutte contre le coronavirus.

La conclusion de tout cela est simple : la vaccination, rendue quasi obligatoire en Russie, rapporte des revenus colossaux à un groupe de personnes bien spécifique.

Il est difficile de croire qu’en promettant 189 milliards de roubles pour la vaccination des Russes, le gouvernement n’a pas calculé à qui iront ces fonds.

2-Seules DEUX sociétés, Vanguard et BlackRock, contrôlent la planète, alors que les 1 % les plus riches du monde possèdent 82 % de la richesse mondiale

 

Les actions des plus grandes entreprises du monde sont détenues par les mêmes investisseurs institutionnels. Ils sont tous propriétaires les uns des autres.
Cela signifie que des marques « concurrentes », comme Coke et Pepsi, ne le sont pas vraiment, puisque leurs actions sont détenues par exactement les mêmes sociétés d’investissement, fonds de placement, compagnies d’assurance, banques et, dans certains cas, gouvernements. C’est le cas dans toutes les industries.
Les petits investisseurs sont détenus par de plus gros investisseurs. Ceux-ci sont détenus par des investisseurs encore plus grands. Le sommet visible de cette pyramide ne comporte que deux sociétés dont nous avons souvent vu le nom…

Ce sont Vanguard et BlackRock.

3-Pandémie Vaccinale. Les personnes ayant reçu un vaccin Covid-19 représentent 70% des décès toutes causes confondues au cours des 6 premiers mois de 2021, 20% survenant dans les 21 jours suivant la vaccination
4-La situation est pire en Tunisie, dans laquelle un gouvernement fantoche [i.e. soumis aux oukases de ceux qui décident OMS, Big Pharma, Empire anglo-sioniste, …] , seuls le petits commerces sont accessibles aux pestiférés (i.e. sans pass nasitaire). Les grandes surfaces ont été les premières à exiger le pass de la honte.

N’OUBLIEZ PAS DE VISITER LA BOUTIQUE EN LIGNE DE VOTRE SITE WEB FAVORI

Sur ce lien:Vintage par Michel

La Criminelle Arnaque du COVID-19:93% des autopsies révèlent que des personnes vaccinées contre le Covid-19 sont mortes du vaccin

La piqûre de vax Covid-19 a été impliquée dans 93% des décès de personnes autopsiées. Le point le plus intéressant à noter est que le coroner ou le procureur général a affirmé qu’ils n’étaient pas dus aux piqûres du génocide. Au départ, quinze corps ont été examinés, âgés de 28 à 95 ans. Ils étaient décédés de 7 jours à 6 mois après la « vaccination ». Cependant, un examen plus approfondi a révélé que la piqûre ayant provoqué un caillot était la cause du décès de 14 des 15 patients. L’organe le plus attaqué était le cœur, mais d’autres organes étaient touchés comme les poumons et le foie. La signification de ces découvertes est déconcertante, car cela signifie qu’il existe un potentiel de millions de décès.

Dr Sucharit Bakdi
Dr Sucharit Bakdi

 

 

Le Dr Sucharit Bhakdi et le Dr Arne Burkhardt ont fait un travail merveilleux pour sensibiliser le public à ces dangereux piqûres de vax Covid-19. Les membres des familles ont demandé que les corps de ces victimes soient minutieusement examinés. Le Dr Bhakdi a consacré toute sa vie à la pratique, à l’enseignement et à la recherche en microbiologie et en maladies infectieuses. Le Dr Burkhardt est un pathologiste et virologue de renommée mondiale qui a publié plus de 300 articles dans les domaines de l’immunologie, de la bactériologie et de la virologie. Les deux hommes travaillent actuellement en Allemagne. Ironiquement, le Dr Bhakdi envisage de quitter le pays parce que les autorités sanitaires veulent que son enfant de 4 ans soit piqué par vax Covid.

Le Dr Bhakdi et le Dr Burkhardt ont tous deux remarqué que chez 14 des 15 patients témoins, il y avait de nombreuses preuves de l’attaque du corps contre lui-même, ce qu’ils n’avaient jamais vu auparavant. Ces patients étaient des personnes décédées à la maison, lors d’événements sportifs, dans la voiture ou au travail. Le Dr Burkhardt a pu ajouter 55 patients supplémentaires à ses examens, portant le nombre total à 70. Chez plus de 90 % des personnes décédées, le Dr Burkhardt a découvert une auto-attaque auto-immune dans les tissus de ces organes par des lymphocytes T tueurs, dans la plage d’âges de 28 à 90 ans. Dans tous les décès, ils ont trouvé les mêmes résultats pathologiques. Le seul dénominateur commun à toutes ces personnes était le vax génocidaire Covid, une thérapie génique, qui a causé des dommages aux protéines de pointe aux tissus. Quatre des victimes du vax Covid-19, n’ont reçu qu’une seule dose. À chaque piqûre de Covid, le système immunitaire s’aggrave progressivement. Le Dr Bhakdi décrit les injections comme «fuyantes», produisant des protéines de pointe qui préparent les organes à l’attaque des lymphocytes tueurs. Il a également noté que ces lymphocytes du système lymphatique sont en train de mourir. Ces cellules sont responsables de la destruction des virus et des bactéries déjà présents dans notre corps, tels que la mononucléose infectieuse, le cytomégalovirus, le virus de l’herpès, le virus d’Epstein-Barr, la tuberculose, la toxoplasmose et tout autre virus dormant. Le Dr Bhakdi a également noté qu’il y a « une explosion de tumeurs et de cancers parmi les vaccinés que personne ne peut expliquer« . Les lymphocytes sont les cellules responsables du contrôle des cancers dans notre corps.

 

 

Le Dr Hoffe avait découvert plus tôt cette année dans ses propres recherches que 60% des patients qui avaient reçu la piqûre de génocide Covid avaient des niveaux élevés de D-dimères, ce qui est un indicateur de coagulation sur les parois des petits vaisseaux sanguins. Le Dr Ryan Cole, un autre pathologiste, constate une multiplication par vingt du cancer de l’utérus, ainsi que d’autres tumeurs. Le Dr Cole a noté que les « vaccins » n’incitent pas les patients à produire suffisamment d’IgA sécrétoires. L’immunoglobuline A est la première ligne de défense contre les microbes nocifs, tout en maintenant une réponse immunologique équilibrée. Enfin, le Dr Cole reconnaît que les infiltrats de lymphocytes T dans la population piquée sont destructeurs de tissus. Il veut faire une étude pour voir comment la protéine de pointe se dépose dans les organes au site des infiltrats.

CONCLUSION

Le fameux docteur Bhakdi a été nominé pour un prix Nobel en 2021.Il est actuellement le scientifique le plus censuré de la planète!

Le travail de l’équipe Bhakdi/Burkhardt est une bombe. C’est la première fois qu’une étude explique comment les piqûres du vax du génocide tuent les lymphocytes dans le système lymphatique, ce qui équivaut à une station d’épuration du corps. Cela conduira par conséquent à l’émergence d’agents pathogènes dormants infectant l’hôte. Je connais personnellement une infirmière praticienne en Pennsylvanie qui a contracté le zona et une infection au Covid-19, après sa troisième injection de rappel. L’une des questions que je me pose et sur laquelle je pense que nous avons besoin de plus de recherches est la suivante : la mort des lymphocytes est-elle une conséquence permanente de l’injection de Covid ? Nous savons par des études antérieures que chaque injection semble détruire l’immunité. Les piquants se préparent-ils à une facilitation de l’infection par des anticorps (Antibodydependant enhancement ou ADE en anglais), ce qui conduirait à des infections percées ? [Une infection percée est un cas de maladie dans lequel un individu vacciné devient infecté par la maladie, en raison du fait que le vaccin n’a pas réussi à fournir une immunité complète contre l’agent pathogène]

Le travail de l’équipe Bhakdi/Burkhardt, ainsi que du Dr Hoffe et du Dr Cole, peut être décrit comme suit.
– Premièrement, les événements inflammatoires dans les petits vaisseaux sanguins sont caractérisés par une abondance de lymphocytes T et de cellules endothéliales mortes, qui à leur tour peuvent conduire à des caillots sanguins.
– Deuxièmement, il y a une accumulation importante de lymphocytes T dans les tissus entourant les vaisseaux sanguins.
– Troisièmement, il y a une infiltration massive des organes et des tissus avec ces cellules tueuses.
D’après les travaux de tous ces scientifiques, nous voyons que le cœur est le principal organe impliqué, mais la coagulation peut se produire n’importe où avec ces piqûres Covid, du cerveau aux vaisseaux sanguins. Ces « injections de caillots » doivent être stoppées immédiatement !

Source
Réseau d’actualités Nemos – 11 janvier 2022


N’OUBLIEZ PAS DE VISITER NOTRE BOUTIQUE EN LIGNE 

Sur ce lien:Vintage parMichel

 

 

 

 

La Criminelle Arnaque du COVID-19:Combien de personnes les vaccins Covid-19 ont-ils vraiment tué ?

Veuillez partager cet article très important avec tous ceux que vous connaissez. Aidez à sauver des vies et envoyez cet article aux hôpitaux, cabinets médicaux, maisons de soins, écoles, journaux, journalistes, etc. 

Notre Blog étant ostracisé par Big Tech, Faites du copier/coller et diffusez tout ou partie de ce constat dîment référencé. H.G.

Personne ne sait combien de personnes les vaccins tuent – ​​ou combien ils tueront.

Mais bien que je n’aie pas vu les médias grand public mentionner la plupart de ces décès, des gens sont déjà morts ou ont été blessés après avoir reçu le vaccin.

Par le Dr Vernon Coleman

CHOQUANT – Les derniers décès et blessures/EIM  de covid jab du VAERS (des nourrissons, des adolescents et des jeunes adultes meurent après le vaccin)

données openvaers.com covid (on estime que seulement 1% des événements indésirables du vaccin sont signalés)

Remarque : Le paragraphe suivant a maintenant été ajouté à l’impression des données d’analyse Pfizer du Royaume-Uni : « Un rapport d’un ADR (EIM en français : évènement indésirable de médicament) suspecté au programme Yellow Card ne signifie pas nécessairement qu’il a été causé par le vaccin… » À mon avis, c’est encore une autre tentative de détourner l’attention des problèmes bien réels liés aux vaccins. Nous notons que lorsque des patients décèdent 60 jours après un test covid positif, ils sont ajoutés aux chiffres de décès covid mais si quelqu’un venait à mourir 60 minutes après un vaccin covid, alors ce n’est qu’une coïncidence.

PFIZER (données britanniques) – Certaines des blessures/EIM  comprennent : les accidents vasculaires cérébraux, les crises cardiaques, les fausses couches, la paralysie de Bell, la septicémie, la paralysie, les troubles psychiatriques, la cécité, la surdité, le zona, l’alopécie et le covid-19. (Veuillez aider à sauver des vies et envoyer le lien pour l’impression de l’analyse des données Pfizer aux écoles et aux journaux locaux)

Remarque : Le paragraphe suivant a maintenant été ajouté à l’impression des données d’analyse d’AstraZeneca au Royaume-Uni : « Un rapport d’un EIM suspecté au programme Yellow Card ne signifie pas nécessairement qu’il a été causé par le vaccin… » À mon avis, c’est encore un autre tentative de détourner l’attention des problèmes bien réels liés aux vaccins. Nous notons que lorsque des patients décèdent 60 jours après un test covid positif, ils sont ajoutés aux chiffres de décès covid mais si quelqu’un venait à mourir 60 minutes après un vaccin covid, alors ce n’est qu’une coïncidence.

ASTRAZENECA (données britanniques) – Certaines des nombreuses blessures/EIM comprennent : la cécité, les accidents vasculaires cérébraux, les crises cardiaques, les fausses couches, la septicémie, la paralysie, la paralysie de Bell, la surdité, le zona, l’alopécie et le covid-19. (Veuillez aider à sauver des vies et envoyer le lien pour l’impression des données d’analyse d’AstraZeneca aux écoles et aux journaux locaux)

Base de données européenne des rapports sur les effets indésirables suspectés des médicaments :  Moderna ,  Pfizer-Biontech ,  AstraZeneca  et  Janssen .

  • Le député Derek Sloan a fait part de ses inquiétudes concernant la censure des médecins et des scientifiques sur le vaccin covid-19 ( vidéo – bitchute )
  • Moderna commence les premiers essais humains pour le vaccin contre la grippe basés sur la nouvelle technologie d’ARNm utilisée pour fabriquer le vaccin covid-19 de l’entreprise ( article – Daily Mail )
  • Ce qui suit est le projet de liste de travail de la FDA sur les effets secondaires possibles du vaccin contre le covid (voir page 16 du document). Cela a été publié en octobre 2020 AVANT le début du déploiement du jab.

 

Remarque importante :
des articles de presse ont signalé que le vaccin AstraZeneca provoquait des caillots sanguins. C’est vrai, mais TOUS les vaccins expérimentaux provoquent également des caillots. Il y a eu de nombreux décès, avec plus de 1000 rien qu’au Royaume-Uni, et un grand nombre d’événements indésirables. Il est important de se rappeler que ces vaccins expérimentaux qui sont administrés à des personnes en bonne santé n’empêchent pas la covid-19 ni n’empêchent sa transmission, et le risque qu’un jeune adulte en bonne santé meure de covid-19 est extrêmement faible.

Ce ne sont là que quelques-uns des décès et des blessures/EIM  possibles qui ont suivi la vaccination.

Je n’ai aucun doute que les autorités prétendront que ces décès étaient une coïncidence.

Et rappelons-nous si un patient décède dans les 28 jours après avoir été testé positif pour le coronavirus (et le test ne signifie pas que le patient a même la maladie puisque la plupart des tests sont de faux positifs), alors le décès sera répertorié comme un covid-19 mort et on dira que le patient est décédé « avec » covid-19. Donc, de la même manière, il est parfaitement raisonnable de dire que si un patient décède ou tombe malade dans les 28 jours suivant sa vaccination, le décès ou la maladie était lié au vaccin contre le covid-19.

Les médias grand public commenceront-ils un jour à enregistrer ces décès ou maladies ? Ou les journalistes vont-ils continuer à promouvoir la ligne officielle du gouvernement – ​​et à nier, déformer ou supprimer la vérité ?

Combien de personnes doivent mourir avant que les médias ne se réveillent ?

 

Décès peu de temps après Covid Jab – Encore une autre coïncidence

Other Important Covid Vaccine Information

 

Les athlètes et le vaccin Covid

Est-ce le covid jab qui a causé la mort et les blessures/EIM  des sportifs suivants ? Il est évidemment rare que de jeunes athlètes en super forme développent soudainement des problèmes cardiaques, surtout lorsque beaucoup d’entre eux auraient subi des examens médicaux approfondis au cours de leur carrière.

  • Avi Barot, 29 ans, joueur de cricket de Saurashtra fait un arrêt cardiaque, décède :
  • Abou Ali, 22 ans , footballeur professionnel s’effondre sur le terrain pendant le match :
  • Fabrice NSakala, 31 ans , défenseur de Besiktas s’effondre sur le terrain pendant le match :
  • Jens De Smet, 27 ans, footballeur s’effondre sur le terrain, décède d’une crise cardiaque :
  • Jente van Genechten, 25 ans , footballeur s’effondre sur le terrain à cause d’une crise cardiaque :
  • Frédéric Lartillot , footballeur français s’effondre dans un vestiaire, décède des suites d’une crise cardiaque après match :
  • Benjamin Taft, 31 ans, footballeur allemand s’effondre après un match, décède des suites d’une crise cardiaque :
  • Rune Coghe, 18 ans , footballeur belge victime d’un arrêt cardiaque sur le terrain :
  • Helen Edwards , arbitre retirée du court lors des qualifications pour la Coupe du monde en raison de problèmes cardiaques :
  • Dimitri Lienard, 33 ans , milieu de terrain du FC Strasbourg s’effondre pendant le match :
  • Sergio Aguero, 33 ans , l’attaquant vedette de Barecelona admis à l’hôpital pour un examen cardiaque après le match :
  • Emil Palsson, 28 ans, le milieu de terrain de Sognal s’effondre en raison d’un arrêt cardiaque pendant le match :
  • Antoine Méchin, 31 ans , triathlète français est victime d’une embolie pulmonaire suite à Moderna :
  • Luis Ojeda, 20 ans , footballeur argentin, est décédé subitement :
  • Greg Luyssen, 22 ans , cycliste professionnel belge met fin à sa carrière à cause de problèmes cardiaques :
  • Pedro Obiang, 29 ans , ex-star de West Ham souffre d’une myocardite après le vaccin :
  • Cienna Knowles, 19 ans , star équestre hospitalisée en raison de caillots sanguins :
  • Un footballeur de 17 ans meurt en s’effondrant sur le terrain contre Boston United (Dylan Rich)
  • Un footballeur décède à 29 ans après avoir subi une crise cardiaque lors d’un match en l’honneur de son frère décédé

Vaccin Covid-19 – Effets secondaires possibles du vaccin

Les pro-vaccins aiment vous dire que les vaccins sont parfaitement sûrs et parfaitement efficaces. Même lorsqu’ils ne seraient pas considérés comme suffisamment sûrs pour être utilisés comme nettoyant pour le four, les fanatiques s’enthousiasment pour eux. Les jeunes et ceux qui connaissent peu la médecine ou la science parlent des vaccins avec révérence parce qu’ils ont été endoctrinés à croire aux mensonges pro-vaccins.

Et les pro-vaxxers mentent, bien sûr.

Les vaccins causent beaucoup de maladies et pas mal de décès et ils ne font pas toujours ce qu’ils sont censés faire. Les gouvernements du monde entier ont versé plusieurs milliards de dollars à des patients qui sont tombés malades à cause des vaccins – ou aux proches de patients qui ont été tués par un vaccin.

Il y a, par exemple, de sérieux doutes sur ce que fait réellement le vaccin contre le covid-19. Étant donné que le vaccin est un nouveau type de vaccin et qu’il est administré avant que les tests et les observations habituels ne soient terminés, personne ne sait ce qui arrivera aux personnes à qui le produit sera injecté dans un bras.

Quels seront les effets secondaires ? Combien mourront ?

Eh bien, je ne sais pas et personne d’autre non plus.

Que se passe-t-il si une femme est enceinte lorsqu’elle reçoit le vaccin ou tombe enceinte après avoir reçu le vaccin ? Le vaccin n’est pas censé être administré aux femmes enceintes, mais toutes les grossesses ne sont pas planifiées.

Le vaccin interférera-t-il avec les médicaments essentiels qui sauvent des vies ? De nombreux patients âgés prennent déjà un certain nombre de médicaments prescrits. Le vaccin interférera-t-il avec eux? Personne ne sait. Le vaccin contre le covid-19 est la plus grande expérience de l’histoire. Et, contrairement à un essai clinique approprié, il est en grande partie non réglementé. Comme pour tous les vaccins, la plupart des problèmes qui surviennent ne seront jamais signalés ou reconnus.

On estime qu’aux États-Unis, seulement 1 effet secondaire sur 100 des vaccins est signalé.

Le meilleur que nous ayons est une liste de travail des effets indésirables possibles que la FDA a publiée aux États-Unis. ( Voici le lien vers le projet de liste de travail )

Puisque je crois que tout le monde a le droit de savoir quels effets secondaires il pourrait y avoir avec un vaccin fortement promu, je vais vous lire la liste officielle des effets secondaires possibles. Il ne s’agit, rappelez-vous, pas de ma liste, mais d’un projet de liste compilé par la FDA – la Food and Drug Administration aux États-Unis.

  • Le syndrome de Guillain Barre
  • Encéphalomyélite aiguë disséminée
  • Myélite transverse
  • Encéphalite
  • Myélite
  • Encéphalomyélite
  • Méningo-encéphalite
  • Méningite
  • Encéphalopathie
  • Convulsions
  • Saisies
  • Accident vasculaire cérébral
  • Narcolepsie
  • Cataplexie
  • Anaphylaxie
  • Infarctus aigu du myocarde (crise cardiaque)
  • Myocardite
  • péricardite
  • Maladie auto-immune
  • Décès
  • Grossesse, issue de la naissance
  • Autres maladies démyélinisantes aiguës
  • Réactions allergiques non anaphylactiques
  • Thromocytopénie
  • Coagulation intravasculaire disséminée
  • Thromboembolie veineuse
  • Arthrite
  • Arthralgie
  • Douleur articulaire
  • maladie de Kawasaki
  • Syndrome inflammatoire multisystémique chez l’enfant
  • Maladie renforcée par le vaccin

Vous n’allez pas nécessairement les recevoir tous ou même aucun d’entre eux si vous avez le vaccin. Mais ce sont les effets secondaires possibles que la FDA a répertoriés. Ils sont tous désagréables, la plupart très sérieux et on ne peut pas être plus sérieux que la mort.

Et si vous êtes assez fou pour recevoir le vaccin, vous et votre médecin devriez surveiller les symptômes de toutes les maladies figurant sur la liste de la FDA.

Votre gouvernement ne vous parlera pas de ces dangers – ils ne croient pas au consentement pleinement éclairé en ce qui concerne les vaccins.

En effet, la plupart des gouvernements font désormais tout ce qu’ils peuvent pour s’assurer que toutes les critiques des vaccins sont interdites. Selon l’endroit où vous vivez, il est, ou sera bientôt, illégal de mentionner que les vaccins pourraient ne pas toujours fonctionner ou vous rendre malade.

Enfin, si votre gouvernement se souciait vraiment de vous, il mènerait un procès très simple et bon marché.

Ils garderaient une note de tous les problèmes de santé affectant 20 000 patients qui avaient reçu le vaccin et compareraient cette liste avec une liste de tous les problèmes de santé affectant 20 000 patients qui n’avaient pas reçu le vaccin au cours de la même période. Ils font les comparaisons tous les 3, 6 et 12 mois.

Bien sûr, ils devraient trouver des médecins honnêtes pour superviser l’essai, car ce serait très facile à manipuler.

Mais cela donnerait des résultats très intéressants donc je doute qu’ils le fassent.

Veuillez partager cet article avec tous ceux que vous connaissez.


N’OUBLIEZ PAS DE VISITEZ  LA BOUTIQUE EN LIGNE DE VOTRE SITE WEB FAVORI AFIN DE GARDER EN VIE LE DROIT À UNE LIBRE OPINION

Sur ce lien : Vintage par Michel