La Criminelle Arnaque du COVID-19:Des preuves biochimiques et statistiques officielles confirment à 100 % que Moderna a créé le Covid-19

1) Lorsque  Kadhafi avait annoncé dans les années 60, en parlant des Américains, « ils fabriqueront des médicaments, et pour vous les fourguer, ils fabriqueront les maladies qui vont avec »; les « experts » l’avaient traité de « fou ». Les mêmes qui traitent aujourd’hui Poutine de fou.
2) Les Big Pharma (Pfizer, Moderna, J&J, etc.) ont sorti leur vaccin Covid en quelques mois, alors qu’habituellement il faut au moins 10 ans, prouve qu’ils étaient tous « au parfum »  de l’arnaque covid qui se préparait chez Moderna.
3) Dès le début de cette pseudo pandémie, nous avons été parmi les premiers à dénoncer cette arnaque et à affirmer que cette « maladie » est artificielle et qu’elle était conçue dans les labos de l’Oncle Sam.  H. Genséric

Des preuves sont apparues prouvant au-delà de tout doute raisonnable que le géant pharmaceutique Moderna, la société qui a gagné des milliards grâce à la vente d’une injection expérimentale appelée vaccin de Covid-19, a en fait créé le virus Covid-19.

Le 23 février, le Daily Mail a publié un article montrant que Moderna avait breveté la séquence de 19 lettres de base (nucléotides) qui code pour le site Furin Cleavage dans Covid-19. 

Il a cité un article rédigé par des scientifiques en Inde, en Suisse, en Italie et aux États-Unis ( avec prudence intitulé : MSH3 Homology and Potential Recombination Link to SARS-CoV-2 Furin Cleavage Site ) dans lequel ils ont calculé que les chances d’une séquence de 19 nucléotides, brevetée par Moderna, apparaissant au hasard dans Covid-19 , dans des circonstances où il n’apparaît nulle part ailleurs dans la nature sont de 1 sur 3 milliards [1].

Mais ils n’ont pas réussi à en tirer la déduction évidente. S’ils avaient fait cette déduction évidente, je crains que cela n’ait été la dernière déduction scientifique qu’ils aient jamais publiée !

Ils ont décidé d’enquêter sur la séquence d’ARN du site de clivage de la furine dans la protéine de pointe Covid-19 pour voir si cela se produisait ailleurs dans la nature. .

Heureusement, le NCBI/NIH a produit la merveilleuse base de données BLAST qui répertorie toutes les séquences de gènes dans la nature connues de l’homme et toutes les séquences de gènes synthétiques brevetées connues de l’office des brevets.

Les chercheurs ont choisi la séquence Furin Cleavage car il s’agit de la seule séquence continue de lettres de gène (séquence de nucléotides) dans Covid-19 avec plus de 3 nucléotides, qui diffère des lettres respectives dans son parent naturel le plus proche, le Bat Coronavirus RaTG13 (toutes les autres différences sont 3 lettres ou moins). C’était donc de loin le meilleur candidat pour déterminer si le Covid-19 était ou non créé par l’homme.

 

De plus, le site de clivage de la furine est la clé de la pathogénicité de Covid-19 . Donc, s’il devait y avoir un gain de fonction créé par l’homme inclus dans le virus, c’est là que l’on pourrait s’attendre à le trouver.

La séquence d’acides aminés du site de clivage de la furine est PRRA (Proline Argenine Argenine Alanine). Chaque acide aminé est codé par un codon composé de 3 nucléotides (lettres de séquence génétique). Ainsi, toutes les différences dans le code génétique entre Covid-19 et RaTG13 sont au plus long d’un codon, d’un acide aminé, autre que la séquence de clivage de la furine, qui est…

CCT CGG CGG GCA

La séquence complémentaire (le brin d’ADN opposé de la double hélice est (GGAGCCGCCCGT) car C se lie à G et A se lie à T

Le compliment inverse (la même chose écrite à l’envers) est donc TGCCCGCCGAGG

Les chercheurs ont effectué une recherche d’alignement BLAST (Basic Local Alignment Search Tool) (ce qui signifie qu’ils recherchent la séquence du gène, la séquence du gène inverse, la séquence du gène complémentaire et la séquence du gène complémentaire inverse) à travers chaque séquence de gènes dans la nature connue de l’homme depuis CTCCTCGGCGGGCACGTAG qui est la séquence de 19 nucléotides contenant la séquence de clivage de la furine, qui apparaît également dans Covid-19, et qui se trouve en fait sous la forme de complément inverse CTACGTGCCCCGCCGAGGAG brevetée par Moderna.

Leurs résultats de recherche peuvent être trouvés ici . 

Le tableau 1 montre qu’il existe bien dans les 5 brevets américains cités ci-dessous…

US9149506B2 : Polynucléotides modifiés codant pour la septine-4 – https://patents.google.com/patent/US9149506B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618953P
2013-12-16 Demande déposée par Moderna Therapeutics Inc
2014-05-22 Publication de US20140141067A1
2015-10-06 Publication de US9149506B2
2015-10-06 Demande accordée
2020-01-10 Premier litige familial mondial déposé

US9216205B2 : Polynucléotides modifiés codant pour la granulysine – https:// patents.google.com/patent/US9216205B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618873P
2013-12-16 Demande déposée par Moderna Therapeutics Inc
2014-04-24 Publication de US20140113960A1 2015-12-22
Publication de US9216205B2 2015-12-22
Demande accordée

SIAH encodant la polynucléotide E3subitine modifiée protéine ligase 1 – https://patents.google.com/patent/US9255129B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618868P
2013-12-16 Demande déposée par Moderna Therapeutics Inc
2014-05-22 Publication de US20140141068A1
2016-02-09 Demande accordée
2016-02-09 Publication de US9255129B2

US9301993B2 : Modified polynucleotides coding apoptosis inducing factor 1 – https://patents.google.com/patent/US9301993B2/en

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Mandataire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618957P
2013-12- 16 Demande déposée par Moderna Therapeutics Inc
2014-04-17 Publication de US20140107189A1
2016-04-05 Demande accordée
2016-04-05 Publication de US9301993B2
2020-01-10 Premier litige familial mondial déposé

US9587003B2 : Polynucléotides modifiés pour la production de protéines et de peptides liés à l’oncologie – https://patents.google.com/patent/US9587003B2/en 

Inventeur : Stephane Bancel, Tirtha Chakraborty, Antonin de Fougerolles, Sayda M. Elbashir, Matthias John, Atanu Roy, Susan Whoriskey, Kristy M. Wood, Paul Hatala, Jason P. Schrum, Kenechi Ejebe, Jeff Lynn Ellsworth, Justin Guild

Cessionnaire actuel : ModernaTx Inc 

2012-04-02 Priorité à US201261618868P
2016-02-04 Demande déposée par ModernaTx Inc
2016-06-02 Publication de US20160152678A1
2017-03-07 Publication de US9587003B2
2017-03-07 Demande accordée

Ainsi, Moderna a déposé une première demande de brevet pour la séquence de 19 nucléotides en 2013 le 16 décembre. Peut-être que le 25 décembre aurait été plus approprié puisqu’il était destiné à devenir la couronne d’épines de Mathew27, Mark15 et John19.

Tableau 2 : montre que la séquence se produit dans Covid-19 du nucléotide 23601 à 23619.

Tableau 3 : montre que cette séquence de gène n’existe pas dans la nature (mais 14 parties nucléotidiques de celle-ci existent). 

J’ai décidé de vérifier leur travail. Oui. Je les ai effectivement vérifiés (j’enverrai une facture aux mondialistes). Cela s’est avéré être un voyage un peu épique. La page de brevet Google pour US9587003B2 ne contient pas la séquence du gène. Le pdf du brevet ne contient pas la séquence du gène et n’est pas consultable à partir des pages 101-304. Mais il a un lien vers une longue section « Liste des séquences » que l’on ne peut pas copier. Je l’ai donc transcrit manuellement de ma main juste –  http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US09587003B2 

À partir de cette page, vous pouvez entrer l’ID de séquence cité dans l’article sous la forme 11652 et accéder à https://seqdata.uspto.gov/?pageRequest=viewSequence&DocID=US09587003B2&seqID=11652 qui a ce qui suit aux nucléotides 2751-2733 en lisant à l’envers…

gccctgatca ccatcatggc ccagatcggc ag ctacgtgc ccgccgagga g gccaccatc 2760

CTACGTGCCCCGCCGAGGAG breveté par Moderna est le complément inverse de CTCCTCGGCGGGCACGTAG, la séquence de 19 nucléotides qui apparaît dans l’ADN de Covid-19 à partir du nucléotide 23601-23619 (qui serait donc couvert par leur brevet).

De même, vous pouvez rechercher la séquence dans US9149506B2 en allant sur https://seqdata.uspto.gov/?pageRequest=viewSequence&DocID=US09149506B2&seqID=11652 , après quoi vous retrouverez la même chose

gccctgatca ccatcatggc ccagatcggc ag ctacgtgc ccgccgagga g gccaccatc 2760

J’ai ensuite recherché la séquence génétique de Wuhan Hu1 (alpha) sur https://www.ncbi.nlm.nih.gov/nuccore/NC_045512 et j’ai trouvé 

23581 ttatcagact cagactaatt ct cctcggcg ggcacgtag t gtagctagtc aatccatcat de https://www.ncbi.nlm.nih.gov/nuccore/NC_045512 

Qui a la séquence de 19 nucléotides CTCCTCGGCGGGCACGTAG de 23601-23619 comme décrit dans le tableau 3. 

J’ai ensuite effectué ma propre recherche par explosion non alignée de toutes les séquences de gènes brevetées pour le compliment inverse directement (ou peut-être pour un compliment inversé) et j’ai obtenu les mêmes résultats que les chercheurs. 

Et pareil pour les 3 autres brevets américains.

Je peux donc confirmer, et le lecteur peut confirmer en utilisant les liens ci-dessus, que Moderna a demandé un brevet non seulement sur le complément inverse du site de clivage de la furine à 12 nucléotides dans Covid-19, mais en fait sur la séquence de 19 nucléotides le contenant comme décrit au dessus.

De plus, ils n’ont pas simplement déposé une demande de brevet le 4 février 2016 avec US9587003B2 : comme le rapporte le Daily Mail. Ils ont effectivement déposé le 16 décembre 2013 pour 4 brevets avec US9149506B2, US9216205B2, US9255129B2, US9301993B2 : également.

Ainsi, Moderna avait développé la séquence de gènes de 19 nucléotides contenant le site de clivage de la furine qui donne à Covid19 son infectivité pour l’homme grâce à une recherche brevetée sur le gain de fonction dès 2013, 6 ans avant l’épidémie de Wuhan. Pas 3 comme rapporté dans le Mail et viralement ailleurs.. 

Alors maintenant, nous examinons les chances que cela se produise naturellement. L’article calcule la probabilité que cette séquence particulière de 19 nucléotides se produise de manière aléatoire dans un virus de 30 000 nucléotides comme

(30 000-18) × (1/4) 19   = 1,09 × 10 -7

Ce qui est correct car il y a 30 000 à 18 places pour commencer la séquence étant donné qu’il faut encore 18 lettres supplémentaires pour la compléter. Mais il y a en fait 29 904 nucléotides dans Wuhan HU1 (alpha). Un calcul plus précis serait donc

(29 904-18) × (1/4) 19   = 1,087 × 10 -7

Ensuite, ils calculent les chances que la séquence de 19 nucléotides se produise dans la bibliothèque brevetée de 24 712 séquences d’une longueur moyenne de 3 300 nucléotides. Mais ce calcul n’est pas pertinent car la séquence n’est pas apparue au hasard dans 5 demandes de brevet Moderna. La séquence était connue pour coder pour un site de clivage de la furine, qui est connu pour fournir un gain de fonction aux coronavirus.

Il y a été mis délibérément et breveté en raison de son pouvoir infectieux chez l’homme, que nous verrons plus loin dans l’article, résulte du remplacement du codon viral normal de l’arginine (R) AGA (utilisé dans 45 % des codons viraux de l’arginine) par le le codon de l’arginine humaine CGG (utilisé dans 0 % des codons de l’arginine virale) dans le site de clivage de la furine.

Tout ce que nous essayons de déterminer ici, c’est quelles sont les chances qu’une séquence de 19 nucléotides brevetée par Moderna apparaisse dans Covid-19 par des causes naturelles, les mutations naturelles du Bat Coronavirus RaTG13 ou d’un autre virus.

Les nucléotides forment des codons qui sont des triplets. Il y a donc 64 triplets possibles des 4 nucléotides d’ADN ACGT (4x4x4 = 64). Mais tous les triplés se produisent. 61 codent pour 20 acides aminés de manière redondante et 3 sont des codons stop qui indiquent au ribosome d’arrêter de fabriquer la protéine.

Mais les choses ne sont pas aussi simples car le site de clivage Furin apparaît dans la protéine de pointe là où il doit être et la protéine de pointe n’a que 1273 × 3 = 3819 nucléotides. Les chances que la séquence de 19 nucléotides Furin Cleavage apparaisse dans la protéine de pointe sont 

(3 819-18) × (1/4) 19   = 1,389 × 10 -8

Soit 1 sur 72 millions. Ce seraient donc les chances qu’une variante particulière, disons la première variante de Covid-19, ait la séquence de 19 nucléotides au bon endroit (le pic). Et il l’a fait. Donc, certainement selon la prépondérance des probabilités, et certainement au-delà de tout doute raisonnable (1 sur 72 millions étant un doute déraisonnable), Moderna a créé Covid-19. 

Preuve 100% biochimique que Covid19 a été créé par l’homme

Le double codon CGG utilisé dans le site de clivage spécifique de la furine Moderna ne se produit dans aucun autre site de clivage de la furine dans aucun autre virus dans la nature. Les sites de clivage de la furine se produisent dans d’autres virus mais PAS du tout dans d’autres bétacoronavirus comme Covid-19 et PAS du tout avec le double codon CGG.

L’arginine (R), peut être codée par l’un des 6 triplets : AGG, AGA, CGA, CGC, CGG, CGT. Dans le Covid-19, le site de la furine (PRRA), compte 12 nucléotides (3 x 4). Dans le Covid-19, le doublet RR du site de la furine est codé par CGG-CGG.  

Antonio R. Romeu

Deux biochimistes, le professeur Antonio R. Romeu et le professeur assistant Enric Ollé, ont analysé le doublet RR à partir d’un large échantillon de sites de clivage de la furine de plusieurs types de virus . Ils ont découvert qu’il n’y avait aucun doublet RR codé par les codons CGG-CGG dans aucun virus dans la nature. Ils ont observé que le triplet AGA était le codon majoritaire impliqué dans ces doublets RR viraux.

Dans toute recombinaison génétique (où une partie d’un génome fusionne avec un autre génome), le code donneur est transmis à l’accepteur. Mais il n’y a tout simplement AUCUN VIRUS CONNU avec un site de clivage de la furine spécifique de Moderna (ayant la paire de codons CGG-CGG) qui existe pour donner un site de clivage de la furine spécifique de Moderna à Covid19. Donc, la seule façon dont cette séquence pourrait entrer dans Covid-19 est de Moderna. Moderna était le donateur. La nature ne l’était pas. CQFD. Affaire classée..  

Mais ça empire.

Les professeurs espagnols ont décidé d’analyser l’utilisation du codon de l’arginine dans chaque protéine de Covid-19. Le constat suivant…
AGG (13%)
AGA (45%)
CGA (5%)
CGC (10%)
CGG (3%)
CGT (24%). 

Ainsi, le triplet de codons AGA était majoritaire et, fait intéressant, CGG était le codon minoritaire de l’arginine dans le virus. 

Mais c’est encore pire.

Dans le cas particulier de la protéine S, sur les 42 Arginines (R) dont elle dispose, 20 sont codées par AGA, et seulement 2 par CGG. Ces 2 bien sûr, sont les deux dans le site de clivage Moderna Specific Furin.

Ainsi, la seule arginine dans la protéine de pointe qui est codée à la Moderna se trouve sur le site Furin Cleavage. Les 40 autres instances n’utilisent pas du tout CGG. 

Ils poursuivent ensuite en commentant que chaque espèce individuelle dans la nature a ses propres préférences de codons. De toute évidence, les virus aiment AGA, et n’aiment pas du tout CGG, dans la nature.

Mais devinez quelle espèce utilise CGG pour l’arginine plus que les 5 autres codons concurrents – oui, son vieil homo sapiens. Nos préférences de codage pour l’arginine sont

AGG (20 %)
AGA (20 %)
CGA (11 %)
CGC (19 %)
CGG (21 %)
CGT (9 %).

Ainsi, le codon CGG dans le site de clivage de la furine SERA issu de la recherche sur le gain de fonction chimère (combinaison homme-animal). 

Quelqu’un d’autre que Moderna aurait-il pu créer le Covid-19 en utilisant le site de clivage de la furine spécifique de Moderna ?

« De nouveaux documents montrent que 18 mois seulement avant l’apparition des premiers cas de Covid-19, les chercheurs avaient soumis des plans pour libérer des nanoparticules et des aérosols pénétrant dans la peau contenant de « nouvelles protéines de pointe  » de coronavirus de chauve-souris  des cavernes du Yunnan, en Chine. Ils prévoyaient également de créer des virus chimériques, génétiquement améliorés pour infecter plus facilement les humains, et ont demandé 14 millions de dollars à la Defense Advanced Research Projects Agency (Darpa) pour financer les travaux.

Des articles, confirmés comme authentiques par un ancien membre de l’administration Trump, montrent qu’ils espéraient introduire des «sites de clivage spécifiques à l’homme» pour les coronavirus de chauve-souris, ce qui faciliterait l’entrée du virus dans les cellules humaines.
Lorsque Covid-19 a été séquencé génétiquement pour la première fois, les scientifiques étaient perplexes quant à la façon dont le virus avait développé une telle adaptation spécifique à l’homme au site de clivage de la protéine de pointe, raison pour laquelle il est si infectieux. – le Telegraph

Je peux voir tous les grands journalistes du Daily Mail et du Telegraph (sans parler des scientifiques du monde entier) faire toutes ces recherches sur Covid19 et arriver à la conclusion logique inévitable qu’il y a eu une fuite accidentelle ou délibérée d’un laboratoire et doivent ensuite formuler leurs conclusions de manière à étiqueter cette forte probabilité comme une possibilité faible. 

Mais ci-dessus, nous l’avons prouvé comme un fait (puisque le codon CGG de la séquence de clivage spécifique de la furine de Moderna n’apparaît dans aucun site de clivage de la furine dans aucun virus naturel et, par conséquent, il ne peut pas avoir été le résultat d’une recombinaison génétique naturelle. Il doit donc être le résultat d’une insertion génétique faite par l’homme. 

En théorie, une autre partie impliquée avec le NAIAD ou le NIH aurait pu utiliser le site de clivage de la furine breveté par Moderna et fabriquer Covid19 eux-mêmes. Cela n’aurait brisé aucun brevet de Moderna. Le site de clivage Furin lui-même n’est pas brevetable étant connu depuis au moins 2004

US7223390B2 : Insertion de sites de clivage de la furine protéase dans les protéines membranaires 
et leurs
utilisations

Bien que Moderna ait en fait pu breveter le codage Moderna Specific (CGG pour AGA) du site de clivage de la furine qui n’était pas connu dans la nature même aujourd’hui (si nous acceptons que Covid-19 soit créé par l’homme).

Mais étant donné que la fuite de laboratoire (délibérée ou accidentelle) est venue de Wuhan, et compte tenu de la dissimulation chinoise et des démentis de Fauci exposés par le sénateur Rand Paul, et étant donné les dissimulations du NIH, du NIAID et des services de renseignement américains, quand leur Un rapport de 3 mois sur l’origine de Covid-19 commandé par l’imitateur présidentiel Biden n’a rien donné, et compte tenu des relations entre le NIAID, le NIH, le WIV, l’EcoHealth Alliance, l’Université de Caroline du Nord et Moderna, je ne vois aucune pièce pour quelqu’un d’autre.

De plus, toute la cabale impie des mauvais acteurs a commencé à développer le vaccin Moderna avant que la pandémie ne frappe – https://www.infowars.com/posts/must-watch-nih-claimed-joint-ownership-of-moderna-mrna-vaccine- a commencé-le-développement-des-semaines-avant-la-pandémie/ 

Mais les choses ne sont pas aussi simples que cela parce que la nature a certainement eu 100 000 ans pour fabriquer des virus humains et elle n’a jamais mis une seule fois un site de clivage de furine spécifique à Moderna (CGG pour AGA) dans quoi que ce soit, ni mis la séquence de 19 nucléotides dans quoi que ce soit auparavant.

Pourtant, dans les 6 ans suivant le brevetage de Moderna, nous le trouvons dans Covid-19 dans des circonstances où Moderna travaille avec ce virus. Donc juste là, la probabilité n’est pas de 100 000 contre 6 ou 16 666 contre 1 que Moderna soit responsable plutôt que la nature. Non c’est à 100% car la nature ne l’a pas fait. Il ne l’a jamais fait et rien ne prouve qu’il le fera un jour.

C’est l’homme qui mélange les codons humains et viraux de l’arginine, pas la nature. 

Le prof. Luc Montagnier a passé les dernières années de sa vie à prouver que le COVID-19 était créé par l’homme et qu’il contenait une grande partie du code génétique du VIH1

Le professeur Luc Montagnier, avant de mourir le 8 février 2022, a totalement détruit le concept selon lequel Covid-19 a évolué naturellement en montrant qu’il avait une équivalence massive avec VIH. Le diagramme ci-dessous montre une région de 275 nucléotides de Covid-19 qui contient 200 nucléotides du VIH/SIV (Simian ImmunoVirus). Et rappelez-vous qu’il y a 61 codons spécifiant 20 acides aminés. On peut donc dire la même chose en moyenne de 3 manières différentes avec des codons.

Vous pouvez télécharger un pdf de son étude ici et les documents supplémentaires ici . C’est très technique. Mais il a remporté le prix Nobel pour avoir découvert le virus VIH. Donc, si quelqu’un savait si Covid avait été boosté par le VIH, ce serait lui. Il a souligné que Covid-19 avait été créé par l’homme au début de la pandémie et qu’il avait lui-même été stipendié par la presse et les « vérificateurs des faits » pour avoir dit la vérité scientifique. Tous les « vérificateurs de faits » qui l’ont attaqué avaient tort.

Aucune de leurs vérifications des faits n’avait de fondement scientifique. Ces gens ne sont pas du tout des vérificateurs de faits bien sûr. Ce sont des agences de désinformation mondialistes, des fils de Goebbels, des fact chuckers et des négateurs de la science. Ils sont à peu près aussi dignes de confiance qu’une élection américaine. Je peux vérifier un fait par moi-même merci beaucoup. Je n’ai pas besoin qu’un taliban soumis au lavage de cerveau me dise son opinion sur un sujet qu’il n’a jamais étudié à l’université.

Puisque nous avons prouvé au-delà de tout doute raisonnable (au-delà d’un doute sur 1 sur 72 millions de manière statistique et avec 100% de certitude biochimique à partir du site de clivage de la furine spécifique de Moderna) que Moderna a fabriqué Covid-19. Et puisque Moderna et Fauci n’ont pas admis l’avoir fait et ont en fait dissimulé des preuves à cet effet, il se peut qu’ils cachent également autre chose.

Maintenant, les deux seules théories qui restent sont la théorie des fuites accidentelles de laboratoire et la théorie des fuites délibérées de laboratoire. Nous savons que la grande majorité des fuites politiques ne sont pas des accidents. Ce sont des stratégies délibérées pour procurer un avantage au bailleur ou au payeur. Il est bien connu dans l’industrie informatique que les virus apparaissent lorsque des ventes d’antivirus sont nécessaires. Pourquoi les choses seraient-elles différentes avec les virus humains, maintenant qu’ils peuvent aussi être créés par l’homme ? Surtout si l’on considère le rôle massif de Bill Gates et de sa fondation et de GAVI et GVAP dans le secteur mondial de la vaccination.

La seule raison pour laquelle Moderna créerait Covid-19 est de le lancer sur le marché. Sinon, tout l’exercice serait financièrement futile, commercialement inutile.

La raison invoquée par Fauci pour faire de la recherche sur le gain de fonction est que l’homme doit être en avance sur la nature ou les mauvais acteurs afin d’avoir un vaccin en temps utile si une maladie mute ou est génétiquement modifiée par « les Chinois ou les Russes » pour être mortelle !!

Mais pour croire cela, il faut croire que Moderna s’intéresse à sauver la vie des gens. Je m’excuse. Toutes leurs actions me montrent qu’ils sont intéressés à vacciner les gens sachant à quel point cela risque de leur coûter la vie.

Ils sont intéressés par le profit, le profit qui découle d’une pandémie. Ils ne sont pas des sauveurs de l’humanité comme ils le représentent. Ce sont nos exploiteurs et nos agresseurs.

Ils ont produit le virus pour le faire fuiter, pour se faire passer pour nos sauveurs de leur propre fuite. Ce ne sont pas les activités d’une figure de sauveur. Luc Montagnier essayait d’être notre sauveur d’eux et il a été assassiné (professionnellement) par leurs groupies. [La fiotte Macron a snobé le décès du Savant]
Moderna effectuait des recherches sur le gain de fonction afin de libérer le virus et de forcer un vaccin contre celui-ci d’une manière qui maximiserait ses profits. Ce n’est pas une théorie du complot. C’est ce qui s’est passé précisément. Le cours de leur action a été multiplié par 20. 

Ils l’ont sorti pour vendre leurs vaccins et détruire le système immunitaire de leurs clients car notre système immunitaire réduit leurs profits. C’est le business de Big Pharma. 

La raison pour laquelle l’écrivain est si confiant que Moderna ou leurs agents ont fabriqué et divulgué Covid-19 et la raison pour laquelle je l’ai appelé ainsi au début de la pandémie pour presque autant de ridicule que le professeur Montagnier a reçu (que Dieu le bénisse) est que le les Écritures disent dans Matthieu27, Marc15 et Jean19 : 

29 Et ils (les soldats du gouverneur du verset 27) placèrent une couronne d’épines et la mirent sur sa tête, et un roseau dans sa main droite ; et ils s’agenouillèrent devant lui, et se moquèrent de lui, disant : Salut, roi des Juifs !
30 Et ils crachèrent contre lui, prirent le roseau et le frappèrent sur la tête. (Matthieu 27 ASV)

Puis-je donc demander votre indulgence pendant que j’interprète ces mots : 

Le département américain de la défense a financé l’épissage génétique du coronavirus des protéines de pointe (Covid-19) par l’intermédiaire du NIH, du NIAID et de la DARPA, qui a d’abord infecté Jésus, par l’intermédiaire de son fiancé, les saints de la Nouvelle Alliance, juste après qu’il soit devenu le roi séculier, César à ces saints, les Juifs antitypiques, ceux qui se sont engagés à être des fils angéliques de Jacob, les nés de nouveau angéliquement.

Nous avons calculé que la malédiction qui a empêché Jésus de devenir César des saints s’est terminée en 2019Tishri15 (17/18 octobre). Glenn Beck a réalisé un documentaire montrant que 10 hôpitaux de Wuhan ont pris en charge des cas présentant des symptômes de Covid19 en octobre 2019. Oui les gens. Le Covid-19 est une preuve que Jésus est désormais le Roi séculier sur les saints, les Juifs antitypiques, les Juifs par l’alliance angélique du salut, au moins.

Mais ensuite, les soldats ont craché sur lui. Car c’est ainsi que Covid19 est transféré, à travers de petites gouttelettes d’aérosol expirées par la bouche. Les soldats lui ont délibérément craché dessus. Ce n’était pas une FUITE DE SALIVE ! Ils ont frappé Jésus sur la tête parce que les saints sont à la tête de l’église et ils ont attrapé Covid19 non pas par une infection fortuite au hasard mais par un coup délibéré avec une lecture, une arme biologique, une attaque armée délibérée. Pour en savoir plus, voir ici .

Alors ce que le Pr Montagnier a vu avec son expertise en virologie, je l’ai vu avec mon expertise théologique. Montrer que si les vérificateurs de faits et la science s’excluent mutuellement, la science et la théologie sont en fait d’accord, lorsqu’elles sont bien comprises (et c’est une grande mise en garde). Le Pr M nous a appris que les vaccins provoquent les variants. En effet, la virologie de base interdit la vaccination de masse pendant une pandémie pour cette raison même. Il a dit que la courbe des décès suit la courbe des vaccinations. Remarquez, paradoxalement, si les vaccins ont causé Omicron, alors ils nous ont sauvés d’eux-mêmes !

Le temps est venu de demander des comptes aux personnes et aux organisations

Les fabricants de Covid19, les fabricants de vaccins génétiques. leurs bailleurs de fonds et leurs promoteurs, qui comprennent presque tous les gouvernements, secteurs publics et services de santé dans le monde, sont donc coupables de génocide et de crimes contre l’humanité. Ils ont poussé le viol génétique, la maladie et la mort sur la moitié de la population mondiale afin d’enrichir les poches des sociétés pharmaceutiques. Les gouvernements et les secteurs publics du monde entier ont abandonné leur réglementation des services de santé aux milliardaires et aux entreprises sans cœur

Au Royaume-Uni, tout l’impôt sur le revenu que nous payons va au service de santé et tous ses protocoles sont déterminés par ses régulateurs et tous ses régulateurs sont contrôlés et financés par Big Pharma qui cherchent à nuire puis à gérer notre santé à leur profit.

Ainsi, chaque cent que nous dépensons en impôt sur le revenu nous rapproche un peu plus de la maladie, de la mort et de la toxicomanie.

Le professeur Luc Montagnier,en 2008.

Alors pourquoi le professeur Montagnier a-t-il choisi de passer les dernières années de sa vie à prouver que le Covid-19 était une création humaine et que les protéines de pointe, et donc les vaccins, étaient une menace existentielle pour l’espèce ? Que lui restait-il à prouver à lui-même ou à qui que ce soit d’autre à 87-89 ? Il ne l’a certainement pas fait pour accroître sa réputation dans la profession.

Non, il était animé par la même passion qui l’a poussé à découvrir le VIH. Une passion pour SAUVER l’humanité des virus et de ceux qui voudraient les concevoir pour nous nuire. Et pourquoi a-t-il rendu l’âme en février 2022 ? Parce qu’il savait qu’Omicron avait battu les vaccins. Son travail a été fait par un plus grand virologue que lui. Il a donc pu reposer en paix et aller voir des gens qui ont compris l’ampleur de sa contribution.

Covid-19 n’a pas été fabriqué en 2019. Il a été fabriqué à partir du site de clivage de la furine chimérique spécifique de Moderna (CGG pour AGA) à 19 nucléotides qui n’existe nulle part dans la nature.
Et chaque décès de Covid et chaque décès par vaccin Covid est carrément garé à la porte de ModeRNA en attente de justice.

Mais nous n’exécuterons pas cette justice assez vite. Et donc le fléau final sur l’humanité d’Apocalypse 6: 8, livré par le 4e cavalier de l’apocalypse, que Bill Gates lui-même a prophétisé, arrivera plus tard cette année (après la guerre et après la famine, les 2e et 3e cavaliers).

Source: BREAKING: Official Biochemical and Statistical Evidence 100% confirms Moderna created Covid-19

 


N’hésitez pas à visiter notre boutique en ligne:vous trouverez plein de cadeaux pour vos proches

Sur ce lien:Vintage par Michel

 

La Gigantesque Arnaque du Covid 19:57 scientifiques et médecins demandent l’arrêt immédiat de toutes les « vaccinations » Covid-19

 Un groupe de 57 scientifiques, médecins et experts politiques de premier plan a publié un rapport appelant à remettre en question la sécurité et l’efficacité des « vaccins » COVID-19 actuels, et réclame maintenant la fin immédiate de tous les programmes de vaccination. Parmi eux se trouve la généticienne Alexandra Henrion-Caude.

Les thérapies utilisées appelés « vaccins » ne répondent pas à la définition du mot vaccin et il serait plus approprié de les nommer thérapies géniques ou thérapies à vecteurs vaccinaux.

Il existe deux certitudes concernant la distribution mondiale de ces thérapies Covid-19 :

  • La première est que les gouvernements et la grande majorité des médias grand public mettent toutes leurs forces pour que ces médicaments expérimentaux s’adressent au plus grand nombre de personnes possible. 
  • La deuxième est que ceux qui sont prêts à affronter le mépris qui accompagne le fait de poser des questions sérieuses sur les vaccins sont des acteurs essentiels dans nos efforts continus pour répandre la vérité.

Vous pouvez lire ce manuscrit en pré-impression ci-dessous. Il a été préparé par près de soixante médecins, scientifiques et experts en politiques publiques du monde entier pour être envoyé de toute urgence aux dirigeants mondiaux, ainsi qu’à tous ceux qui sont associés à la production et à la distribution des différents vaccins Covid-19 en circulation.

Il y a encore beaucoup trop de questions sans réponse concernant l’innocuité, l’efficacité et la nécessité de ces thérapies Covid-19. 

Cette étude est une bombe qui devrait être lue par tout le monde, quel que soit son point de vue sur les thérapies géniques ou vaccins. Il n’y a pas assez de citoyens qui posent des questions. La plupart des gens suivent simplement les ordres des gouvernements mondiaux, comme s’ils avaient gagné notre entière confiance. Ce n’est pas le cas. Ce manuscrit est un pas en avant en termes de responsabilité et de libre circulation de l’information sur ce sujet crucial. Veuillez prendre le temps de le lire et de le partager largement.


Vaccination de masse contre le SARS-CoV-2 : questions urgentes sur la sécurité des vaccins qui exigent des réponses des agences internationales de santé, des autorités réglementaires, des gouvernements et des développeurs de vaccins

Auteurs : Roxana Bruno (1) , Peter McCullough (2) , Teresa Forcades i Vila (3) , Alexandra Henrion-Caude (4) , Teresa García-Gasca (5) , Galina P. Zaitzeva (6) , Sally Priester (7) , María J.Martínez Albarracín (8) , Alejandro Sousa-Escandon (9) , Fernando López Mirones (10) , Bartomeu Payeras Cifre (11) , Almudena Zaragoza Velilla (10) , Leopoldo M. Borini ()1 , Mario Mas (1) , Ramiro Salazar (1) , Edgardo Schinder (1) , Eduardo A Yahbes (1) , Marcela Witt (1), Mariana Salmeron (1) , Patricia Fernández (1) , Miriam M. Marchesini (1) , Alberto J. Kajihara (1) , Marisol V. de la Riva (1) , Patricia J. Chimeno (1) , Paola A. Grellet (1) , Matelda Lisdero (1) , Pamela Mas (1) , Abelardo J. Gatica Baudo (12) , Elisabeth Retamoza (12) , Oscar Botta (13) , Chinda C. Brandolino (13) , Javier Sciuto (14) , Mario Cabrera Avivar (14) , Mauricio Castillo (15) , Patricio Villarroel (15) , Emilia P. Poblete Rojas (15), Bárbara Aguayo (15) , Dan I. Macías Flores (15) , Jose V. Rossell (16) , Julio C. Sarmiento (17) , Victor Andrade-Sotomayor (17) , Wilfredo R. Stokes Baltazar (18) , Virna Cedeño Escobar (19) , Ulises Arrúa (20) , Atilio Farina del Río (21) , Tatiana Campos Esquivel (22) , Patricia Callisperis (23) , María Eugenia Barrientos (24) , Karina Acevedo-Whitehouse (5),

Résumé

Depuis le début de l’épidémie de COVID-19, la course au test de nouvelles plate-formes conçues pour conférer une immunité contre le SARS-CoV-2 a été endémique et sans précédent, conduisant à l’autorisation d’urgence de divers vaccins. Malgré les progrès de la polychimiothérapie précoce pour les patients atteints de COVID-19, le mandat actuel est de vacciner la population mondiale le plus rapidement possible. Le manque de tests approfondis sur les animaux avant les essais cliniques et l’autorisation basée sur les données de sécurité générées lors des essais qui ont duré moins de 3,5 mois, soulèvent des questions concernant la sécurité de ces vaccins. Le rôle récemment identifié du pic de glycoprotéine du SARS-CoV-2 qui peut induire des lésions endothéliales caractéristiques du COVID-19, même en l’absence d’infection, est extrêmement pertinent étant donné que la plupart des vaccins autorisés induisent la production de glycoprotéine Spike chez les receveurs. Compte tenu du taux élevé d’occurrence des effets indésirables et du large éventail de types d’effets indésirables signalés à ce jour, ainsi que du potentiel d’amélioration de la maladie due au vaccin, de l’immunopathologie Th2, de l’auto-immunité et de l’évasion immunitaire, il y a la nécessité d’une meilleure compréhension des bénéfices et des risques de la vaccination de masse, en particulier dans les groupes exclus des essais cliniques. Malgré les appels à la prudence, les risques de vaccination contre le SARS-CoV-2 ont été minimisés ou ignorés par les organisations de santé et les autorités gouvernementales. Nous appelons à la nécessité d’un dialogue pluraliste dans le cadre des politiques de santé.

Introduction

Depuis la déclaration de la pandémie Covid-19 en mars 2020, plus de 150 millions de cas et 3 millions de décès ont été rapportés dans le monde. Malgré les progrès de la polychimiothérapie ambulatoire précoce pour les patients à haut risque, entraînant une réduction de 85% des hospitalisations et des décès liés au COVID-19 [1], le paradigme actuel de contrôle est la vaccination de masse. Bien que nous reconnaissions l’effort impliqué dans le développement, la production et l’autorisation d’urgence des vaccins contre le SARS-CoV-2, nous sommes préoccupés par le fait que les risques ont été minimisés ou ignorés par les organisations de santé et les autorités gouvernementales, malgré les appels à la prudence [2-8].

Les vaccins contre d’autres coronavirus n’ont jamais été approuvés pour l’homme, et les données générées dans le développement de vaccins contre les coronavirus conçus pour susciter des anticorps neutralisants montrent qu’ils peuvent aggraver la maladie COVID-19 via une amélioration dépendante des anticorps (ADE) et l’immunopathologie Th2, quel que soit le vaccin. Plate-forme et méthode de livraison [9-11]. On sait que l’augmentation de la maladie d’origine vaccinale chez les animaux vaccinés contre le SARS-CoV et le MERS-CoV se produit à la suite d’une provocation virale et a été attribuée à des complexes immuns et à la capture virale médiée par Fc par les macrophages, qui augmentent l’activation et l’inflammation des lymphocytes T [11 -13].

En mars 2020, des immunologistes vaccinaux et des experts en coronavirus ont évalué les risques du vaccin contre le SARS-CoV-2, sur la base d’essais de vaccins contre le SARS-CoV sur des modèles animaux. Le groupe d’experts a conclu que l’EIM et l’immunopathologie constituaient une réelle préoccupation, mais a déclaré que leur risque était insuffisant pour retarder les essais cliniques, même si une surveillance continue serait nécessaire [14]. Bien qu’il n’y ait aucune preuve claire de la survenue d’EIM et d’immunopathologie liée au vaccin chez des volontaires immunisés avec des vaccins contre le SARS-CoV-2 [15], les essais de sécurité à ce jour n’ont pas spécifiquement abordé ces effets indésirables graves (EIG). Étant donné que le suivi des volontaires n’a pas dépassé 2-3,5 mois après la deuxième dose [16-19], il est peu probable qu’un tel EIG ait été observé. Malgré 92 erreurs de déclaration, on ne peut ignorer que même en tenant compte du nombre de vaccins administrés, selon le système américain de notification des effets indésirables des vaccins (VAERS), le nombre de décès par million de doses de vaccin administrées a été multiplié par plus de 10. Nous pensons qu’il y a un besoin urgent d’un dialogue scientifique ouvert sur la sécurité des vaccins dans le contexte de la vaccination à grande échelle. 

Dans cet article, nous décrivons certains des risques de la vaccination de masse dans le contexte des critères d’exclusion des essais de phase 3 et discutons de l’ESG rapporté dans les systèmes nationaux et régionaux d’enregistrement des effets indésirables. Nous soulignons les questions sans réponse et attirons l’attention sur la nécessité d’une approche plus prudente de la vaccination de masse. Nous pensons qu’il y a un besoin urgent d’un dialogue scientifique ouvert sur la sécurité des vaccins, dans le contexte de la vaccination à grande échelle. Dans cet article, nous décrivons certains des risques de la vaccination de masse dans le contexte des critères d’exclusion des essais de phase 3 et discutons de l’ESG rapporté dans les systèmes nationaux et régionaux d’enregistrement des effets indésirables. Nous soulignons les questions sans réponse et attirons l’attention sur la nécessité d’une approche plus prudente de la vaccination de masse. Nous pensons qu’il y a un besoin urgent d’un dialogue scientifique ouvert sur la sécurité des vaccins dans le contexte de la vaccination à grande échelle. Dans cet article, nous décrivons certains des risques de la vaccination de masse dans le contexte des critères d’exclusion des essais de phase 3 et discutons de l’ESG rapporté dans les systèmes nationaux et régionaux d’enregistrement des effets indésirables. Nous soulignons les questions sans réponse et attirons l’attention sur la nécessité d’une approche plus prudente de la vaccination de masse.

Critères d’exclusion de l’essai de phase 3 du SARS-CoV-2

À quelques exceptions près, les essais vaccinaux contre le SARS-CoV-2 ont exclu les personnes âgées [16-19], ce qui a rendu impossible l’identification de la survenue d’une éosinophilie post-vaccination et d’une inflammation accrue chez les personnes âgées. Des études sur les vaccins contre le SARS-CoV ont montré que les souris âgées immunisées couraient un risque particulièrement élevé d’immunopathologie Th2 potentiellement mortelle [9,20]. Malgré ces preuves et les données extrêmement limitées sur l’innocuité et l’efficacité des vaccins contre le SARS-CoV-2 chez les personnes âgées, les campagnes de vaccination de masse se sont concentrées dès le début sur cette tranche d’âge. La plupart des essais ont également exclu les volontaires enceintes et allaitantes, ainsi que celles souffrant d’affections chroniques et graves telles que la tuberculose, l’hépatite C, l’auto-immunité, les coagulopathies, le cancer et l’immunosuppression [16-29], bien que ces receveurs se voient désormais proposer le vaccin sous la prémisse de la sécurité.

 


JUSTE UN PETIT MOT

N’OUBLIEZ PAS DE VISITER  LA BOUTIQUE « VINTAGE par MICHEL »

Sur ce lien: Vintage par Michel

Ainsi vous supporterez  notre site bloqué par la censure médiatique!

Merci!


 

Un autre critère d’exclusion de presque tous les essais était l’exposition antérieure au SARS-CoV-2. C’est regrettable car cela a supprimé la possibilité d’obtenir des informations extrêmement pertinentes concernant les effets indésirables post-vaccinaux chez les personnes ayant déjà des anticorps anti-SARS-Cov-2. Au meilleur de nos connaissances, les EAD ne sont pas systématiquement surveillées pour tout âge ou groupe de conditions médicales actuellement administré par le vaccin. De plus, malgré une proportion substantielle de la population ayant déjà des anticorps [21], des tests pour déterminer le statut des anticorps anti-SARS-CoV-2 avant l’administration du vaccin ne sont pas effectués en routine.

Les effets indésirables graves des vaccins contre le SARS-CoV-2 passeront-ils inaperçus?

Le COVID-19 englobe un large spectre clinique, allant de la pathologie pulmonaire très légère ou sévère, à une maladie multi-organique mortelle avec dérégulation inflammatoire, cardiovasculaire et ou encore de la coagulation sanguine [22-24]. En ce sens, les cas d’EIM ou d’immunopathologie liés au vaccin seraient cliniquement indiscernables d’un COVID-19 sévère [25]. De plus, même en l’absence de virus SARS-CoV-2, la glycoprotéine de Spike seule provoque des lésions endothéliales et une hypertension in vitro et in vivo chez les hamsters syriens en régulant à la baisse l’enzyme de conversion de l’angiotensine 2 (ACE2) et en altérant la fonction mitochondriale [26]. Bien que ces résultats doivent être confirmés chez l’homme, les implications de cette découverte sont stupéfiantes, car tous les vaccins autorisés pour une utilisation d’urgence sont basés sur l’administration ou l’induction de la synthèse de glycoprotéines Spike. Dans le cas des vaccins à ARNm et des vaccins vectorisés par adénovirus, aucune étude n’a examiné la durée de la production de Spike chez l’homme après la vaccination. 

Selon le principe de prudence, il est parcimonieux de considérer que la synthèse de Spike induite par le vaccin pourrait provoquer des signes cliniques de COVID-19 sévère et être à tort comptée comme de nouveaux cas d’infections par le SARS-CoV-2. Si tel est le cas, les véritables effets indésirables de la stratégie de vaccination mondiale actuelle pourraient ne jamais être reconnus à moins que des études n’examinent spécifiquement cette question. Il existe déjà des preuves non causales d’augmentation temporaire ou soutenue des décès dus au COVID-19, suite à la vaccination dans certains pays (Fig.1). À la lumière de la pathogénicité de Spike, ces décès doivent être étudiés en profondeur pour déterminer s’ils sont liés à la vaccination. Aucune étude n’a examiné la durée de la production de Spike chez l’homme après la vaccination. 

Réactions indésirables imprévues aux vaccins contre le SARS-CoV-2

L’auto-immunité est un autre problème critique à prendre en compte, compte tenu de l’échelle mondiale de la vaccination contre le SARS-CoV-2. Le SARS-CoV-2 possède de nombreuses protéines immunogènes, et tous sauf un ont des similitudes avec les protéines humaines [27]. Ceux-ci peuvent agir comme une source d’antigènes, conduisant à une auto-immunité [28]. S’il est vrai que les mêmes effets pourraient être observés lors d’une infection naturelle par le SARS-CoV-2, la vaccination est destinée à la plupart de la population mondiale, alors que l’on estime que seulement 10% de la population mondiale a été infectée par le SARS-CoV -2, selon le Dr Michael Ryan, responsable des urgences à l’Organisation mondiale de la santé. Nous n’avons pas pu trouver de preuve qu’un quelconque vaccin actuellement autorisé a criblé et exclu les épitopes immunogènes homologues pour éviter une auto-immunité potentielle due à un amorçage pathogène.

Certains effets indésirables, notamment des troubles de la coagulation sanguine, ont déjà été rapportés chez des personnes vaccinées en bonne santé et jeunes. Ces cas ont conduit à la suspension ou à l’annulation de l’utilisation des vaccins adénoviraux vectorisés ChAdOx1-nCov-19 et Janssen dans certains pays. Il a maintenant été proposé que la vaccination avec ChAdOx1-nCov-19 puisse entraîner une thrombopénie thrombotique immunitaire (VITT) médiée par des anticorps activant les plaquettes contre le facteur plaquettaire-4, qui imite cliniquement la thrombocytopénie auto-immune induite par l’héparine [29]. Malheureusement, le risque a été négligé lors de l’autorisation de ces vaccins, bien que la thrombocytopénie induite par les adénovirus soit connue depuis plus d’une décennie et ait été un événement constant avec les vecteurs adénoviraux [30]. Le risque de VITT serait vraisemblablement plus élevé chez les personnes déjà à risque de caillots sanguins.

Au niveau de la population, il pourrait également y avoir des impacts liés aux vaccins. Le SARS-CoV-2 est un virus à ARN à évolution rapide, qui a jusqu’à présent produit plus de 40.000 variants [32,33] dont certains affectent le domaine antigénique de la glycoprotéine de Spike [34,35]. Compte tenu des taux de mutation élevés, la synthèse induite par le vaccin de niveaux élevés d’anticorps anti-SARS-CoV-2-Spike pourrait théoriquement conduire à des réponses sous-optimales contre les infections ultérieures par d’autres variants chez les individus vaccinés [36], un phénomène connu sous le nom de « sin »[37] ou amorçage antigénique [38]. On ne sait pas dans quelle mesure les mutations qui affectent l’antigénicité du SARS-CoV-2 se fixeront au cours de l’évolution virale [39], mais les vaccins pourraient vraisemblablement agir comme des forces sélectives entraînant des variantes avec une infectivité ou une transmissibilité plus élevée. Compte tenu de la forte similitude entre les variantes connues du SARS-CoV-2, ce scénario est peu probable [32,34] mais si les variantes futures devaient différer davantage dans les épitopes clés, la stratégie de vaccination mondiale aurait pu contribuer à façonner un virus encore plus dangereux. Ce risque a été récemment porté à l’attention de l’OMS sous forme de lettre ouverte [40].

Discussion

Les risques décrits ici constituent un obstacle majeur à la poursuite de la vaccination mondiale contre le SARS-CoV-2. Des preuves de l’innocuité de tous les vaccins contre le SARS-CoV-2 sont nécessaires avant d’exposer davantage de personnes au risque de ces expériences, car la libération d’un vaccin candidat sans le temps de bien comprendre l’impact qui en résulterait sur la santé, pourrait conduire à une exacerbation de la crise mondiale actuelle. [41]. La stratification des risques des vaccinés est essentielle. Selon le gouvernement britannique, les personnes de moins de 60 ans ont un risque extrêmement faible de mourir du COVID-19. Cependant, selon Eudravigillance, la plupart des effets indésirables graves consécutifs à la vaccination contre le SARS-CoV-2 surviennent chez des personnes âgées de 18 à 64 ans. Le calendrier de vaccination prévu pour les enfants âgés de 6 ans et plus aux États-Unis et au Royaume-Uni est particulièrement préoccupant. Dr. Anthony Fauci a récemment prévu que les adolescents de tout le pays seront vaccinés à l’automne et les plus jeunes au début de 2022. Le Royaume-Uni attend les résultats des essais pour commencer la vaccination de 11 millions d’enfants de moins de 18 ans aux vaccins expérimentaux, étant donné que les Centers for Disease Control and Prevention estime qu’ils ont un taux de survie de 99,997% s’ils sont infectés par le SARS-CoV-2. Non seulement le COVID-19 n’est pas pertinent en tant que menace pour ce groupe d’âge, mais il n’existe aucune preuve fiable pour étayer l’efficacité ou l’efficacité du vaccin dans cette population, ou pour écarter les effets secondaires nocifs de ces vaccins expérimentaux. En ce sens, lorsque les médecins conseillent aux patients l’administration élective de la vaccination COVID-19, il y a un grand besoin de mieux comprendre les avantages et les risques de l’administration, en particulier dans les groupes peu étudiés.

En conclusion, dans le contexte de l’autorisation d’urgence d’une utilisation des vaccins contre le SARS-CoV-2, et des lacunes actuelles dans notre compréhension de leur innocuité, les questions suivantes doivent être soulevées :

– Est-ce que l’on sait si les anticorps à réaction croisée provenant d’infections antérieures à coronavirus ou les anticorps induits par le vaccin peuvent influencer le risque de pathogenèse involontaire après la vaccination avec COVID-19 ?

– Le risque spécifique d’EIM, d’immunopathologie, d’auto-immunité et de réactions indésirables graves a-t-il été clairement divulgué aux receveurs de vaccins afin de répondre à la norme d’éthique médicale de compréhension du patient pour le consentement éclairé ? Sinon, quelles en sont les raisons et comment pourrait-il être mis en œuvre?

– Quelle est la justification de l’administration du vaccin à chaque individu lorsque le risque de mourir du COVID-19 n’est pas égal entre les groupes d’âge et les conditions cliniques, et lorsque les essais de phase 3 ont exclu les personnes âgées, les enfants et les affections spécifiques fréquentes ?

– Quels sont les droits légaux des patients s’ils sont lésés par un vaccin contre le SARS-CoV-2 ? Qui couvrira les frais de traitement médical ? Si les réclamations devaient être réglées avec des fonds publics, le public a-t-il été informé que les fabricants de vaccins ont obtenu l’immunité et que leur responsabilité d’indemniser les personnes lésées par le vaccin a été transférée aux contribuables?

Dans le contexte de ces préoccupations, nous proposons de mettre un terme à la vaccination de masse et d’ouvrir un dialogue urgent pluraliste, critique et scientifiquement fondé sur la vaccination contre le SARS-CoV-2 entre les scientifiques, les médecins, les agences internationales de santé, les autorités réglementaires, les gouvernements et les développeurs de vaccins. C’est le seul moyen de combler le fossé actuel entre les preuves scientifiques et la politique de santé publique concernant les vaccins contre le SARS-CoV-2. Nous sommes convaincus que l’humanité mérite une compréhension plus profonde des risques que ce qui est actuellement présenté comme la position officielle. Un dialogue scientifique ouvert est urgent et indispensable pour éviter l’érosion de la confiance du public dans la science et la santé publique et pour garantir que l’OMS et les autorités sanitaires nationales protègent les intérêts de l’humanité pendant la pandémie actuelle. Il est urgent de ramener la politique de santé publique à la médecine factuelle, en s’appuyant sur une évaluation minutieuse de la recherche scientifique pertinente. Il est impératif de suivre la science.

1  https://www.gov.uk/government/publications/covid-19-reported-sars-cov-2-deaths-in-england/covid-19-confirmed-deaths-in-england-report

Lien de l’article en anglais : https://en-volve.com/2021/05/08/57-top-scientists-and-doctors-release-sh…

Déclaration de conflit d’intérêts

Les auteurs déclarent que la recherche a été menée en l’absence de toute relation commerciale ou financière pouvant être interprétée comme un conflit d’intérêts potentiel.

 

Les références

McCullough PA, Alexander PE, Armstrong R et al. Traitement multidrogue séquentiel multiforme hautement ciblé de l’infection ambulatoire précoce à haut risque par le SARS-CoV-2 (COVID-19). Rev Cardiovasc Med (2020) 21: 517-530. doi: 10.31083 / j.rcm.2020.04.264

Arvin AM, Fink K, Schmid MA, et al. Une perspective sur le renforcement potentiel dépendant des anticorps du SARS-CoV-2. Nature (2020) 484: 353–363. doi: 10.1038 / s41586-020-2538-8

Coish JM, MacNeil AJ. Hors de la poêle et dans le feu? Diligence raisonnable justifiée pour ADE dans COVID-19. Microbes infectés (2020) 22 (9): 405-406. doi: 10.1016 / j.micinf.2020.06.006

Eroshenko N, Gill T, Keaveney ML et coll. Implications de l’augmentation de l’infection dépendante des anticorps pour les contre-mesures contre le SARS-CoV-2. Nature Biotechnol (2020) 38: 788–797. doi: 10.1038 / s41587-020-0577-1

Pologne GA. Tortues, lièvres et vaccins: une mise en garde pour le développement d’un vaccin contre le SARS-CoV-2. Vaccine (2020) 38: 4219–4220. doi: 10.1016 / j.vaccine.2020.04.073

Shibo J.Ne vous précipitez pas pour déployer les vaccins et médicaments COVID-19 sans garanties de sécurité suffisantes. Nature (2000) 579 321. doi: 10.1038 / d41586-020-00751-9

Munoz FA, Cramer JP, Dekker CL et al. Maladie renforcée associée au vaccin: définition de cas et lignes directrices pour la collecte de données, l’analyse et la présentation des données sur la sécurité de la vaccination. Vaccin (2021) https : // doi . org / 10 . 1016 / j . vaccin . 2021 . 01 . 055

Cardozo T, Veazey R. Divulgation du consentement éclairé aux sujets des essais vaccinaux d’un risque d’aggravation de la maladie clinique par les vaccins COVID-19. Int J Clin Pract (2020) 28: e13795. doi: 10.1111 / ijcp.13795

Bolles D, Long K, Adnihothram S et coll. Un vaccin contre le coronavirus du syndrome respiratoire aigu sévère à double inactivation fournit une protection incomplète chez la souris et induit une réponse pulmonaire pro-inflammatoire éosinophile accrue lors de la provocation. J Virol (2001) 85: 12201-12215. doi: 10.1128 / JVI.06048-11

Weingartl H, Czub M, Czub S, et al. Vaccination avec le virus de la vaccine modifié Le vaccin recombinant à base d’Ankarab contre le syndrome respiratoire aigu sévère est associé à une hépatite accrue chez les furets. J Virol (2004) 78: 12672-12676. doi: 10.1128 / JVI.78.22.12672-12676.2004272

Tseng CT, Sbrana E, Iwata-Yoshikawa N, et al. L’immunisation avec les vaccins contre le coronavirus du SARS conduit à une immunopathologie pulmonaire en cas de provocation avec le virus du SARS. PLoS One (2012) 7 (4): e35421. doi: 10.1371 / journal.pone.0035421

Iwasaki A, Yang Y. Le danger potentiel de réponses d’anticorps sous-optimales dans COVID-19. Nat Rev Immunol (2020) 20: 339–341. doi: 10.1038 / s41577-020-0321-6

Vennema H, de Groot RJ, Harbour DA, et al. Mort précoce après une provocation par le virus de la péritonite infectieuse féline due à l’immunisation par le virus de la vaccine recombinant. J Virol (1990) 64: 1407-1409

Lambert PH, Ambrosino DM, Andersen SR, et al. Rapport de synthèse de consensus pour la réunion du CEPI / BC du 12 au 13 mars 2020: Évaluation du risque d’amélioration de la maladie avec les vaccins COVID-19. Vaccin (2020) 38 (31): 4783-4791. doi: 10.1016 / j.vaccine.2020.05.064

de Alwis R, Chen S, Gan S et al. Impact du renforcement immunitaire sur la thérapie par globuline hyperimmunisée polyclonale Covid-19 et le développement de vaccins. EbioMedicine (2020) 55: 102768. doi: 10.1016 / j.ebiom.2020.102768

Folegatti PM, Ewer KJ, Aley PK, et al. Sécurité et immunogénicité du vaccin ChAdOx1 nCoV? 287 19 contre le SARS-CoV-2: un rapport préliminaire d’un essai contrôlé randomisé de phase 1/2, en simple aveugle. Lancet (2020) 396: 467–783. doi: 10.1016 / S0140-6736 (20) 31604-4

Polack FP, Thomas SJ, Kitchin N.Innocuité et efficacité du vaccin BNT162b2 ARNm Covid-19. N Engl J Med (2020) 383: 2603-2615. doi: 10.1056 / NEJMoa2034577

Ramasamy MN, Minassian AM, Ewer KJ et al. Innocuité et immunogénicité du vaccin ChAdOx1 nCoV-19 administré dans un régime de premier coup de pouce chez les adultes jeunes et vieux (COV002): un essai de phase 2/3 randomisé, contrôlé en simple aveugle Lancet (2021) 396: 1979–93. doi: 10.1016 / S0140-6736 (20) 32466-1

Chu L, McPhee R, Huang W et coll. Groupe d’étude ARNm-1273. Un rapport préliminaire d’un essai randomisé contrôlé de phase 2 sur l’innocuité et l’immunogénicité du vaccin ARNm-1273 SARS-CoV-2. Vaccin (2021) S0264-410X (21) 00153-5. doi: 10.1016 / j.vaccine.2021.02.007

Liu L, Wei Q, Lin Q et coll. Les IgG anti-pic provoquent de graves lésions pulmonaires aiguës en biaisant les réponses des macrophages au cours d’une infection aiguë par le SARS-CoV. JCI Insight (2019) 4 (4): e123158. doi: 10.1172 / jci.insight.123158.

Ioannidis PA. Taux de mortalité par infection du COVID-19 déduit des données de séroprévalence. Bull WHO (2021) 99: 19–33F. http : // dx . doi . org / 10 . 2471 / BLT . 20 . 265892

Martines RB, Ritter JM, Matkovic E et coll. Pathologie et pathogenèse du SARS-CoV-2 associé à la maladie mortelle à coronavirus, États-Unis Emerg Infect Dis (2020) 26: 2005-2015. doi: 10.3201 / eid2609.202095

Wu Z, McGoogan JM. Caractéristiques et leçons importantes de l’épidémie de maladie à coronavirus 2019 (COVID-19) en Chine: résumé d’un rapport de 72314 cas du Centre chinois de contrôle et de prévention des maladies. JAMA (2020) 323: 1239-1242. doi: 10.1001 / jama.2020.2648

Xu Z, Shi L, Wang Y et al. Découvertes pathologiques du COVID-19 associé au syndrome de détresse respiratoire aiguë. Lancet Respiratory Med (2020) 8: 420-422 doi: 10.1016 / S2213-2600 (20) 30076-X

Negro F. L’amélioration dépendante des anticorps joue-t-elle un rôle dans la pathogenèse du COVID-19? Swiss Medical Weekly (2020) 150: w20249. doi: 10.4414 / smw.2020.20249317

Lei Y, Zhang J, Schiavon CR et al., Spike Protein Empairs Endothelial Function via Downregulation of ACE 2. Circulation Res (2021) 128: 1323–1326. https : // doi . org / 10 . 1161 / CIRCRESAHA . 121 . 318902

Lyons-Weiler J.L’amorçage pathogène contribue probablement à la maladie grave et critique et à la mortalité du COVID-19 via l’auto-immunité, J Translational Autoimmunity (2020) 3: 100051. doi: 10.1016 / j.jtauto.2020.100051

An H, Park J. Molecular Mimicry Map (3M) of SARS-CoV-2: Prediction of potentiellement immunopathogenic SARS-CoV-2 epitopes via une nouvelle approche immunoinformatique. bioRxiv [Pré-impression]. 12 novembre 2020 [cité le 19 avril 2020] https : // doi . org / 10 . 1101 / 2020 . 11 . 12 . 344424

Greinacher A, Thiele T, Warkentin TE, Weisser K, Kyrle PA, Eichinger S. Thrombocytopénie thrombotique après vaccination ChAdOx1 nCov-19. N Engl J Med (2021). doi: 10.1056 / NEJMoa2104840

Othman M, Labelle A, Mazzetti I et al. Thrombocytopénie induite par adénovirus: le rôle du facteur von Willebrand et de la P-sélectine dans la médiation de la clairance plaquettaire accélérée. Blood (2007) 109: 2832-2839. doi: 10.1182 / sang-2006-06-032524

Ortel TL. Facteurs de risque thrombotiques acquis en milieu de soins intensifs. Crit Care Med (2010) 38 (2 Suppl): S43-50. doi: 10.1097 / CCM.0b013e3181c9ccc8

Grubaugh ND, Petrone ME, Holmes EC. Nous ne devons pas nous inquiéter lorsqu’un virus mute lors d’épidémies. Nat Microbiol (2020) 5: 529-530. https : // doi . org / 10 . 1038 / s41564 – 020 – 0690 – 4

Greaney AJ, Starr TN, Gilchuk P et coll. Cartographie complète des mutations au domaine de liaison aux récepteurs de pointe du SARS-CoV? 339 2 qui échappent à la reconnaissance des anticorps. Cell Host Microbe (2021) 29: 44–57.e9. doi: 10.1016 / j.chom.2020.11.007.

Lauring AS, Hodcroft EB. Variantes génétiques du SARS-CoV-2 – Que signifient-elles? JAMA (2021) 325: 529-531. doi: 10.1001 / jama.2020.27124

Zhang L, Jackson CB, Mou H et coll. La mutation D614G dans la protéine de pointe SARS-CoV-2 réduit l’excrétion de S1 et augmente l’infectivité. bioRxiv [Pré-impression]. 12 juin 2020 [cité le 19 avril 2021] https : // doi . org / 10 . 1101 / 2020 . 06 . 12 . 148726

Korber B, Fischer WM, Gnanakaran S et al. Sheffield COVID-19 Genomics Group. Suivi des changements dans le pic de SARS-CoV-2: preuve que le D614G augmente l’infectivité du virus COVID-19. Cellulaire (2020) 182: 812-827.e19. doi: 10.1016 / j.cell.2020.06.043

Francis T. Sur la doctrine du péché antigénique originel. Proc Am Philos Soc (1960) 104: 572-578.

Vibroud C, Epstein SL. La première grippe est éternelle. Science (2016) 354: 706–707. doi: 10.1126 / science.aak9816

Weisblum Y, Schmidt F, Zhang F et al. Échapper aux anticorps neutralisants par les variants de protéine de pointe CoV-2 du SARS? 354. Elife (2020) 9: e61312. doi: 10.7554 / eLife.61312

Vanden Bossche G (6 mars 2021) https : // dryburgh . com / wp – 356content / uploads / 2021 / 03 / Geert _ Vanden _ Bossche _ Ouvert _ Lettre _ OMS _ Mars _ 6 _ 2021 . pdf

Coish JM, MacNeil AJ. Hors de la poêle et dans le feu? Diligence raisonnable justifiée pour ADE dans COVID-19. Microbes infectés (2020) 22 (9): 405-406. doi: 10.1016 / j.micinf.2020.06.006

Légendes de la figure

Figure 1. Nombre de nouveaux décès dus au COVID-19 par rapport au nombre de personnes ayant reçu au moins une dose de vaccin pour certains pays. Le graphique montre les données du début de la vaccination au 3 mai 365, 2021. A) Inde (9,25% de la population vaccinée), B) Thaïlande (1,58% de la population vaccinée), C) Colombie (6,79% de la population vaccinée), D) Mongolie (31,65% de la population vaccinée), E) Israël (62,47% de la population vaccinée), F) Monde entier (7,81% de la population vaccinée). Les graphiques ont été construits à l’aide des données de Our World in Data (consulté le 4 mai 2021) https : // github . com / owid / covid – 19 – données / arbre / maître /public / données / vaccinations

Affiliations

1 Epidemiólogos Argentinos Metadisciplinarios. República Argentina.
2 Centre médical de l’Université Baylor. Dallas, Texas, États-Unis.
3 Monestir de Sant Benet de Montserrat, Montserrat, Espagne
4 INSERM U781 Hôpital Necker-Enfants Malades, Université Paris Descartes-Sorbonne Cité, Institut Imagine, Paris, France.
5 École des sciences naturelles. Université autonome de Querétaro, Querétaro, Mexique.
6 Professeur retraité d’immunologie médicale. Universidad de Guadalajara, Jalisco, Mexique.
7 Médicos por la Verdad Puerto Rico. Centre médical d’Ashford. San Juan, Porto Rico.
8 Professeur retraité de processus de diagnostic clinique. Université de Murcie, Murcie, Espagne
9Urologue Hôpital Comarcal de Monforte, Université de Saint-Jacques-de-Compostelle, Espagne.
10 Biólogos por la Verdad, Espagne.
11 Biologiste à la retraite. Université de Barcelone. Spécialisé en microbiologie. Barcelone, Espagne.
12 Centre de médecine intégrative MICAEL (Medicina Integrativa Centro Antroposófico Educando en Libertad). Mendoza, République argentine.
13 Médicos por la Verdad Argentina. República Argentina. ´
14 Médicos por la Verdad Uruguay. República Oriental del Uruguay.
15 Médicos por la Libertad Chili. República de Chile.
16 Médecin, orthopédiste. República de Chile.
17 Médicos por la Verdad Perú. República del Perú.
18Médicos por la Verdad Guatemala. República de Guatemala.
19 Concepto Azul SA Équateur.
20 Médicos por la Verdad Brasil. Brésil.
21 Médicos por la Verdad Paraguay.
22 Médicos par Costa Rica.
23 Médicos por la Verdad Bolivie.
24 Médicos por la Verdad El Salvador.
* Correspondance: Karina Acevedo-Whitehouse,  karina.acevedo.whitehouse@uaq.mx

Source 

 

 

 

 

 

La Grande Arnaque du COVID 19 et dictature de la pensée unique:YouTube a annoncé supprimer “Tout ce qui va à l’encontre des recommandations de l’OMS”

On l’a constaté avec la vidéo du médecin américain Dan Erickson vues par des millions d’internautes et supprimée à plusieurs reprises : YouTube a instauré de nouvelles règles qui ne font pas grand cas de la liberté d’expression.

Selon le site Businessinsider : “Susan Wojcicki, DG de YouTube, a suggéré que la plateforme vidéo pourrait supprimer les contenus qui contredisent les conseils de l’Organisation mondiale de la santé (OMS) sur le Covid-19. Dimanche sur CNN, elle a déclaré que YouTube “supprimerait les informations qui posent problème”, y compris “tout ce qui est médicalement non fondé.” […] et “Tout ce qui va à l’encontre des recommandations de l’OMS serait une violation de notre politique et donc retiré”, a-t-elle poursuivi.

 

Sources :
BusinessInsider.fr
CNN

Même Google

Le site TheConversation.com rapporte par ailleurs que : “Google supprime les informations trompeuses concernant le Covid-19 sur YouTube, Google Maps, ses plates-formes de développement comme Play, et dans les publicités. Twitter vérifie, entre autres, les comptes qui sont des sources crédibles d’information sur le Covid-19 et surveille les conversations pour s’assurer que les mots clés recherchés sur le virus permettent d’accéder aux informations fiables.”

Sources : TheConversation.com
Communiqué Google
Communiqué Twitter


EN COMPLÉMENTAIRE

 la vidéo du médecin américain Dan Erickson

 

Dr Dan Erickson

 

Le médecin californien Dan Erickson a décrit ses observations concernant le Covid-19 lors d’une conférence de presse le 22 avril. Voici ce qu’il a dit.

 

En se basant sur les taux respectifs de tests positifs, le Dr. Dan Erickson a calculé que “le taux de létalité du Covid-19 serait actuellement de 0,03% en Californie, 0,05% en Espagne, 0,09% en Suède et 0,1% dans l’État de New York, en comparaison le taux de létalité de la grippe aux États-Unis est d’environ 0,13%.”

Il rapporte par ailleurs que “des médecins de plusieurs États américains ont été “poussés” à délivrer des certificats de décès mentionnant Covid-19, contre leur propre avis”.

Le Dr. Erickson affirme également que “le confinement et la peur affaiblissent le système immunitaire et la santé des personnes. Il y a déjà eu une augmentation significative des “effets secondaires” tels que l’alcoolisme, la dépression, le suicide et la maltraitance des enfants et des conjoints.”

Enfin, le médecin américain recommande que “seuls les malades, et non les personnes en bonne santé ou la société entière, soient mis en quarantaine”. Et selon lui, “porter un masque n’a de sens que dans des situations aiguës comme à l’hôpital, mais pas dans la vie de tous les jours”

[…]

À noter que la vidéo a déjà été supprimée à plusieurs reprises par YouTube pour “non respect des règles”. La version ci-dessous est hébergée sur notre site web.

Voir la vidéo :

 

 

 

 

 

La Grande Arnaque du Covid 19:Le Burundi devient la deuxième nation africaine à expulser l’OMS

La Tanzanie n’est pas le seul pays africain à avoir demandé à l’OMS de faire ses valises et de partir.

Reuters a rapporté que le Burundi a expulsé le chef national de l’OMS et trois de ses subordonnés alors que le pays se prépare à une élection présidentielle qui aura lieu la semaine prochaine. L’OMS a fait part de ses inquiétudes à plusieurs reprises, affirmant qu’il ne serait pas prudent de tenir le vote en pleine pandémie.

Ces affirmations ont manifestement irrité le gouvernement, qui fait pression pour organiser la première élection du pays depuis la démission du président Pierre Nkurunziza en 2018. Un candidat successeur du parti de Nkurunziza est le grand favori pour remporter les élections. Son gouvernement a été accusé de violations des droits de l’homme et a déjà expulsé des représentants de l’ONU et d’autres personnes enquêtant sur les violations des droits de l’homme, mais les candidats de l’opposition contestent ouvertement le vote et toute tactique de répression a été largement cachée.

De nombreux critiques du gouvernement et de l’opposition ont critiqué la décision, bien que, notamment, personne ne plaide pour l’annulation de l’élection, signe que l’insistance de l’OMS n’a pas été reçue par la population. La campagne a déjà donné lieu à de nombreux rassemblements où les gens étaient entassés, et beaucoup soupçonnent que le véritable bilan du virus ne se reflète pas dans les chiffres officiels.

 

Les quatre fonctionnaires ont jusqu’à vendredi pour quitter le pays.

 

Le gouvernement a confirmé jeudi qu’une lettre du 12 mai du ministère des affaires étrangères a été envoyée au chef de pays de l’OMS, Walter Kazadi Mulombo, et à trois autres experts de la santé de l’organisme des Nations unies, leur donnant jusqu’à vendredi pour quitter le pays.

Bernard Ntahiraja, le ministre adjoint des affaires étrangères, a déclaré que les fonctionnaires avaient été déclarés « persona non grata » mais n’a pas donné de raisons.

Le responsable de l’OMS pour l’Afrique a également critiqué cette décision et a soutenu l’expulsion des fonctionnaires de l’OMS. Cependant, l’OMS a déclaré qu’elle continuerait à soutenir le Burundi dans sa lutte contre le virus.

Le vote pour le successeur du président Pierre Nkurunziza, dont le gouvernement a été accusé à plusieurs reprises de violations des droits et a déjà expulsé d’autres représentants d’organismes internationaux, est prévu pour le 20 mai.

Le directeur régional de l’OMS pour l’Afrique, Matshidiso Moeti, a qualifié Mulombo de « gestionnaire extrêmement compétent ».

« Nous restons très disposés à … soutenir la réponse (du Burundi) au COVID-19 » a-t-il déclaré lors d’une conférence de presse dans la capitale éthiopienne, Addis-Abeba.

Contrairement à beaucoup d’autres pays africains, le Burundi n’a mis en place aucune mesure de confinement, et les rapports du pays sont trop rares pour dire à quel point son système de santé pourrait être mis à rude épreuve.

Aube Digitale

 

 

 

La Grande Arnaque du COVID 19:Les crimes de l’OMS passés sous silence une vidéo et divers liens de recherches

 

 

 

 

 

Tedros Adhanom a été ministre des affaires étrangères en Éthiopie,alors gouvernée par une dictature marxiste très sanguinaire!

Le directeur général de l’Organisation mondiale de la santé, M. Tedros Adhanom, a corrompu la Chine avec des millions de cendriers. Cet homme est le représentant de la Chine à W.H.O. et c’est évident maintenant. Son crime qu’il a commis lorsqu’il était ministre de la Santé et ministre des Affaires étrangères en Éthiopie dans le cadre d’un parti marxiste-terrosiste aurait dû le mettre en prison pour le reste de sa vie, mais ce qu’il a vécu comme un criminel pour avoir couvert une pandémie de choléra sous le nom de diarrhée aqueuse aiguë, pour le génocide systématique sur le groupe ethnique Amharas donnant des médicaments stérilisants et d’autres nombreuses mauvaises actions bizarres (vous pouvez regarder le documentaire complet qu’il a fait à partir de ce lien: https://youtu.be/KK8Bj14bqu0) était tous considéré comme le meilleur CV pour avoir une clé poste à l’OMS Cet homme est un criminel et quelle que soit l’excuse qu’il apporte et joue les victimes, il doit non seulement démissionner de W.H.O mais il doit être exécuté légalement. Sources : Tedros Adhanom de l’OMS devrait être jugé pour des crimes contre l’humanité | par John Martin https://www.youtube.com/watch?v=I9Wb0… Plus de vidéos sur ce TEDROS Adhanom et W.H.O. , consultez les liens suivants: https://www.youtube.com/watch?v=KK8Bj… https://www.youtube.com/watch?v=JNLh2… https://www.youtube.com/watch?v=oUVWx… https://www.youtube.com/watch?v=famve… #OMS #WHO #TedrosAdhanom

 

 

Le directeur du NIH, le Dr Francis S. Collins (à gauche) et le directeur de Fogarty, le
Dr Roger I. Glass (à droite), ont rencontré le nouveau
directeur général de l’ OMS , le Dr Tedros, lors de sa visite aux États-Unis,en juillet 2017.
On les voit ici ,faire le signe maçonnique du pouce levé.


 

 


ENCOMPLÉMENT

En 2015,le ministre éthiopien des Affaires étrangères Tedros Adhanom pris dans un scandale de 20 millions de dollars de prix pour les adolescents.

Le ministre des Affaires étrangères de l’Éthiopie avait été pris dans un réseau explosif de mensonges avec une écolière alors que le gouvernement de l’Australie et la Fondation Rotary ont nié avoir donné 20 millions de dollars australiens à un adolescent de 14 ans, que le « haut de la nation » diplomate »a publiquement loué et endossé le titre de« philanthrope exemplaire »et a affirmé qu’elle était la gagnante d’un« prix international »sans nom.

La fille éthiopienne-australienne, Beritu Jaleta Ahmed, a affirmé lors d’une conférence de presse conjointe avec le Dr Tedros Adhanom dans son propre bureau qu’elle était prête à construire une école en Éthiopie avec les 20 millions de dollars australiens qu’elle avait gagnés lors d’un concours étudiant tenue à son école à Melbourne. Selon elle, le prix en argent a été financé conjointement par le gouvernement australien et le Rotary Club of Australia [sic].

Mais la direction du Baden Powell College, qui ne savait rien du concours ou du prix, a déjà renvoyé l’affaire à la police de Victoria pour enquête, a appris Addis Voice. L’école publique qui emmène les élèves de la prépa à la 9e année est dominée par les élèves issus de familles immigrées. Il compte environ 1800 étudiants, 180 employés et 50 bénévoles. Il reçoit un budget annuel d’environ 12 millions de dollars australiens des coffres du Victoria Department of Education.

Étrange mais vrai!


AUTRES INFORMATIONS

Le Rotary Club et le Lion Club : deux avant-postes Illuminati et francs-maçons

 

Ribaat : Voici le Logo du Rotary Club International et bien planter en Algérie, ce logo cache le symbole de la Franc Maçonnerie Luciférienne.

 

Le Rotary a vu le jour à Chicago, Illinois, aux États-Unis le 23 février 1905. C’est à cette date que son fondateur, Paul P. Harris, avocat, tint la première réunion, en compagnie de trois amis, Silvester Schiele, négociant en charbon, Gustavus H. Loehr, ingénieur des mines et Hiram E. Shorey, tailleur. Ils étaient d’origine allemande, suédoise, irlandaise, américaine et représentaient les confessions protestante, catholique et israélite. Deux des quatre fondateurs étaient Franc-maçons, P. Harris et Gustavus E. Loehr, qui d’ailleurs ne restera membre que très peu de temps avant de retourner à laFranc-maçonnerie. Hiram E. Shorey quittera également très vite le Rotary, pour, semble-t-il, des raisons professionnelles.

 

http://www.rotaryclub-tunis-belvedere.org/html/ralgerietxt.htm

http://www.rotaryclub-tunis-belvedere.org/html/membres.htm

http://fr.wikipedia.org/wiki/Rotary_International#Rotary_et_franc-ma.C3.A7onnerie

http://www.sergegouteyron-rotary.org/rotaryenfrance.htm

 

Melvin Jones, créateur le 7 juin 1917 du Lions Clubs, est né le 13 janvier 1879 à Fort Thomas dans l’Arizona aux États-Unis. Devenu propriétaire d’une compagnie d’assurance, il adhère au Business Circle de Chicago dont il devient le secrétaire. Il était aussi Franc-maçon. Il est mort le 1er juin 1961.

 

Pour savoir qui dirige la Franc-maçonnerie du haut de la pyramide maçonnique :

 

Albert Pike, Discours prononcé en France en 1889 et adressé aux hauts degrés de la maçonnerie de «Rite Palladique », publié par la revue anglaise « The Freemason » dans son numéro du 19 janvier 1935 (cf. Epiphanius in « Maçonnerie et sectes secrètes : le côté caché de l’histoire », pp. 508-509) :

 

 

« Voilà ce que nous devons dire aux foules : “ Nous adorons un Dieu, mais c’est le Dieu qui s’adore sans superstition ”. A toi, Souverain Grand Instructeur Général, nous disons ceci, que tu peux répéter aux Frères des 32°, 31° et 30° ème degré: “ La Religion maçonnique devrait être maintenue, par nous tous initiés de hauts degrés, dans la pureté de la doctrine luciférienne. Si Lucifer n’était pas Dieu, Adonaï (le Dieu des chrétiens) dont les actions prouvent sa cruauté, sa perfidie, sa haine pour l’homme, sa barbarie et sa répulsion pour la science, l’aurait-il calomnié avec ses prêtres ? Oui, Lucifer est Dieu, et malheureusement Adonaï est aussi Dieu. Par la loi éternelle selon laquelle il n’y a pas de lumière sans ombre, de beauté sans laideur, de blanc sans noir, l’absolu peu seulement exister comme deux Divinités : l’obscurité étant nécessaire à la lumière pour lui servir de contraste, comme le piédestal est nécessaire à la statue et le frein à la locomotive… La doctrine du Satanisme est une hérésie ; et la véritable et pure religion philosophique est la foi en Lucifer, l’égal de Adonaï ; mais Lucifer, Dieu de lumière [avec l’une de ses orgueilleuses devises : Post tenebras lux] et Dieu du bien, lutte pour l’humanité contre Adonaï, le dieu des ténèbres et démon ”. »

 

http://www.lionsclubalgerie.org/

http://www.lionsclubs.org/FR/lci-foundation/about-us/lions-lcif-mission.php

http://www.lionsclub-algerzhira.org/

http://fr.wikipedia.org/wiki/Lions_Clubs

 

Dans la vidéo suivante, à 3 :27, un membre lors de son serment dit ce qui suit :

 

« [J’accepte] avoir conscience de représenter ma profession auprès de vous et d’en être ainsi l’ambassadeur, je vous en présenterais les données actuelles et ultérieurement son évolution »

Et s’il s’agissait d’un membre du gouvernement?

 

http://www.dailymotion.com/video/x9u9zf_naissance-du-rotary-club-montpellie_news

 

Dans cette autre vidéo ci-dessous, pensez vous que le peuple algérien a besoin de ce genre de futilités ?

 

http://www.dailymotion.com/video/x5ubll_rotary-club-montpellier-et-son-proj_news

 

5/ Les clubs maçonniques en Algérie…

 

http://www.webalgerie.com/les-clubs-maconniques-en-algerie%E2%80%A6

 

Le quotidien Echorouk aurait appris que l’association dite Lions Club qui est une branche du mouvement mondial maçonnique a commencé à restructurer ses bureaux dans différentes wilayas. L’épouse d’un des ambassadeurs arabes à Alger s’est déplacée incognito, il y a quelques mois, à Médéa pour inaugurer personnellement les activités du bureau local du Lions Club. Immédiatement après son installation, ce bureau a procédé à la distribution d’aides au profit d’un centre de handicapés à Chlef.

 

Le Lions Club, tout comme le Rotary, est considéré comme l’un des plus importants vecteurs dumouvement maçonnique. Il se base sur l’action caritative en direction des franges pauvres et vulnérables, d’où cet intérêt pour les wilayas qui avaient été affectées par le terrorisme (Ribaat : Créer de toute pièce par l’état apostat, en massacrant les musulmans pour ensuite le mettre sur le compte des moudjahidines. BUT : Rendre Haineux les populations face à l’Islam et stopper sa monter au pouvoir, preuves : http://les-tyrans-de-ce-monde.over-blog.com/article-bilan-historique-reel-de-l-algerie-de-1988-a-2009-0-6-38196178.html,  http://les-tyrans-de-ce-monde.over-blog.com/article-34448887.html).

 

La création de ces clubs dans les pays arabes a suscité une vive consternation au regard des objectifs douteux de l’association dont les activités sont liées à la franc-maçonnerie qui est une société secrète dirigée par les juifs dans le monde. Ce mouvement est largement présent dans les pays arabes, notamment le Liban où les francs-maçons activent ouvertement et accueillent quelque 100 mille libanais.

Le siège principal du Lions Club se trouve dans l’Etat de l’Illinois aux États-Unis, et Lions fait référence aux gardiens du temple; allusion équivoque au fondement maçonnique de ces clubs. Les maçonniques veulent ressusciter le temple de Soliman. L’action caritative n’est qu’une couverture pour servir en toute quiétude le mouvement sioniste, à l’instar des autres associations maçonniques.

NDLR: avant de publier cette info, nous avons courus à la bibliothèque de la ville se procurer un livre de référence sur la Franc Maçonnerie « La Franc-Maçonnerie sous l’éclairage biblique » publié aux éditions Contrastes. »

 

nous pouvons y trouver le serment : Avant d’être admis le futur maçon doit jurer: « au cas où je transgresserais dans la plus petite mesure mon serment, que mon cou soit coupé, que mon cœur mes dents et mes entrailles soient arrachés et jetés au fond des mers, que mon corps soit brulé et mes cendres dispersées dans les airs pour qu’il ne reste rien de moi et de ma pensée parmi les hommes et les frères maçons ». (p 66)

 

ou encore en page 72 : Les « Rotary club » et « Lion’s Club » sont à la fois des pépinières de maçons et la manifestation publique de leurs préoccupations caritatives. Une très forte proportion (jusqu’à 80% selon les pays) des membres du Rotary sont également maçons. Ce sont les cours extérieures du temple. (p 72)


…AU QUÉBEC,FRANÇOIS LEGAULT REÇOIT  UN APPUI TOTAL DU ROTARY CLUB ET DU LION CLUB: LA PUISSANCE FINANCIÈRE DES FRANCS MAÇONS

 

Voici des visages ,des gestes et des dates:

Un membre influent du Lion club.
Ici,Claude Dagenais fait une donnation.
Clément Dion, vice-président de la Maison, Sylvain Perreault, président sortant du Club Lions la Seigneurie, Yvon Poirier, membre du Club Lions, Jean-Louis Legault, président de la Maison Adhémar-Dion, Claude Dagenais, membre du Club Lions, Gilbert Cadieux, directeur général de la Maison, Claude Laurent et Lucie Lafortune, membres du Club Lions.
Scott McKay en compagnie de Chantale Deschamps,la mairesse de Repentigny,depuis plus de 16 ans et membre de la CAQ.Elle était candidate de la CAQ contre Scott McKay,en 2012.

 

Les « personnalités » appuyant Scott McKay en 2012.
Voici ce que dit cette photo de 2012:REPENTIGNY – Plusieurs personnalités de la région dont Nicolas Dufour, Claude Dagenais, Ani Müller, Rollande Dulong et Christian Morrissonneau, ont donné leur appui au candidat du Parti québécois dans Repentigny Scott McKay.

Voir notre article sur cette période pour mieux comprendre cette histoire de favoritime péquiste: Lien important

 

Trump coupe les vivres à l’OMS

Le président américain Donald Trump a annoncé mardi qu’il suspendait la contribution des États-Unis à l’Organisation mondiale de la santé (OMS) en raison de sa « mauvaise gestion » de la pandémie de COVID-19.

«Le monde a reçu plein de fausses informations sur la transmission et la mortalité de la COVID-19», a-t-il ajouté, dans un long réquisitoire contre cette agence de l’ONU.

Donald Trump hier.

Les États-Unis sont le premier contributeur de cette agence sanitaire, dont le siège est à Genève.

Le président républicain a évoqué une étude très approfondie qui pourrait durer de 60 à 90 jours.

Soulignant que les États-Unis contribuaient à hauteur de 400 à 500 millions de dollars américains par an à l’organisation, contre environ 40 millions et même moins pour la Chine, M. Trump a estimé que son pays avait le devoir de réclamer des comptes.

«Si l’OMS avait fait son travail et envoyé des experts médicaux en Chine pour étudier objectivement la situation sur le terrain, l’épidémie aurait pu être contenue à sa source avec très peu de morts», a-t-il martelé.

«Nous avons eu des problèmes avec eux depuis des années», a-t-il encore dit.

Donald Trump a été particulièrement agacé par les critiques de l’OMS à l’encontre de sa décision, fin janvier, d’interdire l’entrée aux États-Unis aux voyageurs en provenance de Chine – une mesure dont le locataire de la Maison-Blanche s’enorgueillit encore, assurant qu’elle a ralenti l’arrivée du virus.

«Aux yeux de l’OMS, la Chine a toujours raison», a déploré le président américain.

Pompeo sur la même longueur d’onde que Trump

Plus tôt, le secrétaire d’État américain, Mike Pompeo, avait indiqué que Washington veut changer radicalement le fonctionnement de l’OMS.

«L’OMS n’a pas fait ce qu’il fallait au début», a-t-il affirmé dans un entretien avec une radio de Floride, reprenant l’accusation de l’administration de Donald Trump qui juge que l’agence de l’ONU a été trop alignée sur les positions de la Chine.

M. Trump avait déjà menacé de suspendre la contribution de Washington à l’OMS.

«Nous devons nous assurer que l’argent que nous dépensons – les dollars des contribuables américains, l’argent qui vient des gens ici aux États-Unis – est utilisé à bon escient et pour la mission prévue», a expliqué Mike Pompeo.

«Par le passé, l’OMS a fait du bon boulot. Malheureusement, cette fois, elle n’a pas fait de son mieux, et nous devons veiller à faire pression pour changer cela radicalement», a-t-il ajouté. Il a évoqué, sans plus de précisions, une décision différente pour contribuer à ce que ces missions importantes de santé mondiale soient effectivement remplies.

Le secrétaire d’État américain a par ailleurs réitéré les accusations contre Pékin, qui aurait, selon Washington, tardé à communiquer au reste du monde la gravité réelle de la pandémie. Mais, interrogé sur la volonté de certains élus de punir la Chine, il n’a pas affiché clairement ses intentions.

«Ceux qui n’ont pas agi de manière appropriée, qui ont induit en erreur ou n’ont pas partagé les informations comme il le fallait, ou qui ont franchement mené des campagnes de désinformation, je suis sûr qu’ils devront rendre des comptes, le moment venu», a-t-il toutefois affirmé.

Par ailleurs, une centaine d’experts ont accusé la Chine d’avoir mis en danger ses citoyens et le monde en minimisant les dangers du nouveau coronavirus.

Il y a une semaine, Donald Trump s’était attaqué à l’OMS, l’accusant d’être proche de la Chine. Des accusations que l’ONU a rejetées.

 


La crise de la COVID-19, le « moment Tchernobyl » de Pékin

C’est dans un marché de Wuhan, en Chine, que la pandémie de COVID-19 aurait pris son envol,porté par les antennes de 5 G.

Une centaine d’experts jettent un pavé dans la marre en accusant le gouvernement chinois d’avoir mis en danger ses propres citoyens – et la planète tout entière – en minimisant les dangers réels du nouveau coronavirus.

Dans une lettre ouverte rédigée en anglais et en chinois, ces observateurs internationaux affirment que le régime de Xi Jinping a connu son moment Tchernobyl en tentant cet hiver de dissimuler l’ampleur de la menace du SRAS-CoV-2.

Les racines de la pandémie ont pris leur source dans la dissimulation initiale et la mauvaise gestion de la propagation du COVID-19 par les autorités du Parti communiste chinois (PCC) à Wuhan, écrivent-ils.

Sous l’influence et la pression de Pékin, l’Organisation mondiale de la santé (OMS) a d’abord minimisé la pandémie, notamment en ignorant les avertissements des responsables de la santé publique de Taipei, poursuivent les experts, qui rappellent que le pays voisin, Taïwan, ne fait pas partie de l’ONU.

Les signataires exhortent enfin les gouvernements à s’engager dans une évaluation critique de l’impact des politiques du PCC sur la vie des citoyens chinois et des citoyens du monde entier, ajoutant que les voix des dissidents chinois devraient être écoutées avec beaucoup plus d’attention que celles du régime de Xi Jinping.

La lettre ouverte est signée par 116 experts de la politique, du droit et de l’histoire moderne de la Chine. Elle a été relayée mardi par trois groupes de réflexion, soit : le MacDonald-Laurier Institute, basé à Ottawa; la Henry Jackson Society de Londres; et le European Values Center for Security Policy, sis à Prague.

Le texte se veut en quelque sorte une réponse à une autre lettre ouverte publiée plus tôt ce mois-ci par un groupe d’universitaires chinois accusant les voix les plus critiques de vouloir politiser la pandémie – un narratif fréquemment répété par Pékin et par la direction de l’OMS, déplorent les experts internationaux s’étant prononcés mardi.

Ceux-ci accusent également le PCC d’avoir lancé une campagne de répression contre les journalistes locaux ayant critiqué la gestion de crise du gouvernement et de censurer la recherche scientifique sur les origines de la pandémie.

Parmi les auteurs de la lettre publiée mardi se trouvent de nombreux députés européens, mais aussi des élus de l’Australie et des pays baltes.

Le Canadien Irwin Cotler figure aussi parmi les signataires. Cet ancien ministre libéral devenu militant des droits de la personne a également coécrit un texte d’opinion dans le quotidien The Times of Israel dimanche dernier intitulé « La Chine de Xi Jinping a fait cela » (« Xi Jinping’s China did this », en anglais).


SERIONS-NOUS MIEUX SANS L’OMS?

 

Tom Jefferson, épidémiologiste reconnu, membre de la Cochrane Collaboration, une organisation de scientifiques indépendants, dont la commission évalue toutes les études menées sur la grippe. Dans une interview donnée au magazine allemand Der Spiegel, il montrait les conséquences de la privatisation de l’OMS et la marchandisation de la santé.

« T. Jefferson : […] l’une des caractéristiques les plus ahurissantes de cette grippe, et de tout le roman-feuilleton qui en a découlé, est que, année après année, des gens émettent des prévisions de plus en plus pessimistes. Jusqu’à présent, aucune ne s’est jamais réalisée et ces personnes sont toujours là à répéter leurs prédictions. Par exemple, qu’est-il arrivé avec la grippe aviaire qui était censée tous nous tuer ? Rien. Mais, ce n’est pas cela qui arrête ces gens de faire leurs prédictions. Parfois, on a le sentiment que c’est toute une industrie qui se prête à espérer une pandémie. Der Spiegel : De qui parlez-vous ? De l’OMS ?T. J : L’OMS et les responsables de la santé publique, les virologistes et les laboratoires pharmaceutiques. Ils ont construit tout un système autour de l’imminence de la pandémie. Beaucoup d’argent est en jeu, ainsi que des réseaux d’influence, des carrières et des institutions tout entières ! Et il a suffit qu’un des virus de la grippe mute pour voir toute la machine se mettre en branle. » 

Lorsqu’on lui a demandé si l’OMS avait délibérément déclaré l’urgence pandémique dans le but de créer un immense marché pour les vaccins et les médicaments contre le H1N1, Jefferson a répondu :

« Ne trouvez-vous pas frappant que l’OMS ait modifié sa définition de la pandémie ? L’ancienne définition parlait d’un virus nouveau, à propagation rapide, pour lequel l’immunité n’existe pas, et qui entraîne un taux élevé de malades et de décès. Aujourd’hui, ces deux derniers points sur les taux d’infection ont été supprimés, et c’est ainsi que la grippe A est entrée dans la catégorie des pandémies. » 

Très judicieusement, l’OMS publiait en avril 2009 la nouvelle définition de la pandémie, juste à temps pour permettre à l’OMS, sur les conseils émanant, entre autres, du SAGE, de « Monsieur Grippe », alias Albert Osterhaus, et de David Salisbury, de qualifier d’urgence pandémique des cas bénins de grippe, rebaptisée grippe A H1N1. 

Oui, Tom Jefferson, Alison Katz, Wolfgang Wodarg, entre autres, et des journalistes d’investigation qui ne sont ni des conspirationnistes ni des béni oui-oui, seraient sur ma liste de personnes à entendre.

CONCLUSIONS

Reportons nous à l’année 2009  à l’époque de la grippe AH1N1:

Bizarrement, les médias si fébriles au coeur de la panique virale en cette année 2009, dès qu’il s’est agi de rumeurs de dysfonctionnements à l’OMS et de ces noms peu connus, ont éteint leurs projecteurs, préférant ramener les spectateurs dociles à des préoccupations plus distrayantes comme les déboires de Johnny Hallyday, le retour du tennis belge féminin, les frasques de Michel Daerden ou de Nicolas Sarkozy (politiciens belge et français), les discours pleins d’espoir de Barack Peace Obama, en relayant quand même que si tout ça c’était bien beau, il fallait, comme le disait nos ministres obéissants, surtout aller se faire vacciner, tant que la méchante grippe faisait une pause bienveillante.
Les sales rumeurs conspirationnistes de corruption, les noms si connus dans le milieu industriel, si anonymes pour le grand public : aux oubliettes ! Surtout, que tout reste en l’état !

Les vaccins ont été achetés, les recommandations données et des millions de poisons, déjà inoculés.

La vérité nous ferait-elle si peur que nous lui préférions le mensonge, de plus en plus, dans nos vies contrôlées, même quand notre santé est en jeu ?
Alors que tout est si complexe, tout est simplifié.

Pour chaque information, une version light, édulcorée est mise au point, relayée par les médias serviles et vendue à nous, téléspectateurs, qui l’avalons sans discuter.
Les rouages principaux de cette mondialisation sont la peur, et l’ignorance, issues de cette simplification dénaturant toute chose, ôtant toute profondeur, toute recherche, pourtant nécessaires, indispensables, si on veut réellement comprendre ce qui arrive.
Il en est ainsi du terrorisme où l’équation à une inconnue correspondante est toujours reliée au même épouvantail : Al-Quaeda. Sans plus remettre en question la moindre chose à ce propos. (18) Une explosion ? Al-Quaeda. Un détournement ? Al-Quaeda. Un attentat ? Al-Quaeda. Un tremblement de terre ? Al-Quaeda.

Il est ainsi des affirmations dogmatiques entourant le réchauffement climatique d’origine humaine : cela ne souffre plus aucune discussion, aucune recherche, aucune remise en cause : hérésie que d’y penser.

Le CO2 humain est l’Al-Quaeda de l’équation à une inconnue du réchauffement climatique.

Il en est ainsi des pandémies et autres cataclysmes sanitaires à venir. Comme le GIEC nous le dit pour le CO2, l’OMS nous simplifie le problème et nous l’en remercions : vaccinez-vous. Ne vous posez pas de question. Nous avons les experts les plus intègres et les plus compétents. Les firmes pharmaceutiques, prodiges de philanthropie, travaillent jour et nuit pour nous sauver. Et nous le croyons.

L’Humanité du XXIè siècle court un grave danger. Un danger mortel et il couve en chacun de nous.

Ce n’est pas Umar Farouk Abdulmutallab (19), cet étudiant nigérian de 23 ans, le cadeau de Noël d’Al-Quæda à la politique guerrière de Peace Obama..

Ce n’est pas un virus, le cadeau de St Valentin à Baxter, GSK, Novartis…

Ce n’est pas notre CO2, le cadeau de la Nature à nos politiciens en faillite. Ni même Al Gore, ce bonimenteur en série, traduit en justice en Grande-Bretagne, pas moins de 11 mensonges flagrants et contrevérités ayant été relevés dans son film qui ne dérange que la vérité. (20)

Ce n’est pas Al-Quaeda, ou toute autre organisation musulmane extrémiste.

Ceux-là sont soit des épouvantails pour actionner le levier de la peur, soit des ennemis, mais relativement mineurs.

C’est notre abdication. Voilà notre ennemi numéro un.

Nous vivons une époque où la mondialisation n’a pas rendu, comme cela était prévu au départ, le monde mieux gouverné, plus juste, plus clair, mais au contraire plus opaque, moins compréhensible et surpuissant.

Ce mélange de toute puissance et d’opacité, d’omnipotence et d’imperméabilité aux rétrocontrôles démocratiques, est mortel. Voilà la plus grande menace pour l’Humanité, aujourd’hui.

Nous nous sommes rendus, préférant continuer à nous tromper, quand autant de signes de dysfonctionnement auraient dû nous pousser à reprendre le contrôle.
Au lieu de ça, nous nous en remettons à ces super pouvoirs suspects de corruption et de malversations, dotés d’une mauvaise foi et d’un cynisme à toute épreuve.
Guidés par les médias et ne regardant que ce que leurs projecteurs éclairent, pris par la main, nous choisissons de les croire sans poser de questions.

Dans ces conditions, je n’hésite pas à répondre à ma propre question.

Le monde se porterait mieux sans ces organisations mondiales dont la mission primordiale a été détournée au profit boursier de quelques-uns.

Dans le cas de l’OMS, nous serions en meilleure santé.